ID: 1108418882

View in Genome Browser
Species Human (GRCh38)
Location 13:50228617-50228639
Sequence TAGGGCAGTAGGGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108418882_1108418886 -5 Left 1108418882 13:50228617-50228639 CCTGCAGCAGCCCTACTGCCCTA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1108418886 13:50228635-50228657 CCCTATGTACCAGCTGCAACTGG 0: 1
1: 0
2: 0
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108418882 Original CRISPR TAGGGCAGTAGGGCTGCTGC AGG (reversed) Intronic
900635405 1:3662418-3662440 CAGGACTGTGGGGCTGCTGCAGG + Intronic
900725225 1:4212079-4212101 TCTGGAAGTAGAGCTGCTGCAGG + Intergenic
900987276 1:6080451-6080473 CAGGGCAGTTGAGCTGCAGCAGG + Intronic
901221549 1:7586578-7586600 TGGGGCAGGAGGGAGGCTGCAGG - Intronic
901577142 1:10210379-10210401 CCGGGGAGTGGGGCTGCTGCGGG - Intergenic
903275373 1:22218149-22218171 GAGGGGAGTTGGGCTGCTGGGGG + Intergenic
903741418 1:25560653-25560675 TGGGGCAGCAGGGCTGCTGGGGG + Intronic
904441740 1:30536201-30536223 CATGGCAGGAGGTCTGCTGCAGG - Intergenic
904791253 1:33023328-33023350 TGGGGCAGGAGGACTGCTCCTGG + Intronic
904808946 1:33150994-33151016 CAGGGCAGAAGGACTGGTGCGGG + Intronic
905402103 1:37711261-37711283 TAGAACAGTAGGGCTGCCCCAGG + Intergenic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906477762 1:46181333-46181355 TATGGCAGCCTGGCTGCTGCTGG - Intronic
906626815 1:47332448-47332470 TCTGGCAGTATGGATGCTGCTGG - Intergenic
907265460 1:53257271-53257293 TAGGGTAGACGGGCTGATGCTGG + Exonic
911291290 1:96059497-96059519 TTGGGCAGCAGTGTTGCTGCAGG - Intergenic
912591377 1:110824375-110824397 CAGGGCAGTGGGGGTGCTGCAGG + Intergenic
916428524 1:164705156-164705178 TGGGGGAGTGGGGATGCTGCTGG - Intronic
917021327 1:170591263-170591285 GAGGAAACTAGGGCTGCTGCTGG + Intergenic
917169186 1:172150823-172150845 TATGCAGGTAGGGCTGCTGCGGG + Intronic
920156445 1:203955913-203955935 TAAAGCACTTGGGCTGCTGCAGG - Intergenic
922617282 1:226968665-226968687 CAGGGAGGTAGGGCTGCTGCAGG + Intronic
922678614 1:227570564-227570586 TGAGGCAGGAGGGCTGCTTCAGG - Intronic
923526720 1:234778562-234778584 TGGGGCTGGCGGGCTGCTGCTGG + Intergenic
1063543999 10:6962274-6962296 CAGGGCAGGAGTGCTTCTGCTGG - Intergenic
1064229463 10:13517311-13517333 TAAGGAAGGAGAGCTGCTGCAGG + Intronic
1066300898 10:34094588-34094610 TTGGTCAGTAAGGCTGGTGCTGG - Intergenic
1068140225 10:52996449-52996471 TTGGTCAGTAGGGCTGGTGTTGG - Intergenic
1070087627 10:73252344-73252366 TAAGGCAGTGTGGCTGCTTCAGG + Intronic
1071438288 10:85666980-85667002 TAGGGCAGTAGCACTGATGTTGG - Intronic
1071523768 10:86346662-86346684 TCGGGAAGCTGGGCTGCTGCTGG - Intronic
1076135003 10:128039728-128039750 TCAGGCAGGAGGGCTGCTGGTGG + Intronic
