ID: 1108417409

View in Genome Browser
Species Human (GRCh38)
Location 13:50212292-50212314
Sequence GCAGTTGCACAATTAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108417409_1108417415 30 Left 1108417409 13:50212292-50212314 CCAGGTTCTAATTGTGCAACTGC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1108417415 13:50212345-50212367 CTAGAAAAGCTGCGTAAAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 100
1108417409_1108417411 1 Left 1108417409 13:50212292-50212314 CCAGGTTCTAATTGTGCAACTGC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1108417411 13:50212316-50212338 ATTAACTAGCTAGCTGTCCTTGG 0: 1
1: 0
2: 0
3: 26
4: 224
1108417409_1108417413 27 Left 1108417409 13:50212292-50212314 CCAGGTTCTAATTGTGCAACTGC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1108417413 13:50212342-50212364 AGCCTAGAAAAGCTGCGTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108417409 Original CRISPR GCAGTTGCACAATTAGAACC TGG (reversed) Intronic
900112336 1:1013693-1013715 TCAGGAGCACACTTAGAACCTGG - Intronic
904457216 1:30655058-30655080 GGAGCTGCAGAATTTGAACCTGG - Intergenic
906842704 1:49157285-49157307 GGAGTTGAACAATGAGAACATGG - Intronic
907172993 1:52488460-52488482 GCAGTTGCCCAATCAGAAATTGG + Intronic
908240212 1:62182810-62182832 GTAGTTGCAACATTAAAACCTGG - Intergenic
915480989 1:156184891-156184913 GCAGTTGCTTTATTAGAAGCTGG + Intergenic
917274969 1:173322253-173322275 GGAGTTGAACAATGAGAACATGG + Intergenic
920552563 1:206875487-206875509 GTAGTTGTACACTTAGATCCAGG - Intergenic
922222543 1:223619353-223619375 GGAGGTGCACAAATGGAACCTGG - Exonic
1063263885 10:4423470-4423492 GCAGTTGAACATTTAGAAAATGG + Intergenic
1069941336 10:71957697-71957719 GTAGTTGCAACATTAAAACCTGG + Intergenic
1070909603 10:80106266-80106288 GTAGTTGCAACATTAAAACCTGG + Intergenic
1074262390 10:111867112-111867134 ACAGTTGCACAATTAGTAAATGG + Intergenic
1075335427 10:121605849-121605871 ACAATTTCACAATTAAAACCTGG + Intergenic
1077239092 11:1501390-1501412 GCAGTTGCACAGTGACATCCAGG + Intergenic
1079255101 11:18821048-18821070 GCAGTTGCAACATGAAAACCTGG - Intergenic
1087121558 11:94580459-94580481 GCAGGTGCACAGATAGGACCTGG - Intronic
1089507598 11:118974278-118974300 GCAGTGGCACAATTACCTCCAGG + Intronic
1089822070 11:121237581-121237603 GTAGTTGCAACATTAAAACCTGG + Intergenic
1090976343 11:131683558-131683580 GTAGTTGCAGAAATAGACCCTGG + Intronic
1092872668 12:12820033-12820055 GCAGTTACACAGTCAGAACAGGG + Intronic
1093348333 12:18067846-18067868 GTAGTTGCAACATTAAAACCTGG + Intergenic
1093819057 12:23589521-23589543 CCAATTTCACAATCAGAACCAGG + Intronic
1094721368 12:33067820-33067842 GGAGTTGAACAATGAGAACATGG - Intergenic
1103546873 12:121708481-121708503 GCAGTTCCAGCATTAGACCCTGG + Intergenic
1104583790 12:130030815-130030837 GCAGTTTCCCAATAAGATCCTGG + Intergenic
1104793354 12:131498289-131498311 GCAGTGCCAGAATTTGAACCAGG + Intergenic
