ID: 1108415386

View in Genome Browser
Species Human (GRCh38)
Location 13:50193199-50193221
Sequence GAGCTGATTGTTAAGTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108415386 Original CRISPR GAGCTGATTGTTAAGTTTAG GGG Intronic
903843948 1:26265641-26265663 GAGCTGATACTTCAGTTCAGAGG + Intronic
904707356 1:32401357-32401379 GAGCTGATTGTTAACATTTCAGG + Intergenic
908772346 1:67608674-67608696 GAGCTGATGGTTAAATTTCCAGG - Intergenic
908951105 1:69564330-69564352 GAACAGATTGTTAATTTGAGAGG + Intergenic
909814548 1:79975672-79975694 GAGCTGATTGTTAAATTTTCAGG - Intergenic
911755628 1:101551250-101551272 AAGCTGAATGTGAAGATTAGTGG + Intergenic
911840994 1:102681711-102681733 GAGCTGATTGATGAGTATATGGG - Intergenic
912984062 1:114408569-114408591 AAGCTGAGTGTTAAGTATAAAGG + Intronic
913244743 1:116861652-116861674 GAACTGATTGTTAAATTTTCAGG + Intergenic
916246312 1:162691733-162691755 GAGCTGATTATTAAATTTTCAGG - Intronic
918966113 1:191350925-191350947 GAGCTGAAGGTTAAAATTAGGGG + Intergenic
920277703 1:204819783-204819805 GAGCTGATTGTTAAATTTTCAGG + Intergenic
922019864 1:221692713-221692735 GAGCTGATTGTTAAATATTTTGG + Intergenic
922321424 1:224491381-224491403 GAACTGATTGTTAAATTTGTAGG + Intronic
922563653 1:226587216-226587238 GAGCTAATAATTAATTTTAGTGG - Intronic
923106773 1:230860037-230860059 GAGCTGATTGTAAAATTTTGAGG + Intronic
923303838 1:232670004-232670026 GAGCTGAATGTTAAATATATTGG - Intergenic
923943576 1:238856985-238857007 GGGCTGATTGTATATTTTAGTGG + Intergenic
1066383806 10:34924281-34924303 GAGCCCATTGTTAAGTTTTCAGG + Intergenic
1070976081 10:80606701-80606723 GAGCTGACTGTTAAATTTTCAGG - Intronic
1073297396 10:102449587-102449609 GAGATCATTGTTATGTTTTGGGG - Intergenic
1078344609 11:10535698-10535720 GAGATTTTTGTTAAGTTTTGGGG - Intronic
1078585681 11:12586412-12586434 GAGCTGATTGTTAAATTTTTAGG - Intergenic
1079303440 11:19300222-19300244 GAGATGATTGTTAAATTTGCAGG + Intergenic
1080550035 11:33366283-33366305 GAGCCAATTGTTAAATTTACAGG - Intergenic
1081452684 11:43187222-43187244 AAGCAGATTGGTAAGTTTAGTGG - Intergenic
1081842498 11:46213125-46213147 GACCTGATTACTAACTTTAGGGG - Intergenic
1084026628 11:66454526-66454548 GAGCTGTTTGTCAAGTTTTGAGG - Intronic
1085325219 11:75601529-75601551 GACCTGATTGCTGAGTTTTGGGG - Intronic
1087209809 11:95435756-95435778 GAGCTGATTGTTAAATTCTCAGG - Intergenic
1088049557 11:105494898-105494920 GAGCTGATTGTAAAATAGAGTGG + Intergenic
1088983517 11:114885804-114885826 GAGCTGTTTGTTAAATTTAGGGG - Intergenic
1089168184 11:116493732-116493754 GAGCTGAGTGGTAAGTTCTGGGG + Intergenic
1090823412 11:130365472-130365494 GAGCTGATTGTTACGTTTTCAGG + Intergenic
1093633110 12:21433622-21433644 GAGCTGATTGTTAAAATTTTAGG - Intergenic
