ID: 1108416255

View in Genome Browser
Species Human (GRCh38)
Location 13:50200685-50200707
Sequence TGGACTCTGAGGAGCACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108416248_1108416255 13 Left 1108416248 13:50200649-50200671 CCTTCTCTCTTGTGGCCTGGGTG 0: 1
1: 0
2: 1
3: 24
4: 294
Right 1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG 0: 1
1: 0
2: 2
3: 31
4: 297
1108416251_1108416255 -2 Left 1108416251 13:50200664-50200686 CCTGGGTGGGCTTGCTTGAGCTG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG 0: 1
1: 0
2: 2
3: 31
4: 297
1108416245_1108416255 19 Left 1108416245 13:50200643-50200665 CCAGTGCCTTCTCTCTTGTGGCC 0: 1
1: 0
2: 1
3: 35
4: 324
Right 1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG 0: 1
1: 0
2: 2
3: 31
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108416255 Original CRISPR TGGACTCTGAGGAGCACTGG CGG Intronic
900586882 1:3436950-3436972 TGGGGTCTGAGGAGCAGCGGAGG - Exonic
900814038 1:4829600-4829622 TGGACTCTCAGAGGCAGTGGGGG + Intergenic
901144086 1:7053593-7053615 TGGGCTCAGAGGGGCCCTGGCGG - Intronic
901539685 1:9907883-9907905 TGGATTCTAAGGAGCAAAGGTGG - Intronic
901957604 1:12797782-12797804 TGGGCCCTCAAGAGCACTGGGGG - Intergenic
901962768 1:12840581-12840603 TGGCCTCTGGGGAGCAGGGGAGG + Intergenic
901989959 1:13104884-13104906 TGGCCTCTGGGGAGCAGGGGAGG + Intergenic
902323354 1:15683665-15683687 GGGTCTCTGAGGAGGGCTGGGGG + Intergenic
902644805 1:17790823-17790845 TGGATGCTGATGAGCACAGGAGG - Intronic
903891366 1:26572512-26572534 TGGACCCTGTGGGGCACTGAGGG + Intronic
904281928 1:29426727-29426749 TGGACTGTGAGGAGCTGGGGAGG + Intergenic
904624044 1:31792282-31792304 TGGCCTCTGTGGAGCACATGGGG - Exonic
905384875 1:37595686-37595708 AGGGCTCCGAGGAGCACTGGAGG - Intronic
907815189 1:57911631-57911653 TGACGTCTGAGGAGTACTGGTGG - Intronic
909098476 1:71320033-71320055 TGGACTTTGGGGACCAATGGGGG - Intergenic
910259818 1:85284114-85284136 TGGGCACTGACGAGCACAGGAGG + Intergenic
911025913 1:93435291-93435313 TGGGCACTGAGGAGCATGGGAGG - Intergenic
911767733 1:101699631-101699653 TGGACTGTCAGGAGCAGTGAGGG - Intergenic
914848846 1:151299070-151299092 TGGACTGTGAGGAGACATGGAGG + Exonic
914912207 1:151796619-151796641 TGGACCCTGGGGAGCAAAGGTGG + Intergenic
915298590 1:154939171-154939193 TGGCCTCTGAGGAGGAGAGGGGG - Intergenic
916928172 1:169545778-169545800 TAGACTCTGAGGATCAGTAGGGG + Intronic
917891917 1:179447864-179447886 TGGTCTCTGAGGAGCTCCAGGGG + Intronic
918413292 1:184282797-184282819 TAGACACTGAGGACTACTGGAGG + Intergenic
920627076 1:207612786-207612808 TGGGCTCTGAGCAGTGCTGGCGG + Intronic
922419427 1:225449564-225449586 TGGCCCCTGAGGAGCACCTGGGG + Intergenic
922852433 1:228745067-228745089 TGGACTCTGAGGACTCCTGAGGG + Exonic
923328108 1:232898471-232898493 TGGGCACTGAGGAGCACAGGAGG + Intergenic
923891419 1:238219299-238219321 TGGTCTCTGAGGAGGACTGAGGG - Intergenic
1064885313 10:20105095-20105117 TGGACTCTGGGGAGCACCACCGG + Intronic
1066164606 10:32772794-32772816 TGGACTTTCAGGATCCCTGGTGG + Intronic