1108417409 13:50212292-50212314 GCAGTTGCACAATTAGAACCTGG - Intronic
1109063113 13:57645936-57645958 GCATTTCCACAAATAAAACCAGG - Intronic
1109793190 13:67276515-67276537 GCAGTTCCCCAATTAAATCCTGG - Intergenic
1111574440 13:90133093-90133115 GCAGTTTTACCGTTAGAACCAGG + Intergenic
1113346407 13:109482589-109482611 TCAGCTGCAGAATTGGAACCTGG - Intergenic
1113819103 13:113199170-113199192 GCAGTTGCACTAGTAGACTCAGG + Intronic
1117213163 14:53522708-53522730 GGAGTTGAACAATGAGAACACGG + Intergenic
1120169009 14:81230690-81230712 CCAATTGCACAATGAGATCCTGG - Intergenic
1120915419 14:89706063-89706085 GAAGGTGCACAATTAGAAAATGG - Intergenic
1126690221 15:51283340-51283362 GTAGTTGCAACATTAAAACCTGG + Intronic
1126886354 15:53155329-53155351 GCAGTTGCATACTTTGTACCAGG + Intergenic
1127769022 15:62215709-62215731 GTAGTTGCAACATTAAAACCTGG - Intergenic
1128071883 15:64802334-64802356 GTAGATGCAGAACTAGAACCAGG - Intergenic
1129530934 15:76263978-76264000 GTAGTTGCAACATTAAAACCTGG + Intronic
1133541777 16:6762801-6762823 GCAATTGCAAAATAAAAACCAGG + Intronic
1134598181 16:15512428-15512450 GCAGTTGGACAGGTAGAAACAGG + Intronic
1135229452 16:20691983-20692005 GCAGAGGAACAATTTGAACCAGG - Intronic
1140234826 16:73148851-73148873 GCAGTAGAACCATTTGAACCTGG + Intergenic
1140954719 16:79851770-79851792 GGAGTTGAACAATGAGAACATGG - Intergenic
1142995223 17:3756040-3756062 GTAGTTGCTCAAGGAGAACCTGG - Intronic
1153368594 18:4287631-4287653 GGAGTTGAACAATGAGAACAGGG + Intronic
1155354901 18:24942495-24942517 GCATTTCCACAAATAGGACCAGG - Intergenic
1156912561 18:42427705-42427727 ATAGTAGCATAATTAGAACCTGG - Intergenic
1157180980 18:45497746-45497768 GCAGTTTCACAAGTAGAATGGGG + Intronic
1157220893 18:45828001-45828023 GCTGCTTCACAGTTAGAACCAGG + Intronic
1161746993 19:6066727-6066749 GCAGATGTTCAATTAAAACCTGG + Intronic
1163566815 19:18056786-18056808 GCAGTTGCTCAATAAATACCAGG + Intergenic
1163923953 19:20321052-20321074 GTAGTTGCAACATTAAAACCTGG - Intergenic
1164323360 19:24170416-24170438 GTAGTTGCAACATTAAAACCTGG - Intergenic
1167754260 19:51401648-51401670 GTAGTTGCAACATTAAAACCTGG - Intergenic
933295723 2:80488758-80488780 GCATTTGTACAAATACAACCTGG - Intronic
933615180 2:84476353-84476375 GTAGTTGCAACATTAAAACCTGG - Intergenic
935422164 2:102880501-102880523 GCTGTTACACAATTATACCCGGG + Intergenic
937646336 2:124269689-124269711 GCAGCTGCACAATTGGTAGCTGG + Intronic
938847698 2:135227886-135227908 GCCCTTGCACAGTCAGAACCTGG - Exonic
941914858 2:170804901-170804923 GCAGTGGCGCAATCAGATCCTGG - Intergenic
942816251 2:180057548-180057570 ATAGTTGCAAAATTAAAACCTGG + Intergenic
944190106 2:196993833-196993855 ACAGTTGGACCATTAGCACCTGG - Intronic
945661895 2:212696702-212696724 GCATTTGCACAATGAGCTCCAGG + Intergenic
948226570 2:236315787-236315809 GCAGCTGAACAATGAGAACGTGG + Intergenic
1170367688 20:15615767-15615789 ACAGTTGCAAAATTAGAAATCGG + Intronic
1170967950 20:21093006-21093028 GCAGAGGCAGAATTAAAACCCGG + Intergenic