1095493694 12:42762415-42762437 GAGCTGACTGTTAAATTTGCAGG + Intergenic
1098837244 12:75438220-75438242 GAGCTGTCTGTTAAGGTTTGAGG - Intergenic
1099177967 12:79443723-79443745 AAGCCAATTGTTAAGCTTAGTGG + Intronic
1100036324 12:90256935-90256957 GAGCTGATTGTTAAATATTCAGG + Intergenic
1100931380 12:99613847-99613869 GACTTTATTTTTAAGTTTAGGGG - Intronic
1101423405 12:104567687-104567709 GAGCTGTGTGCAAAGTTTAGAGG + Intronic
1102494776 12:113312018-113312040 GAGCTGAGTGTTAAGCAGAGAGG + Intronic
1102667170 12:114584771-114584793 GAATTGATAGTTAAGTCTAGGGG - Intergenic
1104290853 12:127465618-127465640 GAGCTGACTCTTATGTTTATGGG + Intergenic
1104526274 12:129526001-129526023 GAGCTGATTGTTTCATTTAGTGG + Intronic
1107611076 13:42113601-42113623 GAGCTGATGGGAAAGTTTGGAGG + Intronic
1108415386 13:50193199-50193221 GAGCTGATTGTTAAGTTTAGGGG + Intronic
1108460280 13:50659449-50659471 GAGCTGATTGTTAAAGTTTCAGG + Intronic
1108921398 13:55679140-55679162 CAGTTGATTTTTAAGTGTAGGGG + Intergenic
1110647908 13:77910105-77910127 GAGAGGATTGTTAAGTTTCGTGG + Intronic
1110732308 13:78893245-78893267 GATCTAACTGTTTAGTTTAGGGG + Intergenic
1111050790 13:82881514-82881536 GACATGATTGTTAAGTTTCCTGG + Intergenic
1111125148 13:83905857-83905879 GAGCTAATTGGTCAGGTTAGAGG + Intergenic
1111938091 13:94578600-94578622 GAAATGATTCTTAAATTTAGTGG + Intronic
1112489891 13:99852678-99852700 GAGCTGATTGATGAGTATATGGG - Intronic
1114184498 14:20389969-20389991 GAGCTGATTGTTAAGTTTTCAGG + Intronic
1114842600 14:26282787-26282809 GAGCTGACTGTTAAATTTTCAGG - Intergenic
1115682529 14:35757418-35757440 CAGCTGATTGTTAAAATTTGTGG - Intronic
1118654449 14:67932376-67932398 GAGCTTATAGTGAAGTTTGGTGG + Intronic
1120740885 14:88107587-88107609 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1121079815 14:91098593-91098615 GAGCTGAGTGTTAAATTTTTGGG - Intronic
1122853913 14:104551128-104551150 GAGCTGATTGCTAAGGGTGGTGG - Intronic
1124392738 15:29274312-29274334 GAGAAGATTATTAAGTTTTGAGG + Intronic
1124952827 15:34339046-34339068 CAGGTGATTGTTAAATTTAGAGG - Intergenic
1125295736 15:38201213-38201235 GATCTGTTTGTTAATTTTACTGG - Intergenic
1125327598 15:38552773-38552795 GAGCAGATTGTTAAATTTTCAGG - Intronic
1125369530 15:38956936-38956958 GAGCTGATTGCTAAGTTTTCAGG + Intergenic
1125821816 15:42638277-42638299 GACCTGCTTGTTAAGTCTATGGG - Intronic
1128205836 15:65851353-65851375 GAACTGATTGTTAAATTTTCAGG + Intronic
1129915680 15:79267842-79267864 GAACTGATTGTTAAGTTTCCTGG + Intergenic
1133112740 16:3558448-3558470 AAGCTGATTGTTAAATTTTCAGG - Intronic
1134004213 16:10806999-10807021 GAGCTGATTGTTTAATTTTAAGG - Intronic
1135051667 16:19198098-19198120 GAGCCAATTGTTAAGTTTTCAGG + Intronic
1135687845 16:24512671-24512693 CAGCTGCTTGTTCAGTTCAGGGG - Intergenic