1076803396 10:132843456-132843478 GGGTGCTGTAGGGCTGCTGCTGG + Intronic
1076803405 10:132843491-132843513 GGGTGCTGTAGGGCTGCTGCTGG + Intronic
1077123892 11:924117-924139 CAGGGCAATGGGGGTGCTGCAGG - Intergenic
1077395061 11:2316539-2316561 TGGGGCAGTGGGGCAGCCGCGGG + Intronic
1079163011 11:18012394-18012416 TGGGGGAGTTGGGCTGCTGTTGG - Intronic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1081814041 11:45928812-45928834 CAGGGCTCTGGGGCTGCTGCAGG - Exonic
1081935343 11:46899986-46900008 CAGAGCAGTCAGGCTGCTGCAGG + Intronic
1083343082 11:61971495-61971517 GAGGGAAGTCGGTCTGCTGCAGG + Intergenic
1084369046 11:68726140-68726162 CAGGGTAGAAGGTCTGCTGCAGG + Intronic
1087709276 11:101530648-101530670 TTGGTCAGTAGGGCTGGTACTGG - Intronic
1089350044 11:117816985-117817007 GGGGGCAGGAGGGCTTCTGCTGG - Intronic
1089793186 11:120958921-120958943 TAGGGCAGAAGAGCTGAGGCAGG + Intronic
1090560182 11:127924191-127924213 TAGGGCTGTAGGGCTGATATTGG - Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1101603186 12:106227878-106227900 CAGGGCAGTTGAGTTGCTGCAGG - Intergenic
1101778492 12:107815154-107815176 TGGGGCAGCAGTGCTGCAGCTGG - Intergenic
1106054747 13:26227783-26227805 TGGGGCAGCAGTGCTGCAGCAGG + Intergenic
1106368305 13:29105691-29105713 TAGGGAAGTAGGGATACAGCTGG + Intronic
1107104224 13:36626232-36626254 TAGGAAACGAGGGCTGCTGCTGG - Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1110194437 13:72770491-72770513 GATGGCAGTAGGGCTGGGGCTGG + Intronic
1114382060 14:22217103-22217125 TTGGGTAGTAGTGCTGTTGCTGG - Intergenic
1114497072 14:23140208-23140230 TAAGGCAGTAGTGTTACTGCAGG + Intronic
1114584648 14:23799499-23799521 TAGGGGAGAAGGGCGGTTGCCGG - Intergenic
1117341823 14:54798186-54798208 AAGGGCAGTAGCTGTGCTGCCGG + Intergenic
1117771594 14:59139333-59139355 TTGGGCAGAAGGGCTGCTGGGGG - Intergenic
1122071892 14:99210373-99210395 CAGGGATGTAGGGCAGCTGCAGG - Intronic
1122762602 14:104040622-104040644 CGGGGCTGTAGGGCTGCTGTGGG + Intronic
1124400461 15:29343486-29343508 TAGGGCAGCAGGGAGGCTGGAGG - Intronic
1124508655 15:30303629-30303651 TTGGTCAGTAGGGCTGGTGATGG + Intergenic
1124734902 15:32235032-32235054 TTGGTCAGTAGGGCTGGTGATGG - Intergenic
1126687000 15:51257108-51257130 GAGGGCAGTATTGATGCTGCAGG - Intronic
1127637892 15:60888823-60888845 CTGGGCAGGAGGCCTGCTGCTGG - Intronic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1129753734 15:78083505-78083527 CAGGGCAGTAGGCTTGGTGCAGG - Intronic
1129936088 15:79451406-79451428 TGGGGCAGAAGGGCTGTTCCAGG + Intronic
1131120939 15:89823087-89823109 TGGGGCACCAGGGCTGCTGCTGG + Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132763602 16:1523529-1523551 GAGGGCGGTAGAGCTGCTGCTGG - Exonic
1134599721 16:15523821-15523843 TAGGGCATCAGGGCTGCTTATGG + Intronic