1066315430 10:34241375-34241397 TGAACACTGGGGAGCACCGGTGG + Intronic
1067000102 10:42602943-42602965 TGGGGGTTGAGGAGCACTGGTGG - Intronic
1067547195 10:47201463-47201485 TGGAGTCTCAGGAGAGCTGGTGG + Intergenic
1069121758 10:64576769-64576791 TGGGCACTGACGAGCACGGGAGG + Intergenic
1069400383 10:68038430-68038452 AGCACTCTGAGGAGTACTTGAGG - Intronic
1069864191 10:71491289-71491311 TGGACTGACAGCAGCACTGGGGG - Intronic
1069901316 10:71708161-71708183 CAGACACTGGGGAGCACTGGAGG + Intronic
1070754137 10:78981323-78981345 TGGAGTCTGAGCAGTGCTGGGGG + Intergenic
1071677321 10:87666844-87666866 GGGACTTGGAGGAGCTCTGGGGG + Intronic
1072660409 10:97360363-97360385 TGGAGTCTAAGGGGCCCTGGGGG - Intronic
1072729336 10:97834655-97834677 TGGATTCTTAGGGACACTGGGGG + Intergenic
1073319891 10:102608804-102608826 TGGACTCTGAGGAGGACAGAGGG - Intronic
1073327650 10:102651671-102651693 TGGACTCTGAAGAGCACCTGGGG + Intronic
1073953970 10:108846022-108846044 TGGTCACTGAGGAGTACTAGTGG + Intergenic
1074613650 10:115044546-115044568 TACACTTTGAGAAGCACTGGTGG + Intergenic
1076314063 10:129528496-129528518 TGGAGTGTGAGGGGCAGTGGCGG + Intronic
1076887955 10:133271163-133271185 TGGGCTCTGGGGGTCACTGGTGG + Intronic
1077222920 11:1425382-1425404 TGGACTCTGGGGAGCTCAGTGGG - Intronic
1077412353 11:2409549-2409571 TGGGCTCTGAGGAGACCTGCAGG + Intronic
1078345588 11:10544955-10544977 TGGACACTGATGAGCATGGGAGG - Intergenic
1078387798 11:10908263-10908285 TGGGCAGTGAGGAGGACTGGTGG + Intergenic
1079095747 11:17509265-17509287 TCCACTCTCAGGAGCAGTGGAGG + Intronic
1079444402 11:20546158-20546180 TGGGCTCAGAGGACCACTGTGGG + Intergenic
1081066400 11:38545851-38545873 TGGATCCTGAGGATCACTTGAGG + Intergenic
1083478644 11:62929678-62929700 TGGCTTCTGAGGAACACAGGTGG + Intergenic
1083901078 11:65643851-65643873 TGGACACTGGGGAGCCATGGAGG + Intronic
1084019676 11:66410070-66410092 TTGACTCTGGGGAGCCCTGCCGG - Intergenic
1088328869 11:108629345-108629367 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1089324254 11:117646437-117646459 GGGACTCTGAGTAGGACTTGGGG - Intronic
1090041874 11:123298986-123299008 TGGGCACTGATGAGCACAGGAGG + Intergenic
1090089541 11:123682872-123682894 ATGACTATCAGGAGCACTGGTGG - Intergenic
1090278183 11:125434030-125434052 TGGGCTCTGACCAGCTCTGGTGG + Intergenic
1090394063 11:126407487-126407509 AGCGCTCTGAGGAGCAGTGGAGG + Intronic
1091779041 12:3202307-3202329 TGGTCCAGGAGGAGCACTGGGGG + Intronic
1092480477 12:8854837-8854859 TGGACTCAGAGCAGGATTGGTGG + Intronic
1094180348 12:27585893-27585915 TGGAGTGTGAGGGGCAGTGGGGG + Intronic
1094272326 12:28630475-28630497 TGCTCTCTGAGGTGCACTGATGG + Intergenic
1096049809 12:48597664-48597686 TGGACTCTCAGGAACACAGAAGG + Intergenic
1096518169 12:52169860-52169882 AGGCCTGTGGGGAGCACTGGAGG - Exonic
1096882085 12:54681349-54681371 TGCCCTCAGAGGAGGACTGGTGG + Intergenic
1097309242 12:58100470-58100492 GTGACTCTGAGGAGCACAGTGGG + Intergenic
1099561006 12:84174045-84174067 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1100351545 12:93788473-93788495 TGGTCTCTGAGGCCCAGTGGTGG + Intronic
