ID: 1108408035

View in Genome Browser
Species Human (GRCh38)
Location 13:50124397-50124419
Sequence TGCCCACTCAAACTGCGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108408029_1108408035 -9 Left 1108408029 13:50124383-50124405 CCCCTCTCTCCCTCTGCCCACTC 0: 2
1: 1
2: 46
3: 319
4: 2396
Right 1108408035 13:50124397-50124419 TGCCCACTCAAACTGCGAAAGGG 0: 1
1: 0
2: 1
3: 4
4: 85
1108408030_1108408035 -10 Left 1108408030 13:50124384-50124406 CCCTCTCTCCCTCTGCCCACTCA 0: 1
1: 0
2: 15
3: 193
4: 1630
Right 1108408035 13:50124397-50124419 TGCCCACTCAAACTGCGAAAGGG 0: 1
1: 0
2: 1
3: 4
4: 85
1108408028_1108408035 3 Left 1108408028 13:50124371-50124393 CCAGAAGGAAAACCCCTCTCTCC 0: 1
1: 0
2: 2
3: 33
4: 239
Right 1108408035 13:50124397-50124419 TGCCCACTCAAACTGCGAAAGGG 0: 1
1: 0
2: 1
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108408035 Original CRISPR TGCCCACTCAAACTGCGAAA GGG Intronic
907596761 1:55727281-55727303 TGCCCACTGCACCTGGGAAAGGG - Intergenic
908271748 1:62429245-62429267 TACACACTCACACTGAGAAAGGG + Intergenic
911157421 1:94651237-94651259 TGCCCACATAAACTACGTAAGGG - Intergenic
918876714 1:190055776-190055798 TGTCAACTCAATCTGAGAAAGGG + Intergenic
922705323 1:227787539-227787561 TTCCCACTCATGCTGCAAAATGG - Intergenic
1068496579 10:57790946-57790968 TACCCACGCAAACTGGAAAAAGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069251749 10:66275736-66275758 TTCATACTCAAACTGCTAAAGGG - Intronic
1070350383 10:75586291-75586313 TGCCCACTAACACTGTGCAAGGG + Intronic
1073350430 10:102815779-102815801 TCCCCACTCTAACTGGGGAAAGG - Exonic
1075031358 10:119026751-119026773 TGCCAACACAAACTTGGAAAAGG + Intergenic
1083252619 11:61478035-61478057 TGCCCCCTCCACCTGCTAAAAGG + Intronic
1084507995 11:69581670-69581692 TGCCCACTCACACTGCGTGACGG + Intergenic
1085417377 11:76328330-76328352 TTCCCACCCAATCTGTGAAATGG + Intergenic
1088223902 11:107598392-107598414 TGCCCACCCACACTGGGAAGGGG + Intronic
1093844189 12:23948923-23948945 TGGCCACTAAAACTTAGAAAGGG + Intronic
1094041957 12:26127502-26127524 TACCTACTCAAACTGCAAATGGG + Intronic
1094569199 12:31627046-31627068 TGACAACTAAAACTGGGAAATGG - Intergenic
1096113844 12:49043716-49043738 GGCCCACCCCAACTGCAAAAAGG + Exonic
1097358454 12:58629820-58629842 TGACCACAAAAACTGGGAAAAGG + Intronic
1099983344 12:89632769-89632791 TTCCCACCCATACTGCGATAAGG + Intronic
1101388698 12:104280429-104280451 GGCACGCTCAAACTGCAAAAGGG - Intronic
1108408035 13:50124397-50124419 TGCCCACTCAAACTGCGAAAGGG + Intronic
1108715486 13:53074242-53074264 TCCCCTCTCTATCTGCGAAATGG - Intergenic
1111344531 13:86933319-86933341 TCCCCACTCTAACTGGGGAAAGG + Intergenic
1116661948 14:47721530-47721552 TGCCCACTCAGACTGAGAGTGGG + Intergenic
1117871295 14:60203409-60203431 TGCCCACTGAAACAGAGAAATGG - Intergenic
1118504733 14:66398890-66398912 TGACCACTCAAACCTTGAAATGG + Intergenic
1125906989 15:43401900-43401922 TGTCAACTCAAACTGCCTAAGGG - Intronic
1126119361 15:45237644-45237666 TGCCCATACAAAATGAGAAAAGG + Intergenic
1128630795 15:69264645-69264667 TTCCCACCCAAAGTGCGCAAGGG + Intronic
1129198977 15:73987381-73987403 TGCTCACTCAGTCTGGGAAATGG + Intronic
1129999859 15:80036965-80036987 TGCCAAATGAAAATGCGAAAAGG + Intergenic
1130173804 15:81546660-81546682 TGCCTACTCAATCTGTCAAATGG + Intergenic
1132765389 16:1531843-1531865 TCCCCACTCAACCTGAGGAAAGG + Intronic
1135076297 16:19396731-19396753 TGCCCATACAAAATGAGAAAAGG + Intergenic
1135934505 16:26768273-26768295 TGCCCACTCAACCTCAGAATAGG + Intergenic
1142065136 16:88057976-88057998 TGCCCCCTTAAACTATGAAACGG + Intronic
1144089599 17:11842789-11842811 TGCCCACCCAAACTGAGAGTGGG + Intronic