1138426512 16:56937106-56937128 TAGGAAATTAGTGCTGCTGCAGG + Intronic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1141428822 16:83960533-83960555 TAGGTCAGAGGGGCTGCTGGAGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1142072269 16:88097664-88097686 AAGGGCTGTGGGGCTGATGCCGG - Intronic
1142353052 16:89588532-89588554 TAGGGCTGGGGGGCTGCTGTTGG - Intronic
1142780297 17:2176279-2176301 TAGGGCCTAAGGGCTGCTGTCGG - Intronic
1144454987 17:15411596-15411618 TAGGGCAGAAGAGGTGCAGCTGG + Intergenic
1144819048 17:18058636-18058658 TAGGGCAGTGGGGCCCCAGCTGG + Intronic
1144899249 17:18568858-18568880 TGGGGAAGAAGGGCCGCTGCTGG + Intergenic
1146596090 17:34170317-34170339 TCGGTCAGTTGGGATGCTGCCGG - Intronic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147893895 17:43737761-43737783 TGGGGCAGTGGTGCTGTTGCTGG - Intergenic
1148270636 17:46259619-46259641 TGTGTCTGTAGGGCTGCTGCAGG - Intergenic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148498586 17:48071280-48071302 TAAAGCACTTGGGCTGCTGCAGG + Exonic
1150570563 17:66382759-66382781 TGGGGCTGGAGGGCTGCTACTGG + Intronic
1151890574 17:76948576-76948598 TTGGGCAGAAGGGCTGGGGCGGG - Intronic
1152293422 17:79453549-79453571 TGGGGCTGTGGGGCTGCAGCAGG - Intronic
1152755311 17:82084726-82084748 CAGGGAGGTGGGGCTGCTGCGGG + Intronic
1153239493 18:3017469-3017491 TAGGGCAGTAGGGCAATTGAGGG - Intergenic
1153686995 18:7556282-7556304 GAGGGCACTAGGGCTGATTCTGG + Intergenic
1153766883 18:8383536-8383558 CAGGGCAGTAGGAGTGGTGCTGG - Intronic
1156886150 18:42138798-42138820 TTGAGCAGTAGGGATGCTGGAGG + Intergenic
1157143342 18:45134991-45135013 TGGTGCATCAGGGCTGCTGCAGG - Intergenic
1163255731 19:16154693-16154715 TATGGCAGCAGGGCTGGCGCTGG - Intronic
1164539794 19:29114116-29114138 TGGGGCAGTAGGGTTGAGGCTGG + Intergenic
1166819888 19:45571560-45571582 TATGGCAGCCAGGCTGCTGCTGG - Intronic
925378377 2:3405325-3405347 TGGGGCAGTAGGGATGGTACTGG - Intronic
925492749 2:4413049-4413071 AAGGCCAGTGGGGCTGCCGCAGG - Intergenic
925900445 2:8505538-8505560 TAGGACTGCAGGGCTGCTGGGGG - Intergenic
926272294 2:11375817-11375839 AAGGGCAGTGGGGCCGCTGATGG + Intergenic
926392157 2:12404411-12404433 CAAGGCAGCAGGGCTGCTGTTGG + Intergenic
927212235 2:20645926-20645948 ATGGGCAGGAGGGCTGCTACAGG + Intronic
927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG + Intergenic
927358029 2:22196412-22196434 TAGGGCAGGGGAGCTGGTGCAGG + Intergenic
927458189 2:23275436-23275458 TAGGGCAGTATGGCTGGAGTAGG + Intergenic
928437837 2:31267183-31267205 GAGGGCAGGCGGGCAGCTGCAGG + Exonic
930772438 2:55141509-55141531 AAGGGCAATAGGGGTGCTGAAGG + Intergenic
931396916 2:61895854-61895876 TTGGTCAGTAGGGCTGGTGTTGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932750275 2:74367140-74367162 TAAGGCAGAAGGGCTCCTGCTGG - Intronic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