1103247885 12:119473616-119473638 TGGACTCTGGGGACTCCTGGGGG - Intronic
1103281124 12:119758830-119758852 TGTACTCTGAGGATCACAGATGG + Intronic
1103913326 12:124363645-124363667 TGGACTCTGTGGGGCTCTGGGGG + Intronic
1104744516 12:131202599-131202621 TGGCCTCAGATGTGCACTGGCGG + Intergenic
1104789860 12:131474604-131474626 TGGCCTCAGATGTGCACTGGCGG - Intergenic
1107062619 13:36175784-36175806 TGAGCTCTGAGGAACTCTGGGGG + Intronic
1107853405 13:44591956-44591978 TGGGCACTGAGGAGCACAGGAGG + Intergenic
1107979018 13:45716596-45716618 AGGGCTCTGAGGATTACTGGAGG - Intergenic
1108240372 13:48457687-48457709 TGGGCGCTGACGAGCACGGGGGG - Intronic
1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG + Intronic
1109378154 13:61524539-61524561 TGGACCCTGAGGAGCAGGGTTGG + Intergenic
1109853079 13:68092717-68092739 TGGATGCTGAGGAGCAATTGTGG + Intergenic
1110529001 13:76574790-76574812 TGGACTTCCAGGAGCAATGGCGG + Intergenic
1110637546 13:77783376-77783398 AGGACACTGAGGAGCATTAGAGG + Intergenic
1111119207 13:83823838-83823860 TGGACACTGACAAGCACAGGAGG + Intergenic
1111351885 13:87041821-87041843 TGGCTTCTGAGGAGCCCTGGGGG + Intergenic
1113125947 13:106979886-106979908 TGGCCACTGTGGAGAACTGGAGG + Intergenic
1113740870 13:112711599-112711621 TGGACTGGGAGGGGCACTGCAGG + Intronic
1116749377 14:48863876-48863898 AGGACACTGGGGACCACTGGAGG + Intergenic
1117003524 14:51395399-51395421 TTGACTCTGAGGGGCACTGCTGG + Intergenic
1117099924 14:52335498-52335520 TGGACTCTGATGCCCACTGTAGG - Intergenic
1117914020 14:60658285-60658307 TGGAGTTTGAGGCGCTCTGGCGG - Intergenic
1121858106 14:97289181-97289203 TTTATTCTGAGGAGCAATGGTGG - Intergenic
1123118389 14:105905105-105905127 TGGAGCCTGAGTAGCACTGAGGG - Intergenic
1202883692 14_KI270722v1_random:84691-84713 TGGGCACTGACGAGCACAGGAGG - Intergenic
1124567827 15:30832819-30832841 GCCACTCTGAGGAGCACTGCCGG - Intergenic
1124971685 15:34495362-34495384 TGGACGCTGACGGCCACTGGGGG + Intergenic
1125381642 15:39092605-39092627 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1125971340 15:43914225-43914247 TGAACTCTGGAAAGCACTGGAGG + Intronic
1126105241 15:45142967-45142989 TGGAATCTGAGGAGGAAGGGTGG + Intronic
1126367604 15:47912107-47912129 CATACTCTGAGGAGCAATGGAGG - Intergenic
1126719799 15:51566474-51566496 TGCACTCTGAGGAACACTAAAGG - Intronic
1126793788 15:52243781-52243803 TGGACTCTCAGGACCCCTCGAGG + Intronic
1127369359 15:58322931-58322953 TAGACACTGGGGACCACTGGAGG - Intronic
1128510693 15:68312372-68312394 TGTACTGTGAGGTGAACTGGAGG + Intronic
1129183155 15:73889554-73889576 AGGACTCAGGGGAGCAGTGGGGG - Intergenic
1130991163 15:88876960-88876982 TGGCCTCTGAGGTCCTCTGGAGG + Intergenic
1131890888 15:96970377-96970399 AGGACTCTGGGGAGCAGTGATGG + Intergenic
1132104930 15:99056640-99056662 TGCCCCCTGAGGAGCACAGGAGG - Intergenic
1132349772 15:101132572-101132594 TGCACTCTGAGTGGCACTGTGGG + Intergenic
1134183372 16:12064783-12064805 TGGAGTCTCAGGAGAAATGGTGG - Intronic
