ID: 1108420546

View in Genome Browser
Species Human (GRCh38)
Location 13:50244768-50244790
Sequence GAATGTGACAAGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 477}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108420546_1108420550 11 Left 1108420546 13:50244768-50244790 CCACCTTCCCTCTTGTCACATTC 0: 1
1: 0
2: 2
3: 40
4: 477
Right 1108420550 13:50244802-50244824 CACATTTTATTTCTCTGCCTAGG 0: 1
1: 1
2: 2
3: 40
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108420546 Original CRISPR GAATGTGACAAGAGGGAAGG TGG (reversed) Intronic
900020366 1:183616-183638 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
901430610 1:9211765-9211787 GCATGTCACAAGTGGGGAGGGGG + Intergenic
901432378 1:9224935-9224957 GACTGAGACTAGAGGGAAAGAGG - Intergenic
902442781 1:16441763-16441785 GAAAGTAACAAGAGGAAATGTGG - Intronic
903052879 1:20614694-20614716 GAATTTGAGAAGAGGCAAGAAGG + Intronic
904506919 1:30964697-30964719 CCATGTGAAGAGAGGGAAGGAGG + Exonic
904891203 1:33780955-33780977 GCATCTGACAAGAGGAAAGGCGG + Intronic
904925816 1:34047420-34047442 AAATGGGACAGGAGGGGAGGAGG - Intronic
906110127 1:43317169-43317191 GGATGAGACAAGAGGGCAGACGG - Intronic
906801641 1:48742935-48742957 GAATGTCACAAGGGAAAAGGTGG + Intronic
906913814 1:49985195-49985217 GTATTTTACAAGAGGGAATGTGG - Intronic
908260399 1:62335767-62335789 GGAAGTGACAAGAGGGAGGTGGG + Intergenic
908846042 1:68325275-68325297 GAATGGCAAAAAAGGGAAGGGGG - Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909569726 1:77095564-77095586 CAATATGACAAAAGGGTAGGGGG + Intronic
909749893 1:79145943-79145965 GAATGGGACAAAAGGGAAAAAGG - Intergenic
911155703 1:94634797-94634819 GAATGTGACTAGAAGGAAAAAGG - Intergenic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
912274713 1:108244006-108244028 GACTCTGACAAGAGTGAGGGAGG + Exonic
912286552 1:108375852-108375874 GACTCTGACAAGAGTGAGGGAGG - Exonic
912293505 1:108450335-108450357 GACTCTGACAAGAGTGAGGGAGG - Intronic
912879682 1:113397954-113397976 GGCTGTAACAAAAGGGAAGGCGG - Intronic
913038318 1:114997045-114997067 GAATGTCATAACAGGGAAGAGGG + Intergenic
914940461 1:152018400-152018422 GACTCTGACAAGAGTGAGGGAGG - Intergenic
915518978 1:156430442-156430464 GTATGAGAGAGGAGGGAAGGGGG - Intronic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
916294753 1:163205560-163205582 GAATGTGAAAAGAGGTGAGTAGG + Intronic
916320822 1:163501792-163501814 GAATGTGAAAATAGGGAGAGGGG - Intergenic
916607877 1:166360986-166361008 GAATGTGACAGGAAAGAAGGAGG + Intergenic
916677506 1:167076210-167076232 GAATGAGCCAAGAGAGAATGGGG + Intronic
917720452 1:177782031-177782053 GAATGAGACCTGAGTGAAGGGGG + Intergenic
918039790 1:180907076-180907098 GGAAGAGAAAAGAGGGAAGGGGG + Intergenic
919808045 1:201392442-201392464 GTAAGTGACATGAGAGAAGGTGG + Intronic
920057462 1:203202909-203202931 GCAGCTGACAGGAGGGAAGGGGG - Intergenic
920133742 1:203753216-203753238 GAATGTGACAACAGGAGTGGGGG - Intergenic
920156235 1:203954377-203954399 GAATGTTGAAAGAGGGCAGGAGG + Intergenic
920805358 1:209228716-209228738 GAATGAAACAAGAGGGAAAATGG + Intergenic
921211114 1:212899436-212899458 GAATGGGCAAAGAGGGAATGAGG + Intergenic