935828733 2:106977151-106977173 AAGGGCTGTAGGGTTGGTGCGGG + Intergenic
936438460 2:112529116-112529138 TAAGGCACTAGGGCTGCAGTGGG - Exonic
936438468 2:112529148-112529170 CAGAGCAGTGGGGCTGCAGCCGG - Exonic
936944131 2:117915279-117915301 TGGGACAGACGGGCTGCTGCAGG - Intergenic
938292717 2:130158719-130158741 CAGGGAAGTAGGGGTGCTGAGGG + Intronic
938293434 2:130162328-130162350 TTGGGCAGGAGGCATGCTGCTGG - Intronic
938381199 2:130837398-130837420 TTGGGAAGGAGGGCTGGTGCCGG + Intronic
938463120 2:131510633-131510655 TTGGGCAGGAGGCATGCTGCTGG + Intergenic
938765888 2:134460263-134460285 GAGGGCAGGATGGCTGTTGCAGG - Intronic
939615092 2:144353559-144353581 TAGGGCAGTAGGACAGCTCCTGG + Intergenic
941036098 2:160570743-160570765 TAGTGCAGCAGGGGTGGTGCGGG - Intergenic
941421312 2:165285801-165285823 GTGGGCAGTAGGAGTGCTGCAGG + Intronic
941489642 2:166127298-166127320 GAAGGCAGCGGGGCTGCTGCTGG - Intronic
943367786 2:186982060-186982082 TAGGGCACTGTGGCTGCAGCTGG - Intergenic
944243863 2:197512208-197512230 TAAGCCAGAATGGCTGCTGCAGG + Intronic
945807998 2:214513886-214513908 GAGGGCAATATGGCTGCTACTGG - Intronic
947800272 2:232925266-232925288 GAAGGCAGCTGGGCTGCTGCAGG + Intronic
948604480 2:239126264-239126286 AGGGGCAGAAGGGATGCTGCTGG - Intronic
948714458 2:239851779-239851801 TAGGGAAACAGGGCTGCTGGTGG + Intergenic
1169195498 20:3680322-3680344 GGGGGAAGGAGGGCTGCTGCAGG - Intronic
1170130290 20:13011619-13011641 TGGGGCAGCAAGCCTGCTGCAGG - Intronic
1170446811 20:16436703-16436725 TACAGCAGTATTGCTGCTGCAGG + Intronic
1170603463 20:17859220-17859242 TAGGGCAGTCGGGTTGCAGCTGG + Intergenic
1172008595 20:31833659-31833681 CAGGGCAGGGGGGCAGCTGCAGG - Intronic
1172493449 20:35360273-35360295 TAGGGCATTCAGGCTTCTGCTGG - Intronic
1172669877 20:36627625-36627647 CAGCGCAGAGGGGCTGCTGCTGG + Intronic
1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG + Intronic
1172806642 20:37616612-37616634 GAGGCCAGCATGGCTGCTGCTGG + Intergenic
1173225994 20:41162791-41162813 CAGGGCAGCAGGGCTGAGGCAGG - Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1179567580 21:42258722-42258744 CAGGGGAGTAGGGCGCCTGCTGG + Intronic
1181443580 22:22951514-22951536 TGGTGCAGTAGTGCTGCAGCTGG - Intergenic
1181585443 22:23850390-23850412 CCGGGCTGTAGGGCTGGTGCGGG + Intergenic
1181936724 22:26444005-26444027 TTTGGCAGTAGGGCTTCTGTAGG - Exonic
1182335066 22:29578540-29578562 CAGGCCAGAAGGGCTGCTGCTGG + Intronic
1183283925 22:36951021-36951043 CAGGGCAGTGGGGCTGTTGTGGG + Intergenic
1183481696 22:38068917-38068939 GGGGGCAGAAGGGCTGCTGGGGG - Intronic
1183670423 22:39269504-39269526 CAGGACAGTAGGACGGCTGCTGG + Intergenic