1135832654 16:25789724-25789746 GTGACTATGAGGAGCACAGGTGG - Intronic
1136550239 16:30979163-30979185 GGGACGCAGAGGCGCACTGGGGG - Exonic
1137750796 16:50859771-50859793 TGAACTGTGAGGTGCACTTGGGG + Intergenic
1137761885 16:50947860-50947882 TAGACTCTGAAGGGCACTGAAGG - Intergenic
1138772940 16:59686676-59686698 TGGTCTCTGAAGTGCCCTGGAGG + Intergenic
1138906482 16:61340996-61341018 GGAACTCTGGGGGGCACTGGTGG + Intergenic
1139150920 16:64381214-64381236 TGGACACTGAGGAGTCCAGGAGG + Intergenic
1140938744 16:79701074-79701096 TGGACACTGGGGACCACTAGAGG - Intergenic
1141677245 16:85524282-85524304 TGGCATCTGAGGTGCCCTGGGGG - Intergenic
1141916137 16:87098628-87098650 TGGAGACTGCAGAGCACTGGGGG + Intronic
1142207745 16:88792008-88792030 GGGTCTCTGAGGAGCAGCGGTGG + Intergenic
1142560758 17:807587-807609 TGGCTTCTGAGGAGCACTCAGGG + Intronic
1142638191 17:1270613-1270635 AGGACTCTGCGGAGGACTTGGGG + Exonic
1143887899 17:10079189-10079211 TGGACTCTGAGAAGCATTTGGGG + Intronic
1146176656 17:30669466-30669488 AGGACTCTGAGGAGCAGGGAGGG - Intergenic
1146786365 17:35725383-35725405 TGGACTCAGAGGAGGAATCGTGG + Intronic
1146808593 17:35885279-35885301 TGGATTGTGAGGAGCACAGGAGG + Intergenic
1148101918 17:45097405-45097427 GGGACTCTGAGCAGAACAGGTGG - Intronic
1148555667 17:48577388-48577410 TGGAATCTGAGCAGCAAGGGTGG - Intronic
1148908044 17:50923730-50923752 TGGATTCTGGGGAGCACAGCTGG - Intergenic
1150131675 17:62672553-62672575 TGGACTGGGTAGAGCACTGGGGG - Intronic
1151460310 17:74250288-74250310 TGGACTCTGAGGAGTTCAGCAGG - Exonic
1151807979 17:76418433-76418455 TGGCCTCTGAAGGGCAATGGTGG + Intronic
1151914250 17:77105785-77105807 TGGGCCCAGAGGAGCACAGGTGG + Intronic
1152527358 17:80896252-80896274 GAGACGCTGAGAAGCACTGGCGG - Intronic
1153773225 18:8432035-8432057 TGGCCTTTGAGGAGGACAGGAGG + Intergenic
1153815347 18:8785917-8785939 TGGACTGTTAGGTGCACGGGAGG - Exonic
1154250051 18:12736884-12736906 TGGCCTCTAAGGAGGACAGGAGG + Intergenic
1161868083 19:6849251-6849273 TAGACTCGGGGGAGCACTAGAGG - Intronic
1163399937 19:17086075-17086097 TGGACTCTGGGGGGCCTTGGTGG - Intronic
1164448495 19:28338015-28338037 TGGACACTGGGGACCACTTGGGG - Intergenic
1164478343 19:28592260-28592282 TGGACACTGAGGAGCAAAGTGGG - Intergenic
1165922082 19:39305475-39305497 TGGAATCTGAGGGACCCTGGCGG - Intergenic
1166340817 19:42135538-42135560 GGGTCTCTGAGGCCCACTGGGGG - Intronic
1166881714 19:45934164-45934186 TGGAATATGGGGAGGACTGGAGG - Exonic
1167115820 19:47488494-47488516 TGGTCTCTGAGGAGGAGTAGAGG + Intronic
1168097095 19:54122112-54122134 ATGAGTCTGAGGAGCACTCGGGG + Intronic
1168161373 19:54512632-54512654 TGGACCCTGAGGTGGACAGGTGG + Intergenic
1168301928 19:55409803-55409825 TTGACTCTAAGCAGGACTGGTGG - Intergenic
1202659117 1_KI270708v1_random:51839-51861 TGGGCACTGACGAGCACAGGAGG - Intergenic
925060345 2:885712-885734 TGAAGACTGAGGAGGACTGGGGG + Intergenic
925410914 2:3639678-3639700 TGGACGTTGAGGAGAACTGAGGG + Intronic
925596547 2:5561189-5561211 CCCACTCTGTGGAGCACTGGTGG - Intergenic