1148953833 17:51337215-51337237 TGCACACTCACACTGAGAACGGG - Intergenic
1153507407 18:5815450-5815472 TGCTCAAGCAAACTGAGAAAAGG + Intergenic
1160058523 18:75509014-75509036 TCCCCACCCAAACTGTGAGAGGG + Intergenic
1160814003 19:1027042-1027064 CGCCCACTCAACCTTCGAGAAGG + Intronic
1163183098 19:15617826-15617848 TGCCCACACAGACTGGGAAGGGG + Intronic
1164921528 19:32092119-32092141 TGCCCAGTCACTCTGTGAAATGG + Intergenic
930049913 2:47207047-47207069 TGCTCACACAAAGTGAGAAATGG - Intergenic
932418002 2:71585379-71585401 TGCCCATTCAAGTTGTGAAATGG - Intronic
932433323 2:71688259-71688281 ACCCCACTCAAGCTACGAAAGGG + Intergenic
938210919 2:129465145-129465167 TGCTCACTTCTACTGCGAAATGG + Intergenic
939780407 2:146439452-146439474 TGCTCACTCAAACTACAAGAAGG + Intergenic
944163654 2:196693712-196693734 TTCCCCCTAAAACTGGGAAAAGG - Intronic
1170859048 20:20085922-20085944 TCCCCACTTAACCTGCCAAAAGG - Intronic
1176874634 21:14115901-14115923 TCCCCACTCACACTGGAAAAAGG + Intronic
1177275005 21:18899176-18899198 TGCCCACTAAAACAAAGAAATGG - Intergenic
1178261840 21:31106974-31106996 TGCCTAGTGAAACTGTGAAAAGG - Intergenic
1179206748 21:39288168-39288190 TGCACACTCAAACTGCCCTATGG - Intronic
954457921 3:50610030-50610052 TGACCACTCACAGTGAGAAAGGG + Intronic
955978381 3:64499520-64499542 TGCCCACTCAGACTGAGGGAGGG + Intergenic
969452310 4:7281643-7281665 TGCCCACACAAACGGCCCAATGG - Intronic
971836512 4:31771012-31771034 TCTCCTCTCAAACTGCCAAAGGG - Intergenic
972178164 4:36433124-36433146 TGCCCACCCAGACTGAGAATGGG + Intergenic
975365058 4:73519501-73519523 TGCCCACCAGAACTGCTAAAAGG - Intergenic
975984542 4:80190233-80190255 TGACCACTTAACCTGCGGAAAGG - Intronic
976225795 4:82795025-82795047 TGCCCACTCATAAAACGAAAAGG + Intronic
976538781 4:86248669-86248691 TGCCCACCTAAACTGAGAATCGG + Intronic
977311578 4:95394418-95394440 TACCCACCCTAACTGCCAAAGGG + Intronic
978275783 4:106948064-106948086 TGCCCACTCAAACTGCTGAATGG - Intronic
979168139 4:117562771-117562793 TGCACACTCAAACTTCCATATGG + Intergenic
979892961 4:126122749-126122771 TGGCAACATAAACTGCGAAAAGG + Intergenic
981765075 4:148239817-148239839 TGTCCACAAAAACTTCGAAAAGG - Intronic
984332514 4:178343437-178343459 TGTCCACTAATACTGAGAAAAGG + Intergenic
985691137 5:1313282-1313304 TGCACATTTAAACCGCGAAAAGG + Intergenic
990109742 5:52308403-52308425 AGCCCAGTCAAAGTGAGAAAAGG - Intergenic
995922234 5:117328253-117328275 TGTGAACTCAAACTGGGAAAAGG + Intergenic
1010921709 6:81690538-81690560 TGCCCACACACACAGCCAAAAGG - Intronic
1017090025 6:150750901-150750923 TGTCCAGTCAAACAGGGAAATGG - Intronic
1021048559 7:15953983-15954005 TGCCCTCTCACACTGGGTAAGGG + Intergenic
1023143508 7:37126367-37126389 TGCCGAATCAAACAGAGAAAAGG + Intronic
1030267123 7:107632003-107632025 TCCCCACTCTAACTGGGGAAAGG - Intergenic
1030422072 7:109319870-109319892 TGCCAACTGATACTGTGAAATGG - Intergenic
1032416276 7:131737743-131737765 AGCCCTCTCAAACAGCTAAAGGG - Intergenic
1037703631 8:21297009-21297031 TTCCCCCTCAAACCCCGAAACGG + Intergenic
1038330715 8:26606915-26606937 TGAACACTCAAACTGCGGATAGG + Intronic
1045267174 8:100629450-100629472 GGCCCAGTCAACCTGAGAAATGG - Intronic
1048634828 8:136284548-136284570 TGCCCACTCAGACTGAGAGTGGG + Intergenic
1049876881 8:145029559-145029581 TGCCCACACAAAATGAGAAAAGG - Intergenic
1049933922 9:482469-482491 TGCCAACTCAACCTCCAAAATGG + Intronic
1055625235 9:78169710-78169732 TGCCCACTGACCCTGCTAAAAGG + Intergenic
1056832175 9:89925728-89925750 TGCCCACTCACATTGCAGAATGG - Intergenic
1061200389 9:129134946-129134968 TTCCTCCTCAAACTGGGAAATGG + Intronic
1198126822 X:133653108-133653130 TGACCACTCAAATTACGAAATGG + Intronic