1184047707 22:41981842-41981864 GAAGGCTGTGGGGCTGCTGCAGG + Intronic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1185131956 22:49044332-49044354 AGGGGCAGCAAGGCTGCTGCTGG + Intergenic
951249907 3:20382427-20382449 TAGGTCACTAGGGCTGCTCAGGG + Intergenic
952998637 3:38909482-38909504 TAGGGCAGTAGGGAATCTGGAGG + Intronic
954366094 3:50146957-50146979 TAGAGCACGGGGGCTGCTGCCGG - Intergenic
954742990 3:52769707-52769729 CAGGACAGTAGGACTGCTCCAGG - Intronic
956785491 3:72638742-72638764 TAGGGCAGAAGGGATGGTGGTGG + Intergenic
957927413 3:86832584-86832606 TGGGGAGCTAGGGCTGCTGCTGG - Intergenic
961352018 3:126310155-126310177 TAGGCCAGGAGGGCTCCTGCTGG - Intergenic
962628141 3:137248167-137248189 CAGGGAGGTGGGGCTGCTGCTGG + Intergenic
962837750 3:139203929-139203951 AAGGGCACTAGACCTGCTGCAGG + Intronic
967894203 3:194383684-194383706 GAGGGCAGTAGGGATGCTCACGG + Intergenic
968669850 4:1843401-1843423 GAGGGCAGTGCGGCTGGTGCAGG + Intronic
968951893 4:3699754-3699776 GAAGGCAGCAGAGCTGCTGCAGG + Intergenic
969046823 4:4342437-4342459 TCGGGCAGTGGGGATGCAGCGGG - Intergenic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
974467293 4:62273500-62273522 GAGGGCAGAAGAGCTGCTGGTGG - Intergenic
975900119 4:79141398-79141420 TGGGGCAGCAGGGGTGATGCTGG + Intergenic
983395808 4:167194780-167194802 TTGGCCAGTAGGGCTAGTGCTGG + Intronic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
986212783 5:5689922-5689944 TAGGGCAGGAGGGAGCCTGCAGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
996923930 5:128800387-128800409 GGGGGCAGTGGGGCTCCTGCAGG + Intronic
996949059 5:129103075-129103097 TATTTCAGTAGGCCTGCTGCAGG + Intronic
998267518 5:140677281-140677303 GAGGGCAGTGGGACGGCTGCTGG + Intronic
1001667747 5:173447280-173447302 TAGGGCAAGATGGCAGCTGCTGG - Intergenic
1001886228 5:175293139-175293161 GAGGACAGTAAGGCAGCTGCAGG - Intergenic
1002563506 5:180097847-180097869 TGGGGCAGAGGGGCTTCTGCTGG - Intergenic
1002607026 5:180389562-180389584 TGGGGCTGTAGGACAGCTGCTGG + Intergenic
1006919643 6:37619051-37619073 CAGGGCAGAGGGGCTGCTCCAGG + Intergenic
1007389748 6:41544218-41544240 TAAGGTACAAGGGCTGCTGCAGG + Intergenic
1011800493 6:91009076-91009098 TAAGGCAATATGGCTGCAGCTGG - Intergenic
1014111596 6:117623755-117623777 TAGGTCACTAGGGCTGCTTAGGG + Intergenic
1015742134 6:136468053-136468075 TGGGGCTGTAGGGGTGGTGCTGG - Intronic
1016753686 6:147660395-147660417 TAGGGAAGCAGGGTGGCTGCAGG - Intronic
1018392344 6:163350126-163350148 TGGGGATCTAGGGCTGCTGCAGG - Intergenic
1018443562 6:163834771-163834793 TAGGGCAGGAGAGCTGCGCCAGG - Intergenic
1018838274 6:167501204-167501226 CAGGGCAGGAGGGCTGTGGCCGG - Intergenic
1019565842 7:1678669-1678691 AAGGGCAGCAGGGCTGAGGCTGG - Intergenic
