ID: 1108408870

View in Genome Browser
Species Human (GRCh38)
Location 13:50128220-50128242
Sequence TAAGCTGACCAGATTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108408870_1108408874 -10 Left 1108408870 13:50128220-50128242 CCAACCCCAATCTGGTCAGCTTA 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1108408874 13:50128233-50128255 GGTCAGCTTAAAAGTGTCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1108408870_1108408880 22 Left 1108408870 13:50128220-50128242 CCAACCCCAATCTGGTCAGCTTA 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1108408880 13:50128265-50128287 CTTTCCCAGCGAACCAACACTGG 0: 1
1: 0
2: 1
3: 123
4: 3361
1108408870_1108408883 30 Left 1108408870 13:50128220-50128242 CCAACCCCAATCTGGTCAGCTTA 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1108408883 13:50128273-50128295 GCGAACCAACACTGGCAGATTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108408870 Original CRISPR TAAGCTGACCAGATTGGGGT TGG (reversed) Intronic
902970381 1:20043957-20043979 TAAGCTGAGCAGATCTGGGAAGG + Intronic
903305042 1:22407470-22407492 TAAAATGACCAGGTTGGGGGAGG + Intergenic
904271126 1:29350707-29350729 AAAGCTGACCATAATGGTGTTGG - Intergenic
904385771 1:30140994-30141016 GAAGCTGACCAGGTTGCGGGTGG + Intergenic
906106508 1:43296938-43296960 TAAACTTGCCAGACTGGGGTGGG - Intergenic
906293262 1:44633463-44633485 TAAGCTTACCAAAGTGTGGTAGG - Intronic
907048346 1:51313580-51313602 GAATGTGACCAGATGGGGGTGGG - Intronic
907407937 1:54265175-54265197 GAAGCTGACCAGATGGGGGGAGG + Intronic
908965871 1:69762160-69762182 TAAAATGACCAGATTGGCCTAGG - Intronic
909729470 1:78874728-78874750 TAAGCTGAGCAGATCTGGGAAGG - Intergenic
910187143 1:84556414-84556436 TAAGATGACCACTTTGGGGCCGG + Intronic
910244434 1:85123429-85123451 TAAAATGACCAGATTGCTGTCGG + Intronic
912546851 1:110457227-110457249 TCCTCTGTCCAGATTGGGGTGGG + Exonic
915528971 1:156492632-156492654 TTAGATGACCAAATTGGGTTAGG - Intronic
915553606 1:156648926-156648948 TAAACTGATCAGACTGGGGTAGG - Intronic
919171729 1:193962484-193962506 TTTGCAGAACAGATTGGGGTGGG + Intergenic
921269975 1:213458950-213458972 GAAGCTGACTTGATTGTGGTGGG + Intergenic
923307139 1:232698658-232698680 AAATCTGACCAGTTTGGGGCCGG - Intergenic
1069868050 10:71516259-71516281 TCAGGTGACCAGCTTGAGGTGGG + Intronic
1073708251 10:106011137-106011159 TAAGCTGTGCAGTCTGGGGTTGG + Intergenic
1074889264 10:117721527-117721549 AATGCTGACCAGATTTGGGAGGG + Intergenic
1075487905 10:122841118-122841140 AACTCTGACCACATTGGGGTGGG - Intronic
1079093699 11:17497557-17497579 GAAGCTGACCAGATGGGCCTGGG - Intronic
1079516961 11:21281009-21281031 TAAGCTGTGCAGCCTGGGGTTGG - Intronic
1079987967 11:27218143-27218165 TAAACTAACAAGATTGGGGGAGG + Intergenic
1081020847 11:37946845-37946867 AAAGCTGTCCATATTGGGCTTGG - Intergenic
1081159742 11:39736842-39736864 TAAGCTGAGCAGATCTGGGAAGG - Intergenic