925697343 2:6594949-6594971 TGCTCTCTGAGGAACACTGAAGG - Intergenic
926681593 2:15668080-15668102 TGAACTCTCAGGAGCACTCAGGG + Intergenic
928723673 2:34147873-34147895 TGGGCACTGAGGAGCACAGGAGG - Intergenic
929022066 2:37563264-37563286 TGAGCTTTGAGGAGCTCTGGTGG + Intergenic
929414986 2:41738083-41738105 TGGTCTCTTAGGATCACTTGAGG + Intergenic
929886453 2:45883313-45883335 AGGACTCTGAGGCGCCCTGCAGG + Intronic
930602381 2:53457247-53457269 TGGATGCAGAGGATCACTGGAGG - Intergenic
932008644 2:67953513-67953535 AGCACACTGAGGTGCACTGGGGG + Intergenic
932485265 2:72080823-72080845 TGGGCACTGAGGAGCATGGGAGG + Intergenic
933849908 2:86357736-86357758 TGACCGCTGAGGAGCCCTGGAGG + Intergenic
937167745 2:119836868-119836890 TGGGCGCTGATGAGCACAGGAGG + Intronic
938755805 2:134377913-134377935 TGGACTCTGTTGAGAACTGCTGG - Intronic
940694330 2:156959684-156959706 TGGACACTGAGGAGCACAGGAGG - Intergenic
942607576 2:177709054-177709076 GGGACTCCAAGAAGCACTGGTGG - Intronic
943614117 2:190072238-190072260 TAGACACTGGGGAGCACTGGAGG + Intronic
945130474 2:206565885-206565907 TGGACTCCTAGGAGGGCTGGTGG - Intronic
946878040 2:224149966-224149988 TGGCCTCTGAGAAGCACTTTAGG - Intergenic
948575450 2:238946882-238946904 TGGGCACTGAGGAGCATGGGAGG - Intergenic
948625841 2:239267358-239267380 TGGAGTCTGAAGAGCACCAGTGG + Intronic
948662046 2:239513683-239513705 TGGACACTGAGGTGCACTGATGG + Intergenic
948840650 2:240647225-240647247 TGGCCCATGAGGAGCACGGGGGG + Intergenic
1168835376 20:874040-874062 TTGTCTCTGAGGAAAACTGGTGG + Intronic
1169393012 20:5205427-5205449 TGCAATCTGAGGAGCTCTGCAGG + Intergenic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1170437889 20:16349353-16349375 TGGACTCTGAGCATCCCTGGAGG + Intronic
1170739441 20:19042067-19042089 TGGCTACAGAGGAGCACTGGAGG + Intergenic
1171960237 20:31488339-31488361 GGGACTCTGAGGAGGCTTGGGGG - Intergenic
1172345407 20:34194608-34194630 TGGAATCTGGGGATCTCTGGTGG - Exonic
1173386498 20:42593169-42593191 TGGAATCTCAGAATCACTGGAGG + Intronic
1173700030 20:45061761-45061783 TAGACACTGAGGATTACTGGAGG - Intronic
1174847321 20:53955227-53955249 TGCCCTCTGAAGAGCACCGGTGG - Intronic
1174915116 20:54645571-54645593 TGGAGCCTGAGGGGCGCTGGAGG - Intronic
1175252410 20:57617337-57617359 TGGCATCTGAGGAGGCCTGGAGG - Intronic
1175719334 20:61275785-61275807 TGGATTCTGAGTATCACTGGGGG + Intronic
1175824101 20:61927366-61927388 TGGCCCCTGAGGAGCTCTGGGGG + Intronic
1175886004 20:62291326-62291348 TGGGCTCTGAGTTGCACAGGTGG + Intronic
1176185357 20:63775490-63775512 TGGCCTCTCAGGTGCACGGGGGG - Intronic
1176671360 21:9738086-9738108 TGGATTCTGGGGAACACAGGTGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178348324 21:31851160-31851182 TGGACTTGGAGGAGCAGAGGAGG - Intergenic
1179524697 21:41968013-41968035 TGGGGTCTGAGGAGCCCTGCAGG - Intergenic
1179582530 21:42352406-42352428 CGGACCCAGAGGAGCCCTGGAGG - Intergenic
1180149963 21:45942409-45942431 TGAACTCTGAGGAGCACAGAGGG - Exonic
1180326576 22:11435363-11435385 TGGGCACTGACGAGCACAGGAGG - Intergenic