1136416165 16:30105113-30105135 GAGCTGATTGTTAAATTCTCAGG + Intronic
1138742150 16:59323462-59323484 GAGCTAACTGTTAAGTTTTCAGG + Intergenic
1143265905 17:5637415-5637437 GAGCTGATTATTAAATTTTTAGG + Intergenic
1143867314 17:9933442-9933464 GAGCTGAATGTTAAATTTTCAGG + Intronic
1144811929 17:18006095-18006117 GAGCTGGTTGCTAAATTTTGAGG + Intronic
1145838481 17:27973204-27973226 GAGCTAATTGTTAAATTTTCAGG + Intergenic
1147449474 17:40495064-40495086 GAGCTGATTGTTAAATTTTCAGG + Intronic
1147992200 17:44341376-44341398 GAGCTGATGGTTAAGTCTGAGGG - Intergenic
1149118919 17:53137244-53137266 GGGCTGAATCTTAGGTTTAGGGG + Intergenic
1153152124 18:2107366-2107388 GAGCTGGTTGTTTAGCTTGGTGG + Intergenic
1153767411 18:8387531-8387553 GAGCCAATTGTTAAGTTTTCAGG + Intronic
1157641028 18:49214627-49214649 GGGCTAATTGTTAATTTTGGTGG + Intronic
1165797580 19:38527871-38527893 GAGATGACTATTAAGTTTTGGGG + Intronic
927024391 2:19050451-19050473 GAGTGGATTGTTTAGGTTAGAGG - Intergenic
928763352 2:34610858-34610880 GATCTCATTGTTAAATTTATTGG + Intergenic
931871411 2:66464329-66464351 GAGCTGATTCTCAAGTTAAAGGG - Intronic
932217163 2:69974485-69974507 GAGCTGATTGTTAAATCTTCAGG - Intergenic
936826393 2:116586899-116586921 GAGCTGATTATTAAATTTTTAGG + Intergenic
942530741 2:176907188-176907210 GAGCTGATTGTTAAATTTGTAGG + Intergenic
942862140 2:180627620-180627642 GAGCTGATTAGTGAGTTTAGGGG - Intergenic
944243284 2:197506474-197506496 TAGCTGATAGTTGAGTTTAAGGG - Intronic
946441123 2:219696909-219696931 GAGCTGATTGTCAAATTTTCAGG + Intergenic
946504614 2:220285360-220285382 GAGCTATTGGTTAAGTTTAGGGG - Intergenic
947589510 2:231377401-231377423 GAGCTGATTCCTAAGTTTGGGGG + Intergenic
948373373 2:237504748-237504770 GAGCTGAGTCTTCAGATTAGAGG - Intronic
1170414308 20:16123836-16123858 GAGCTGACTGTTGAATTTTGAGG - Intergenic
1172573626 20:35989625-35989647 GAGCTGATTGTTAAATTTTCAGG + Intronic
1174827284 20:53779831-53779853 GACCTGATTATTCTGTTTAGAGG - Intergenic
1174829144 20:53797014-53797036 GAGCTGGTTGTTAAGTTTTCAGG - Intergenic
1175240997 20:57548776-57548798 AAGCCGATTGTGAAGTTCAGAGG + Intergenic
1176886054 21:14256873-14256895 GAACTGATGGTTAAGTACAGTGG + Intergenic
1177196682 21:17910981-17911003 GAGCCAATTGTTAAGTTTTTAGG + Intronic
1177777888 21:25589791-25589813 GAGCTGACTGGTATGTTTAAAGG + Intronic
1178459428 21:32788874-32788896 GAGCTGATTGGTAAGTTTTCAGG + Intergenic
1178632069 21:34270254-34270276 GAGCTGATTATTAACTTTTCAGG + Intergenic
1179118572 21:38520351-38520373 GAGCTGATCCTTCAGTCTAGAGG - Intronic
1179171945 21:38979993-38980015 GAGCTGATTGTAAAGGTTGGCGG - Intergenic
1183191912 22:36327051-36327073 GATCTCCTTGTTAAGTTCAGAGG + Intronic
949166269 3:945197-945219 GGGCTGATTGTTAAATTTTCAGG - Intergenic