1084787094 11:71448638-71448660 CCAGCTGACCAGCTGGGGGTGGG + Intronic
1086899225 11:92347484-92347506 TAAGCAGACCAGATTAATGTTGG + Intergenic
1089717028 11:120370360-120370382 TAATCTGAACAGTTTGGTGTCGG - Intronic
1092442835 12:8524044-8524066 GAAGCTGACTTGATTGTGGTGGG + Intergenic
1094316010 12:29138277-29138299 TAAGCTGAGAAGATTGGGGAAGG + Intergenic
1096868003 12:54576615-54576637 AAAGCTGACCACATCAGGGTTGG - Exonic
1097565393 12:61263042-61263064 GAAGCTGACTTGATTGTGGTGGG - Intergenic
1097592459 12:61589692-61589714 TAAGCTGAGCAGATCTGGGAAGG - Intergenic
1102678341 12:114673500-114673522 TAGGCTGGCCTGCTTGGGGTTGG + Intronic
1103053874 12:117803381-117803403 TAAGCTCCCCAGCATGGGGTCGG - Intronic
1104103211 12:125634867-125634889 TAAGCTGTACAGCCTGGGGTTGG + Intronic
1106367077 13:29091738-29091760 TAAGATTATGAGATTGGGGTAGG - Intronic
1106906118 13:34410979-34411001 AAAGCTGAATAGATTGGAGTTGG + Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1108425638 13:50296665-50296687 TAAGCTGACTTGATTTTGGTAGG + Intronic
1109506681 13:63311430-63311452 TGAGCTGTACAGGTTGGGGTTGG - Intergenic
1113541326 13:111112087-111112109 AAAGCTCACCACATTGGGGAGGG + Intergenic
1116832449 14:49734987-49735009 TAAGCAGACAAAAATGGGGTTGG + Intronic
1117221948 14:53615324-53615346 TAAGGTGAACAGATTGAGGCAGG + Intergenic
1118113011 14:62743777-62743799 GAAACTGCCCAGATTGGGGGTGG - Intronic
1118903837 14:70008835-70008857 TAAGGCTACCAAATTGGGGTTGG + Intronic
1121752238 14:96366765-96366787 TAAGCTGACAATATTCGGTTGGG - Intronic
1125592056 15:40860796-40860818 TAAGATGAGCAGATGGGTGTGGG + Intergenic
1126074825 15:44899008-44899030 TAAACTGACTAGACTGGGATGGG - Intergenic
1126083540 15:44988807-44988829 TAAACTGACTAGACTGGGATGGG + Intergenic
1128946282 15:71824138-71824160 TAATCTGCCAGGATTGGGGTGGG - Exonic
1131953418 15:97705904-97705926 TAAGCTTACAAAATAGGGGTGGG + Intergenic
1132605022 16:790054-790076 TAAGCTGGCCAGTGAGGGGTGGG - Intronic
1132956594 16:2597578-2597600 GCAGCTCACCAGGTTGGGGTGGG + Intronic
1134769033 16:16788655-16788677 TAAGCTGACCATATTTGTGTGGG + Intergenic
1137628026 16:49921818-49921840 TCAGGTCACCAGATTGGGGAGGG - Intergenic
1141084442 16:81081823-81081845 TATGCTGATAATATTGGGGTGGG - Intergenic
1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG + Intergenic
1142119836 16:88381850-88381872 GAGGCAGACCAGATTGGGGGAGG + Intergenic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1148123091 17:45223639-45223661 TGAGCTGAGCAGATGGGGGAGGG + Intronic
1148542281 17:48490334-48490356 TAAGTAGACTAGATTTGGGTGGG + Intergenic
1149139383 17:53411967-53411989 GAAGCTGACTTGATTGTGGTGGG + Intergenic
1149631213 17:58125789-58125811 TAACCTGTCCAGTTTGTGGTAGG - Intergenic
1152746713 17:82043689-82043711 TAAGACGACCGGATGGGGGTGGG + Intergenic
1152797510 17:82315484-82315506 AAAGCTGACCGGAGTGGGGTGGG - Intronic