1173452269 20:43175540-43175562 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452278 20:43175590-43175612 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452285 20:43175640-43175662 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452294 20:43175690-43175712 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1174419345 20:50389633-50389655 GGAGTTGCCCAGTTAGAACTTGG - Intergenic
1178523463 21:33305090-33305112 ACAGTTGAAGACTTAGAACCAGG - Intergenic
1179627150 21:42654968-42654990 GCAGACGCACAACTAGACCCAGG + Intronic
1181665676 22:24394739-24394761 GCAACTGCAAAATTAAAACCAGG - Intronic
1184403501 22:44287103-44287125 GCAGAGGAAGAATTAGAACCAGG - Intronic
951414590 3:22408797-22408819 GGAGTTGAACAATTAGATTCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955363765 3:58294423-58294445 GCAGTCGCAGAATGAGCACCTGG + Exonic
957099662 3:75811343-75811365 GTAGTTGCAACATTAAAACCTGG - Intergenic
959730400 3:109594614-109594636 GCAGAGGCAGAATTCGAACCCGG - Intergenic
965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG + Intergenic
965665211 3:171086412-171086434 GCAGCAGCAGAATTTGAACCAGG + Intronic
965824893 3:172720402-172720424 GTAGTTGCAACATTAAAACCTGG + Intergenic
967083850 3:186076343-186076365 GCAGTGGCACAATGAGATCATGG + Intronic
968039921 3:195580099-195580121 GCAGAGTCACAATTTGAACCTGG - Intronic
968171019 3:196510598-196510620 AGAGTTGGACAATTAGAATCGGG - Intronic
968841706 4:3011699-3011721 GCAAATGCACGATTAGAATCTGG - Intronic
968842704 4:3019715-3019737 GAAGTTTCACATTTACAACCTGG + Exonic
970205307 4:13649699-13649721 GGAGTTGAACAATGAGAACATGG + Intergenic
970501789 4:16685232-16685254 GCAGAGCCAAAATTAGAACCTGG - Intronic
970612731 4:17740660-17740682 GCAGTTGCCCAGTTGGAAGCTGG + Intronic
971094805 4:23388787-23388809 GCAGCTGCAAGATTAGAACCTGG + Intergenic
973175193 4:47197043-47197065 GCAGAAGCAGAATTAGAGCCAGG + Intronic
977073900 4:92429064-92429086 GGAGTTGAACAATGAGAACATGG - Intronic
978305973 4:107329113-107329135 GTAGTTGCAACATTAAAACCTGG + Intergenic
979624981 4:122834602-122834624 GCAGTTTCAAAAGGAGAACCAGG - Intronic
981160194 4:141488261-141488283 GCAGATCCACAATTAGAACAAGG - Intergenic
981264215 4:142762176-142762198 GGAGTTGCAGAATGAGAGCCAGG - Intronic
981664359 4:147206252-147206274 TAAGTTGCACAATGAGAAGCAGG + Intergenic
992634913 5:78718111-78718133 GCAGGTGCACAGTTGGAACCTGG + Intronic
992762187 5:79960490-79960512 GCAGCTTCAGAACTAGAACCAGG - Intergenic
993329056 5:86573684-86573706 ACAGTAGAACATTTAGAACCTGG - Intergenic
996759920 5:126976728-126976750 GCAGTTGCACACATGGCACCTGG + Intronic
1000157446 5:158565649-158565671 GCAAATGCACAATTAGTATCAGG + Intergenic
1000404177 5:160868996-160869018 GCAGAAGCAAAATTAGAACCAGG - Intergenic
1001520377 5:172387460-172387482 GCCCTTGCACAAACAGAACCTGG + Intronic
1001998848 5:176184132-176184154 ACAGCAGCAGAATTAGAACCTGG + Intergenic