949796113 3:7852845-7852867 GAGCAGATTGTTAAATTTTGAGG + Intergenic
953335371 3:42089740-42089762 CAGCAGATGGTTAAGTTTGGGGG - Intronic
953466783 3:43128815-43128837 GATCTGAATGTGAGGTTTAGAGG - Intergenic
953690197 3:45111369-45111391 GAGCTGACTGTTAAGTGTTCAGG - Intronic
958503169 3:94940538-94940560 GAGATGTTTGTTAACTTTTGTGG + Intergenic
960231520 3:115233291-115233313 GAGCAGATTGTTAAATTTTCAGG + Intergenic
960264809 3:115608403-115608425 GAGCCAATTGTTAAGTTTTCAGG + Intergenic
960704404 3:120468288-120468310 GCCATGATAGTTAAGTTTAGAGG + Intergenic
962209343 3:133463967-133463989 GAGCTGATTTTTAAATTTTCAGG - Intronic
963865822 3:150360418-150360440 GAGCTGATTGTTACATTTTCAGG + Intergenic
970373947 4:15437348-15437370 AGGGTGATTGTTAAGTTTAAGGG + Intronic
971812484 4:31444630-31444652 GAGCTGATTGTTAAATATCCAGG - Intergenic
972011810 4:34191879-34191901 GATCTGATTTTTGAGTTTTGAGG - Intergenic
974079850 4:57200689-57200711 CAGCTGATTGTTAAGAGTATGGG + Intergenic
974381696 4:61148706-61148728 GTGCTGATTGTTAATTTTTCAGG + Intergenic
976698546 4:87944332-87944354 GAGCTGACTGTTAAATTTCTGGG - Intergenic
978393887 4:108257184-108257206 GAGCTGATTGTTAAGTTTTCAGG + Intergenic
979729147 4:124001557-124001579 AAGCTGATTATTAAGTTTTCCGG - Intergenic
980036086 4:127883953-127883975 AAGCTGAGTGTTAAGTTCAGGGG - Intronic
982127215 4:152194570-152194592 AAACTGATAGTTAAATTTAGAGG - Intergenic
982342101 4:154311120-154311142 AAGCTGATTGTTAAGCTAAAAGG + Intronic
982733690 4:158982590-158982612 GAGCAGATTGTTCAGTTTCCAGG - Intronic
984118339 4:175710067-175710089 GTGCTGTTTGCTAAGTTTTGTGG - Intronic
985974541 5:3406206-3406228 GAGTTGATTTTTAAATATAGTGG + Intergenic
986769677 5:10960936-10960958 GAGCTGATTGTTAAATTTTCAGG + Intergenic
988499788 5:31775022-31775044 GAGCTGATTGTTAAAATTTCAGG - Intronic
989475313 5:41868187-41868209 TAGCTGTTAGTTATGTTTAGTGG + Intronic
991281059 5:64913836-64913858 AAGCTTATTGTAAAGTTTATAGG + Intronic
991654932 5:68894455-68894477 GAACTGATTGTTAAATTTTCAGG + Intergenic
992474383 5:77087895-77087917 GAGCTAATTGTTAAATTTCCAGG - Intergenic
992758766 5:79933387-79933409 GAGGTTATTGTTTAGCTTAGTGG - Intergenic
992761383 5:79953753-79953775 GAGCTGATTGTTCAGGTTAGGGG - Intergenic
995221437 5:109653070-109653092 GAACTGATTGTTAAATTTTCAGG + Intergenic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
996767771 5:127051804-127051826 GAGCTGTTTTTCAAGTTTTGAGG + Intronic
997363569 5:133311147-133311169 GAGCTCATTGTTAAATTTTCAGG - Intronic
997389603 5:133503395-133503417 GAGCTTATTGTTAAATTTGCAGG - Intronic
998454771 5:142263299-142263321 GAGCTCAGTGTTAAGTTTTCAGG - Intergenic
999610434 5:153363680-153363702 GAGCTGATTGTTACATTTCTAGG - Intergenic
1000005857 5:157184358-157184380 TAGCTAATTGTTAAGTTTTCAGG - Intronic