1153014845 18:574130-574152 TAAGTGGAGCAGATAGGGGTTGG + Intergenic
1153651545 18:7245462-7245484 TAAGCTGAGCAGATTGAGTGAGG - Intergenic
1156684208 18:39624979-39625001 GAAGCTGATTAGGTTGGGGTAGG - Intergenic
1158794413 18:60825883-60825905 TATGCTGTCCAGATTGAGTTTGG - Intergenic
1161302024 19:3547436-3547458 CAAGGTGAGCAGATTGGGGCGGG - Exonic
1162658944 19:12154761-12154783 TCAGTTGACTTGATTGGGGTGGG - Intronic
1163754746 19:19100022-19100044 TAATATGACCAGAGTGGGGCTGG - Intronic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1164387363 19:27785214-27785236 TAAGCTGACTATATTTGTGTGGG - Intergenic
1165334321 19:35158376-35158398 TCAGCAGGCCAGGTTGGGGTTGG - Exonic
1166648040 19:44547357-44547379 TAAGCAGACCAGAGTGAGGTTGG + Intergenic
925239585 2:2312167-2312189 TAAGCGGAACAGAATGGGGAGGG - Intronic
929386257 2:41410984-41411006 CAAGCAGACCAGATTGACGTGGG + Intergenic
930099043 2:47588935-47588957 TAAGCTGAGCAGATCTGGGAAGG + Intergenic
931418702 2:62105526-62105548 TTAAATGACCAGATTGGGCTGGG + Intronic
932277541 2:70462818-70462840 AAAGCTGACCATCTTGGGGGAGG - Intronic
935815921 2:106845629-106845651 CAAGGTGACCACATTGAGGTAGG - Intronic
938586543 2:132696224-132696246 TAAGCAGTACAGATTGTGGTTGG + Intronic
941150845 2:161914124-161914146 TGAGCTGACCAAATTTGGCTAGG - Intronic
944126557 2:196300160-196300182 TAGGCTGTCTAGACTGGGGTGGG + Intronic
945014332 2:205499184-205499206 CTAGCTGAGCAGTTTGGGGTTGG + Intronic
1175327159 20:58137788-58137810 GAAGCTGACCAGGTTAGGGAGGG + Intergenic
1177479807 21:21671603-21671625 TAAGATAACCAAATTGGGGTGGG + Intergenic
1179308242 21:40174312-40174334 TAAACTGAGTAGTTTGGGGTTGG + Intronic
1181692861 22:24575144-24575166 AAACCAGTCCAGATTGGGGTGGG - Intronic
952895176 3:38073931-38073953 TAAGCTGAGCAGATCTGGGAAGG + Intronic
954089456 3:48272894-48272916 AAAGCTGACGAGAATGGGGTAGG - Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
958626701 3:96634824-96634846 TAAGCTGTCCAGATAGAGATAGG - Intergenic
959641972 3:108649669-108649691 TGGGCTCACCAGATTGTGGTTGG - Intronic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
962230291 3:133659647-133659669 TAAGCAGACCTGATTGAAGTGGG - Intronic
962511062 3:136101105-136101127 TAAGCAGCCCAGATTAGAGTAGG + Intronic
963627616 3:147692948-147692970 TAAGGTCACAGGATTGGGGTGGG - Intergenic
970549882 4:17168722-17168744 TAAACTGACCAGGATGGGGGAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977878917 4:102181925-102181947 TAATCTCACCAGATGGGGTTTGG - Intergenic
978609878 4:110525935-110525957 TAAGGTGAGCAAATTGGTGTGGG + Intronic
978782144 4:112567231-112567253 GGAGCTGACCAGATTGGGATGGG + Intronic
979530272 4:121763616-121763638 GAAGCTCACCAGATTTGAGTGGG + Intronic
979542506 4:121901455-121901477 TTAACTGACCAGTGTGGGGTAGG - Intronic
979977018 4:127209472-127209494 TAAGCTGACTTGATTGTGGTGGG + Intergenic
981201848 4:141989362-141989384 AAAGCTGACTCGATTGTGGTAGG + Intergenic