1180378194 22:12114125-12114147 TGGGCACTGACGAGCACAGGAGG - Intergenic
1181169643 22:21000938-21000960 TGGACTGTGAGGAGTCCTGCGGG - Intronic
1182352038 22:29704571-29704593 TTAACTCTGAGCAGCACTGGGGG - Intergenic
1183252760 22:36742111-36742133 AGGAATCTGAGGATCAGTGGGGG - Intergenic
1184751610 22:46489492-46489514 TGGATTCTGAGGGCCCCTGGTGG + Intronic
1184831293 22:46990401-46990423 AGGACGCTGAGGAGCACATGGGG - Intronic
1185106223 22:48871460-48871482 TGGAGTCTGAGGAGTGATGGAGG + Intergenic
949421949 3:3875328-3875350 TGGGCTCTGAGGAGCCCTGGAGG + Intronic
952027530 3:29100425-29100447 TGGACTTTCAGGATCTCTGGTGG + Intergenic
953603012 3:44386731-44386753 TGGGCGCTGATGAGCACAGGAGG + Intronic
954676136 3:52316417-52316439 AGGACTGTGAGGGGAACTGGAGG - Exonic
955987446 3:64588641-64588663 TGGACTCTGAGGAGGAGTCCAGG - Intronic
956203685 3:66733926-66733948 TGGACCATGAGGAGATCTGGAGG + Intergenic
957095266 3:75772021-75772043 TGGGCACTGACGAGCACAGGAGG + Intronic
960634286 3:119768308-119768330 TGGGCACTGAAGAGCACAGGAGG - Intergenic
962105289 3:132383124-132383146 TGGACTCTGATGAGCATAGGAGG - Intergenic
963972927 3:151449213-151449235 TGGACACTGCTGAGCACTAGAGG + Exonic
964336398 3:155659444-155659466 TGTACTCTGAGCTGCTCTGGAGG - Intronic
964656153 3:159067917-159067939 TGGAATGTGAGGGGGACTGGCGG + Intronic
965175201 3:165322204-165322226 TGGGCTCTAAGGAACATTGGTGG - Intergenic
966290676 3:178354171-178354193 TGAACTTTGAGGAGTACTAGTGG + Intergenic
966656522 3:182364606-182364628 TGGACCTTGAGAAGAACTGGGGG - Intergenic
966757077 3:183381304-183381326 AGGACTCAGAGGAGCAAAGGCGG + Intronic
967155879 3:186691986-186692008 TGGACCCTGAGGGGCAATAGTGG - Intergenic
968101038 3:195965468-195965490 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
968629527 4:1642790-1642812 TTGACCCTGAGGAGGCCTGGAGG - Intronic
968705193 4:2074355-2074377 TGCTCTCTCAGGAGCACTCGGGG - Intronic
969079368 4:4606586-4606608 TGGACACTGAGAAGCACAGAGGG - Intergenic
970429854 4:15978653-15978675 CGGGCTCGGGGGAGCACTGGCGG + Intronic
978757805 4:112323134-112323156 TAGGCTCTGAGGAGCAGGGGTGG - Intronic
980253671 4:130349584-130349606 TGGGCACTGATGAGCAGTGGAGG - Intergenic
984019965 4:174473742-174473764 TGGACCCGGAGGAGCAAAGGGGG + Intergenic
985383390 4:189419477-189419499 GGGACTGTGAGGAGCACTTCAGG + Intergenic
985403368 4:189613707-189613729 TGGATTCTGGGGAACACAGGTGG + Intergenic
1202759813 4_GL000008v2_random:99590-99612 TGGGCACTGACGAGCACAGGAGG - Intergenic
985502044 5:254445-254467 AGCCCTTTGAGGAGCACTGGAGG + Exonic
985561861 5:591994-592016 TGGACTCTGAGGGTCCTTGGTGG + Intergenic
985734974 5:1574221-1574243 AGCCCTTTGAGGAGCACTGGAGG - Intergenic
985885520 5:2674687-2674709 TGAAATGTGAGCAGCACTGGGGG - Intergenic
987989595 5:25193324-25193346 TGGACTCTGGGAAGCACCAGTGG + Intergenic
988376270 5:30439618-30439640 TGGACATTGAAGAACACTGGTGG + Intergenic
991176208 5:63689918-63689940 TGGGGTCTGAGGAACAGTGGCGG - Intergenic
992161337 5:74006550-74006572 TAGACACTGAGGACTACTGGAGG - Intergenic
