ID: 1108411131

View in Genome Browser
Species Human (GRCh38)
Location 13:50148253-50148275
Sequence ACCTCCTGCTGCAGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108411131_1108411137 28 Left 1108411131 13:50148253-50148275 CCTCCTGCTCTGCAGCAGGAGGT 0: 1
1: 0
2: 2
3: 39
4: 367
Right 1108411137 13:50148304-50148326 GACTTTCTTTCAGTACCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1108411131_1108411135 25 Left 1108411131 13:50148253-50148275 CCTCCTGCTCTGCAGCAGGAGGT 0: 1
1: 0
2: 2
3: 39
4: 367
Right 1108411135 13:50148301-50148323 TCCGACTTTCTTTCAGTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108411131 Original CRISPR ACCTCCTGCTGCAGAGCAGG AGG (reversed) Intronic