981748983 4:148075420-148075442 TAAGCTGAGCACAGTAGGGTTGG + Intergenic
984165318 4:176298122-176298144 TAAGCTGAGAAGATTGGGGAAGG + Intergenic
985799555 5:1995624-1995646 GATGCTGGCCTGATTGGGGTGGG + Intergenic
986632058 5:9783353-9783375 TAAGCTGACCAGATGCTGTTAGG - Intergenic
990821155 5:59841780-59841802 GAAGTTAACCAGATTGGGGGAGG + Intronic
996943793 5:129042787-129042809 TCAGCTGAACATAGTGGGGTAGG - Intergenic
999875955 5:155805939-155805961 GAAGCAGACCATATTGGGGCTGG + Intergenic
1000268607 5:159661342-159661364 TAAGTTGACAAGGTTGGGGGAGG + Intergenic
1006835143 6:36993913-36993935 TAAGATGGCCAGATTTGGCTGGG - Intergenic
1007708296 6:43804910-43804932 TCAGCTGAGCAGATTTTGGTGGG + Intergenic
1018077637 6:160230932-160230954 TAAGCTGAGCAGATCTGGGGAGG - Intronic
1020932782 7:14420461-14420483 CAAACTGAGCAGATTTGGGTGGG + Intronic
1025148910 7:56530541-56530563 TAAGCTGACTATATTAGTGTGGG - Intergenic
1028500419 7:91513215-91513237 TGAAGTGACCAGATTGCGGTTGG + Intergenic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031466814 7:122123256-122123278 TAAGCTGAGGAGATAGGAGTTGG - Intronic
1032848875 7:135775370-135775392 TAAGCTGAGAAGACTGGGTTAGG + Intergenic
1033682455 7:143608233-143608255 TTAGCTGACCGGCTGGGGGTAGG - Intergenic
1033702434 7:143853680-143853702 TTAGCTGACCGGCTGGGGGTAGG + Exonic
1034395551 7:150821533-150821555 AAAGGTGACCAGATTGTGCTGGG - Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1042985083 8:74574426-74574448 TAAGATTACTAGATTGGGGATGG - Intergenic
1043597414 8:81901809-81901831 TAAGCTGAGAAGATTTGGGAAGG + Intergenic
1043752515 8:83956889-83956911 TAGGCAGACAAGATTGTGGTGGG + Intergenic
1043850237 8:85208031-85208053 TAAAATGACCACATTGGGCTGGG + Intronic
1052787852 9:32846348-32846370 AAAGCTGAACTGCTTGGGGTAGG + Intergenic
1056087545 9:83166669-83166691 TCAGGTGACCAGGCTGGGGTGGG - Intergenic
1057439955 9:95075925-95075947 TAAGCTGCCCCGATGGGGATGGG + Intronic
1059479329 9:114576197-114576219 TGAGGTGTCCACATTGGGGTAGG - Intergenic
1059889339 9:118784112-118784134 TAAGCTGAACAGATAGGAGTTGG + Intergenic
1060871341 9:127043298-127043320 TCAGCTGACCATATTTGTGTAGG - Intronic
1061590776 9:131596263-131596285 TGAGCTCACTAGATTGGGGCTGG - Intronic
1187571943 X:20513350-20513372 CAAGCTTACCAAAGTGGGGTGGG - Intergenic
1190454205 X:50610185-50610207 TGAGCTGACCAGAATGGGGGAGG - Intronic
1197508936 X:127346676-127346698 TGAGCTGTGCAGCTTGGGGTTGG + Intergenic
1198637092 X:138712033-138712055 TGAGCTGACCAGATTGTGCTCGG + Intronic
1198664067 X:139002576-139002598 CAAGCTGTACAGCTTGGGGTTGG - Intronic
1201937168 Y:19421407-19421429 TAAGCTGAGCAGATCTGGGAAGG - Intergenic
1202076490 Y:21042356-21042378 TAAGCTGAGCAGATCTGGGAAGG + Intergenic
1202349368 Y:23971422-23971444 TAAGTTTAACAGATTGGGGCAGG + Intergenic
1202521407 Y:25698682-25698704 TAAGTTTAACAGATTGGGGCAGG - Intergenic