995517610 5:112969496-112969518 TGGACTCTGAGGTGGAGTAGGGG - Intergenic
996393125 5:122985331-122985353 AGGACTCTTAGGAGCACTTCAGG + Intronic
998263341 5:140647816-140647838 TTGATTCTGAGGTGCACTGTGGG + Exonic
998387075 5:141763544-141763566 TGGAGTCTGATGAGCAGTGATGG + Intergenic
999119416 5:149197826-149197848 TGCACACTAAGAAGCACTGGTGG - Intronic
999982689 5:156972979-156973001 TGGACTTTGGGGAGGACTTGTGG - Intergenic
1000666956 5:164010134-164010156 TGGACTTTGAGGACCCCTTGGGG + Intergenic
1001547562 5:172579951-172579973 TGGATTGGGAGGATCACTGGGGG - Intergenic
1003438936 6:6121929-6121951 TGGGCACTGAGGAGCACAGGAGG + Intergenic
1003961862 6:11216164-11216186 TGGGCACTGAGGAGGACTGCTGG - Intronic
1004310403 6:14540312-14540334 AGGACTGTCATGAGCACTGGTGG + Intergenic
1006139460 6:31919546-31919568 TTGCCTCTGGGGAGAACTGGGGG - Intronic
1007214741 6:40228287-40228309 TGGACACTGAAGAGCACGGGAGG + Intergenic
1008475715 6:51933760-51933782 TGGAATGTGAGCAGAACTGGGGG - Intronic
1008625012 6:53306633-53306655 TTGACTCTGCTGAGAACTGGGGG - Intronic
1010570329 6:77466451-77466473 GGGACTCTGCGAAGCAGTGGAGG - Intergenic
1011238676 6:85246833-85246855 TAGACACTGGGGAGTACTGGAGG - Intergenic
1011255725 6:85418797-85418819 TGGACTGTGAGGAGGGCTAGGGG + Intergenic
1012749566 6:103140500-103140522 TGGGCTCCAAGGAGCACAGGAGG - Intergenic
1012810470 6:103950258-103950280 TAGACACTGAGGACCACTAGAGG - Intergenic
1016700381 6:147047763-147047785 TGGCTTCTGGGGAGCACTTGGGG - Intergenic
1018066632 6:160129118-160129140 TGGACTCTGGGGAGAACAGAGGG - Intronic
1018620806 6:165727602-165727624 TGAATTCTGGAGAGCACTGGTGG - Intronic
1019442714 7:1055562-1055584 GGGACTCTGTGCAGCACAGGTGG + Intronic
1019968443 7:4520563-4520585 AGGACTCTCAGAAGCAATGGAGG - Intergenic
1020832604 7:13110312-13110334 TGGTCGCTGAGAAGCACTGGAGG - Intergenic
1021993904 7:26161569-26161591 CGGACACTGAGGAGCCCTGGGGG - Intronic
1023770927 7:43556096-43556118 TAGAATCAGAGGAGCACAGGGGG + Intronic
1024007201 7:45233775-45233797 TGGCCTCTGAGGAGCTGTGAAGG - Intergenic
1024980406 7:55153286-55153308 CGGGCTCTGAGCAGCACTGGAGG + Intronic
1025065946 7:55856160-55856182 TGGACACTGAGGACTACTAGAGG - Intronic
1026576998 7:71580748-71580770 TGTTCTCTAAGGAGCACTGTTGG + Intronic
1026768125 7:73173222-73173244 AGGCCTCTGAGGAGCCCTGGTGG + Intergenic
1027044590 7:74982932-74982954 AGGCCTCTGAGGAGCCCTGGTGG + Intronic
1027079048 7:75219428-75219450 AGGCCTCTGAGGAGCCCTGGTGG - Intergenic
1028674485 7:93442931-93442953 TGGACTTTCAGCAGCCCTGGGGG + Intronic
1029150459 7:98476718-98476740 TGGACTCTTAGGATCATGGGTGG + Intergenic
1029388280 7:100257997-100258019 AGGCCTCTGAGGAGCCCTGGTGG - Intronic
1031763758 7:125748107-125748129 AAGACTCTGAGTAGTACTGGGGG - Intergenic
1032080923 7:128858111-128858133 TGGCATCTGAGGAGAACTTGGGG - Exonic
1032091325 7:128913049-128913071 TGGCATCTGAGGAGAACTTGGGG + Intergenic
1032417176 7:131744668-131744690 TGGGCTCTGAGGAGGGGTGGAGG + Intergenic
1033163437 7:139017379-139017401 TAGACTCTGAAGAGCAGTAGAGG - Intergenic