1004254940 6:14054819-14054841 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1005507205 6:26479924-26479946 GAGGTGATTGTTAAATTTTCAGG + Intergenic
1008679017 6:53852683-53852705 GAGCTGATAGTTATTTTGAGAGG + Intronic
1011050221 6:83139167-83139189 GAGGTGATTTTTAACTTTATTGG + Intronic
1011180688 6:84616793-84616815 GAGTTGTTTGTAGAGTTTAGTGG - Intergenic
1012833243 6:104232028-104232050 GAGATGACTTTTAAGATTAGAGG + Intergenic
1015089406 6:129337130-129337152 GAGCTTATTCTCTAGTTTAGGGG + Intronic
1016509881 6:144830397-144830419 GAGCTGATTGTTACATTTTCAGG + Intronic
1017397661 6:154021456-154021478 AAACTGATTTTTAAGTTTATAGG - Intronic
1021732435 7:23608913-23608935 GTGCTGATTGTTCAGGTTGGAGG + Intronic
1022312539 7:29210726-29210748 GGTCTGAGTGTTAAGTTTAGTGG + Intronic
1022440348 7:30427902-30427924 CTGCTGATTCTTAAGTTTTGAGG - Intronic
1024632895 7:51263691-51263713 GGTCTGATTGTTAAGTTCAAGGG + Intronic
1027689304 7:81322353-81322375 GAACTGATTGTTCAGTTTTCAGG + Intergenic
1029254272 7:99258655-99258677 GAGCTGATTGTGAAATTTTCAGG + Intergenic
1030090635 7:105854783-105854805 GAGCTGATTGTTAAATTCTCAGG + Intronic
1030396008 7:108987883-108987905 GAGCCAATTGTTAAGTTTTCAGG - Intergenic
1030906798 7:115195127-115195149 GAGCTGATTGTTAAATTTTCAGG + Intergenic
1037261855 8:17018464-17018486 GAGCTGATAGTTAAATTTTCAGG + Intergenic
1037482702 8:19319433-19319455 GAGCTGTTTGGGAAGTTTCGTGG + Exonic
1038686780 8:29726094-29726116 GAGCTGCTTGTTAAATTTTCAGG - Intergenic
1040028204 8:42800953-42800975 GAGCTTCTTGTTAAATCTAGTGG - Intergenic
1041813763 8:61942781-61942803 GAGCTGTTTATTAAGTATACAGG + Intergenic
1042965453 8:74347095-74347117 TAGCTGATTGTTAAATTTTCAGG - Intronic
1047881700 8:129201608-129201630 GAGATGACTGTAAAGTTTTGGGG - Intergenic
1051788477 9:20772628-20772650 AAGCTTATTGTTAACATTAGAGG + Intronic
1051820884 9:21166265-21166287 CAGCTGCTGGTTAAGTTCAGTGG + Exonic
1053321656 9:37104241-37104263 GAGCTGATTGTCAAATTTTAAGG - Intergenic
1055124633 9:72704887-72704909 GAGCTGAGTATTCTGTTTAGTGG - Intronic
1055491803 9:76812847-76812869 GAGCTGACTGTTAAATTTTCAGG + Intronic
1055769465 9:79702025-79702047 GAGCTGATTCTTAAGGATAGTGG + Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1187174749 X:16886166-16886188 GAGCTCATTGTGAAGTTTTCAGG - Intergenic
1190790106 X:53691120-53691142 GAGCTCACTGTTCAGTGTAGAGG - Intergenic
1191035328 X:56019878-56019900 GATCTTATGGTTAAGTTTGGAGG + Intergenic
1194454338 X:94083318-94083340 CAGGTGCTTGTTAATTTTAGAGG + Intergenic
1195789924 X:108572895-108572917 GAGCTAAGGGATAAGTTTAGTGG - Intronic
1196501326 X:116386489-116386511 GAGCTATTAGTTAAGTTTATTGG - Intergenic
1198481125 X:137041930-137041952 GAGCTGATTGTTACATTTTCAGG + Intergenic