1002329287 5:178430385-178430407 CCAGTTGCACAATTCCATCCTGG + Intronic
1003495756 6:6661849-6661871 CCTGTTACACAATTAGAGCCTGG - Intergenic
1004814454 6:19297887-19297909 GCAGTTGCTGAAAAAGAACCTGG + Intergenic
1007561123 6:42809141-42809163 GTAGTTGAACAATGAGAACAGGG - Intronic
1009492033 6:64303181-64303203 GCAGTTGCAATGTTAGAAGCCGG - Intronic
1014291515 6:119563914-119563936 GAAGTTGCACTATTAGAAGGTGG - Intergenic
1014470765 6:121812005-121812027 GCAGTTGGAAAAGTAGAGCCAGG - Intergenic
1015622844 6:135150552-135150574 GGAGTTGAACAATGAGAACATGG - Intergenic
1019903016 7:4038771-4038793 GCAGTTACACAATAAGAAGTGGG - Intronic
1021142287 7:17041735-17041757 GTAGTTGAACAATTAAAACCAGG + Intergenic
1022453466 7:30537229-30537251 GTAGTTGCAACATTAAAACCTGG + Intronic
1023899867 7:44467403-44467425 GCAGTTGTACAATTTGAGTCAGG - Intronic
1025251603 7:57354850-57354872 GGAGTTGCCCAATTAGAACTTGG + Intergenic
1025805542 7:64828389-64828411 GCAGTTACACTCTTAGAATCAGG - Intronic
1031478954 7:122255496-122255518 GCAGATGCAAAAATACAACCAGG - Intergenic
1033085756 7:138340202-138340224 GTAGTTGCAACATTAAAACCTGG + Intergenic
1033426877 7:141252809-141252831 GCAGTGGCACAGTTAGCACCAGG + Intronic
1036505773 8:9354133-9354155 GTAGTTGCACAATTTTAATCTGG - Intergenic
1038239205 8:25792657-25792679 AAAGTTGCACAATTATAAACTGG - Intergenic
1039682153 8:39752219-39752241 ACAGTGGCAGAATTAGAAGCAGG + Intronic
1041671369 8:60494732-60494754 GTAGTTGCAACATTAAAACCTGG + Intergenic
1046085827 8:109434050-109434072 GGAGTTGAACAATGAGAACGAGG + Intronic
1048979586 8:139696017-139696039 GCAGATGTACATTTAGAAACTGG - Intronic
1051212354 9:14758075-14758097 GAAGGTGCACAATTCAAACCAGG + Intronic
1052096866 9:24393665-24393687 GGAGTTGAACAATGAGAACATGG + Intergenic
1052529226 9:29659086-29659108 GTAGTTGCAACATTAAAACCTGG - Intergenic
1055290222 9:74775018-74775040 GCAGTTCCACAATTGGTACCAGG - Intronic
1060219303 9:121755923-121755945 GCACTTGGACCATTGGAACCAGG + Intronic
1203687002 Un_GL000214v1:4578-4600 GTAGTTGCAACATTAAAACCTGG + Intergenic
1203649273 Un_KI270751v1:99475-99497 GTAGTTGCAACATTAAAACCTGG - Intergenic
1185547959 X:960998-961020 GCAGTTGCATAAATACAACCCGG - Intergenic
1186686757 X:11933019-11933041 GCAGTTGCTCAATAAATACCTGG + Intergenic
1187552727 X:20322168-20322190 GCAGTTGTACAAATAGATCTGGG + Intergenic
1188892731 X:35630607-35630629 GGAGTTGAACAATGAGAACATGG - Intergenic
1190568220 X:51752777-51752799 GCAATTGGACAATTTGAACTAGG - Intergenic
1193105687 X:77669361-77669383 GCAGTAGCACAATCTCAACCTGG + Intronic
1194033933 X:88847770-88847792 GTAGTTGCAACATTAAAACCTGG - Intergenic
1195060401 X:101188840-101188862 GTAGTTGCACCATTGAAACCTGG - Intergenic
1196664258 X:118299717-118299739 GTAGTTGCAACATTAAAACCTGG - Intergenic
1198414905 X:136410129-136410151 ACAGTTGCCCGGTTAGAACCAGG - Intronic
1199465433 X:148130400-148130422 GCAGTTGTACAATAAAAACAAGG + Intergenic
1200849105 Y:7864440-7864462 GCAGTTGCATTGTTAGAAGCTGG + Intergenic