1033210106 7:139454045-139454067 TGGAGTCTGGGGAGAAATGGAGG + Intronic
1035052244 7:156005576-156005598 GGGACACTGAGGAGCCCTGCGGG - Intergenic
1037074720 8:14700439-14700461 TGGACACTGAGGACTACTAGAGG + Intronic
1037680966 8:21097148-21097170 TGGAGGCTGAAGAGCTCTGGAGG + Intergenic
1041560241 8:59209263-59209285 TAGACACTGAGGACTACTGGAGG - Intergenic
1042536225 8:69861270-69861292 TGAAGACTGAGGAGAACTGGTGG + Intergenic
1042856567 8:73273490-73273512 TGGTCACTGATGAGCACAGGAGG + Intergenic
1042975590 8:74465445-74465467 TGAACTCTGTGGGGCAGTGGAGG - Intronic
1043614485 8:82108649-82108671 TGGAGACTGAGGAGAGCTGGTGG + Intergenic
1043702893 8:83313038-83313060 TGGGCTCTGATGAGCATGGGAGG - Intergenic
1047063578 8:121254969-121254991 TGGACTCTGTATGGCACTGGTGG - Intergenic
1048416325 8:134231389-134231411 TGGCCTCTGAGGAGTGCAGGTGG - Intergenic
1048856740 8:138693000-138693022 GGGTCTCTGGGGAGCAGTGGTGG - Intronic
1049435162 8:142583168-142583190 AGGGCTCTGAAGAGAACTGGGGG + Intergenic
1049592014 8:143466867-143466889 TGGGGCCTGAGGAGCCCTGGGGG + Intronic
1051410999 9:16789232-16789254 TAGTCACTCAGGAGCACTGGGGG + Intronic
1052466854 9:28839927-28839949 TGGGCACTGATGAGCACAGGAGG - Intergenic
1053270480 9:36746128-36746150 TGGACGCTGAGGCCCAGTGGAGG - Intergenic
1053304133 9:36972171-36972193 TGGACTCTGAGAAAGGCTGGAGG - Intronic
1056762758 9:89426694-89426716 TGGCCTCTGAGGGGCTTTGGGGG - Intronic
1057112778 9:92489864-92489886 TGGACTCTGTGGGCCAGTGGGGG - Intronic
1057510868 9:95678627-95678649 TGGACGCTGAGGCGCATGGGAGG - Intergenic
1057843868 9:98506962-98506984 AGGCCTCCGAGGAGCAGTGGTGG - Intronic
1058185830 9:101853528-101853550 GGGTCACTGAGGAGCACAGGAGG - Intergenic
1058321515 9:103636846-103636868 TGGACCCAGAGGAGTACTTGGGG - Intergenic
1058405704 9:104671478-104671500 TTAACTCTGAGGAGCTTTGGGGG + Intergenic
1058441246 9:105009753-105009775 TGGACACTGGGGAGTACTAGAGG - Intergenic
1059444826 9:114331639-114331661 TGGACGATGAGAAGAACTGGGGG + Exonic
1059917590 9:119121034-119121056 TGGGCTCAAAGGAGCACTGGGGG - Intergenic
1060213301 9:121723521-121723543 TGGGCTCAGGGGAGCCCTGGAGG + Intronic
1060751032 9:126169710-126169732 TGTACCCTCAGGGGCACTGGAGG - Intergenic
1060887973 9:127168879-127168901 TGGACTCTGATAAGCCCTGCAGG - Intronic
1061636098 9:131909421-131909443 TGGACTCTGAGGGGCTCAAGGGG + Intronic
1062289643 9:135788813-135788835 CGGACTCTGCTGAGCACTGACGG - Intronic
1203540589 Un_KI270743v1:84485-84507 TGGGCACTGACGAGCACAGGAGG - Intergenic
1186724653 X:12344368-12344390 TGGAATTTGAGCAGTACTGGAGG - Intronic
1189239117 X:39512157-39512179 TGGACCCTCAGGAGCAATAGAGG + Intergenic
1190747454 X:53332953-53332975 TGGACTCAGAGGAGCATGGAAGG + Intergenic
1194023583 X:88723897-88723919 TGGGCTTTAAGGAACACTGGTGG + Intergenic
1196520754 X:116668151-116668173 TGGACTCAGAGGAGCAGGGCTGG - Intergenic
1198101030 X:133421943-133421965 TGGATGCAGAGGAGCATTGGAGG - Intergenic
1199505862 X:148560847-148560869 TGGACTTTGAGGAGAACAGGAGG - Intronic
1199768002 X:150954370-150954392 GGCATTCTGAGCAGCACTGGGGG - Intergenic