921266604 1:213425875-213425897 GATGGTGACCAGCGGGAAGGTGG + Intergenic
921477575 1:215629556-215629578 GAATGAGAAATGAGGGAGGGAGG - Intronic
921495670 1:215838173-215838195 TCATGTGAAATGAGGGAAGGTGG - Intronic
922191535 1:223323170-223323192 GAGAGTGACAAAAAGGAAGGAGG + Intronic
922505994 1:226126008-226126030 GAGAGTAACAGGAGGGAAGGAGG - Intergenic
923127577 1:231045977-231045999 GAAAGAGAGAAGAGGGAGGGAGG + Intergenic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063713112 10:8499992-8500014 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1064119065 10:12603674-12603696 GAATGGGTCAAGCGGGAAAGAGG - Intronic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065257409 10:23884975-23884997 AAATGGGAGAAGAGGAAAGGTGG - Intronic
1067233286 10:44426662-44426684 GGTTGTGAAAAGAGGGAGGGAGG - Intergenic
1068107675 10:52639304-52639326 GATTGTGACAAGAGAGTATGAGG - Intergenic
1068305936 10:55208417-55208439 GAATGTGAGAGGTGGGAAGCAGG - Intronic
1069077526 10:64053374-64053396 GCATGGGACAAGGGGGAAGAAGG + Intergenic
1069129955 10:64687220-64687242 GAATGAGAAACGAGTGAAGGGGG - Intergenic
1070895653 10:79981670-79981692 GGCTGTGGGAAGAGGGAAGGTGG + Intronic
1071175546 10:82922819-82922841 GGATGGGACAATATGGAAGGAGG - Intronic
1071432653 10:85618496-85618518 AGAGATGACAAGAGGGAAGGAGG - Intronic
1071441043 10:85695310-85695332 GGATGTGACATGAGAGAAGTGGG + Intronic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072553214 10:96494503-96494525 GAAGGTGAGATGAGGTAAGGTGG - Intronic
1072637328 10:97186216-97186238 GGATGGGAGAAGAGGGAAGGGGG + Intronic
1073755926 10:106580412-106580434 GACTGTGAGATGGGGGAAGGTGG - Intronic
1073954098 10:108847969-108847991 GAAAGTGAAAAGATGGAGGGAGG + Intergenic
1075055508 10:119215480-119215502 GAAGGAGAAAATAGGGAAGGGGG + Intronic
1075122691 10:119675854-119675876 GAAGGGGGCAAGGGGGAAGGGGG - Intronic
1075417064 10:122271979-122272001 GAATCTGAGAAGAGAGAAGAGGG - Intronic
1075469896 10:122680179-122680201 GAATGTGACCAGGGGAGAGGAGG + Intergenic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1076934102 10:133555962-133555984 GAAGGTGAGACCAGGGAAGGTGG - Exonic
1078083805 11:8221817-8221839 GAAACTGATAAGAGGGTAGGGGG - Intergenic
1078249706 11:9607060-9607082 CCATGTGACAAGGAGGAAGGTGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078276167 11:9849568-9849590 GAATGGAATAAGAGGGAAGTGGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078495509 11:11812684-11812706 CAATGAGACAACAGGAAAGGAGG + Intergenic
1078877831 11:15415779-15415801 AATTGTGGCAAGAGGGCAGGGGG - Intergenic
1079288819 11:19167212-19167234 GAATGTAACAAGAGGGTGGATGG - Intronic
1079761518 11:24335332-24335354 CAATGTGACATGAGTGAATGTGG + Intergenic
1080394297 11:31875713-31875735 AAATGTGGCAAGTGGGATGGAGG + Intronic
1081412195 11:42773005-42773027 GACTGTGACAACAGAGGAGGAGG + Intergenic
1081649047 11:44811335-44811357 GGATGTGATAAGAGAGAGGGAGG + Intronic
1081845394 11:46237611-46237633 GAATGTGTCAACAGCCAAGGGGG + Intergenic
1082007219 11:47426132-47426154 GCCATTGACAAGAGGGAAGGAGG - Intronic
1082067474 11:47912422-47912444 AAAGGTGGCAAGAAGGAAGGAGG + Intergenic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1083990535 11:66243480-66243502 GAAGGGGAAAAGCGGGAAGGAGG - Exonic