1019701663 7:2477235-2477257 CAGAGCCCTAGGGCTGCTGCAGG + Intergenic
1021556312 7:21922329-21922351 CAGGGCAGTAGGTCAGCTGTAGG + Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1024980398 7:55153262-55153284 TGGGGCAGCAAGGCTTCTGCTGG - Intronic
1025029363 7:55544368-55544390 TGGGGCAGTAGGGCTGGTGGGGG + Intronic
1025842453 7:65163333-65163355 TGAGGAAGTAGGGCTGCCGCAGG + Intergenic
1025880592 7:65532636-65532658 TGAGGAAGTAGGGCTGCCGCAGG - Intergenic
1025892845 7:65669968-65669990 TGAGGAAGTAGGGCTGCCGCAGG + Intergenic
1025928223 7:65975751-65975773 CAAGGCAGGAGGACTGCTGCAGG + Intronic
1027278103 7:76583246-76583268 AAGGGCAAGAGGGCTGCTGAGGG + Intergenic
1029157173 7:98525588-98525610 CAGGGCTTCAGGGCTGCTGCTGG + Intergenic
1029625544 7:101718313-101718335 TCGGGGAGTAGGGGTGCTCCAGG + Intergenic
1034430103 7:151036839-151036861 TGGGGCAGTGGCGCTGCAGCAGG + Intronic
1034707241 7:153156637-153156659 CAGAGCAGAAGGGCTGCTGGAGG + Intergenic
1036939691 8:13039606-13039628 TAGGTCAGTAAGGCTGCATCAGG + Intergenic
1037652254 8:20849498-20849520 TTGGGCAGTGGGGGTGCTGGTGG - Intergenic
1039922591 8:41903786-41903808 GAGTGCAGTAGGGCTGCACCCGG - Intergenic
1041045066 8:53880714-53880736 TGGAGCAGTGGGGCTGCGGCCGG + Intronic
1049462742 8:142737580-142737602 TGGGGCAGTAGGGCTGGGGAGGG + Intergenic
1049859900 8:144891053-144891075 TGGGGTAGTGGGGCTGGTGCTGG + Intronic
1050364905 9:4864885-4864907 TAGAGCACTTGGGCTGCTGCCGG + Intronic
1051612107 9:18971070-18971092 TTGGGTAGGAGGGCTGGTGCAGG - Intronic
1055839136 9:80481847-80481869 TTGGTCAGTAGGGCTGGTGCTGG + Intergenic
1056931419 9:90880957-90880979 TTGGGCAGCATGGCAGCTGCGGG + Intronic
1058382199 9:104389398-104389420 TAGGGCATCAGGACTGCTGGTGG + Intergenic
1059144729 9:111889027-111889049 TAGGGCAGGAGGATTGCTTCAGG + Intergenic
1060615261 9:125007454-125007476 TAGGGCAGAAGGACTGCTTGAGG + Intronic
1061369027 9:130187539-130187561 CAGGGCAGAACGGCTCCTGCAGG - Intronic
1061920618 9:133780402-133780424 GGGGGCAGGAGGGCTGGTGCAGG + Intronic
1061956221 9:133962514-133962536 CAGGGCACCTGGGCTGCTGCGGG + Intronic
1062716526 9:138013262-138013284 GGTGGCAGTGGGGCTGCTGCAGG + Intronic
1186386032 X:9110923-9110945 AAGGGCAGGAGGGGTACTGCTGG + Intronic
1190057998 X:47193293-47193315 CAGGGAAATGGGGCTGCTGCAGG - Intronic
1190500760 X:51075649-51075671 CTGGTCAGTAGGGCTGGTGCTGG - Intergenic
1192796108 X:74425098-74425120 TGAGGCAGTAGGACTGCTGGAGG - Intronic
1194110111 X:89823754-89823776 CTGGGCAACAGGGCTGCTGCTGG - Intergenic
1197095695 X:122592014-122592036 TAGGTTTGTAGGGCTGCTGGAGG - Intergenic
1199604151 X:149563353-149563375 TGGGGCAGTTGGGCTTCTGGAGG - Intergenic
1200462770 Y:3478495-3478517 CTGGGCAACAGGGCTGCTGCTGG - Intergenic
1200987884 Y:9323773-9323795 TGGGGCAGTGGGGCTGCCACGGG - Intergenic