1084096112 11:66912710-66912732 GAGTGGGCCAAGAGGGAATGGGG + Intronic
1084440493 11:69170040-69170062 GACTGTGAGAAGAGGGAGTGGGG - Intergenic
1084493802 11:69492258-69492280 GGATGTGAAATGAGGGAAAGAGG + Intergenic
1085023527 11:73223513-73223535 GAATAAGACAAGGGGGCAGGTGG - Intronic
1085122281 11:73974845-73974867 GAATGTAGAAAGAGGGAAGGTGG + Exonic
1085943956 11:81243388-81243410 AAATGTGAGAAGAGGGAAAGAGG - Intergenic
1086672757 11:89567589-89567611 GAATGAGTGCAGAGGGAAGGGGG + Intergenic
1086816224 11:91374924-91374946 GAAAGAGACAAGAGGTAAGAAGG - Intergenic
1089533338 11:119146049-119146071 GAAGGTGACAATAGGTAATGAGG + Intergenic
1089817234 11:121187280-121187302 CAATGCCACAAGAAGGAAGGGGG + Intronic
1090431098 11:126647411-126647433 GAATTTGATTAGAGGGAAAGGGG - Intronic
1090533291 11:127613502-127613524 GAATGAGACAAAATGGAAGAAGG - Intergenic
1090985318 11:131761141-131761163 GAAAGTGGCAAGAGGCAGGGAGG + Intronic
1091373745 12:13224-13246 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
1091452179 12:579635-579657 ACATGTGACAAGAGGGAGTGGGG - Intronic
1092320101 12:7462924-7462946 GAATGAGAGCAGAGTGAAGGGGG + Intronic
1092931522 12:13320247-13320269 GAAGGTGAGAATGGGGAAGGAGG + Intergenic
1093764896 12:22952096-22952118 GAAGGAGAGAAGAGAGAAGGAGG - Intergenic
1093919887 12:24848072-24848094 AAAAATGGCAAGAGGGAAGGTGG - Intronic
1095649473 12:44589958-44589980 GAATGTGACAAGAGGAAGGCAGG - Intronic
1095999399 12:48116198-48116220 GAAGGAGAAAAGAAGGAAGGAGG - Intronic
1096110653 12:49027195-49027217 GAAGGTGCCAAGGGGGAAGGGGG + Exonic
1096257491 12:50072334-50072356 GAAGGTGACCCGAGGGGAGGAGG - Intronic
1096737028 12:53663688-53663710 GAAACTGAGAAGAGGGAAGCAGG + Intronic
1098692797 12:73510310-73510332 CACTATGAAAAGAGGGAAGGTGG + Intergenic
1098924758 12:76337186-76337208 GAGTGTGACAAGAAGCAAAGAGG + Intergenic
1099645658 12:85352018-85352040 GAAGGTGACAAAAAGGTAGGAGG + Intergenic
1099964429 12:89430566-89430588 GAAGGAGAGAAGAGGAAAGGAGG - Intronic
1100563079 12:95768548-95768570 GGATGAGACAAGAGGCCAGGGGG + Intronic
1101168591 12:102064147-102064169 GAATGTGACTTGAGGGTAGGTGG + Intergenic
1101349736 12:103918021-103918043 GAAGGAGAAAAGAGGGAATGAGG + Intergenic
1102201531 12:111060875-111060897 GAAGCTGACAAGAGGGTAGAAGG - Intronic
1102924347 12:116815492-116815514 GAAGGGGACCAGAGGCAAGGAGG - Intronic
1103091713 12:118102812-118102834 GAGTGTGACAAGCTGGGAGGAGG - Intronic
1103421440 12:120787507-120787529 GAAAGTGACAGGAGTGAGGGTGG - Intronic
1103538063 12:121647090-121647112 GAAAGTCACATGAGTGAAGGCGG - Intergenic
1104003402 12:124874971-124874993 GAAAGTGCCAGGAGGGATGGTGG + Intronic
1104623363 12:130334802-130334824 GAGTGTGACAATTGGGAACGTGG - Intergenic
1104984881 12:132591207-132591229 GAAGGTGCCGAGAGCGAAGGTGG - Intergenic
1106287486 13:28330097-28330119 GAAGGTGAGAAGAGGGGACGTGG - Intronic
1107540268 13:41383020-41383042 AAATGTGACAAGATGAAAGGAGG - Intergenic
1107569176 13:41638477-41638499 GAAGCAGACAAGAGGGAAGCTGG + Intronic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108462126 13:50677206-50677228 GGCTGGGACAGGAGGGAAGGAGG - Intronic
1109770640 13:66967398-66967420 GAATGTGACAAGTGTGATTGAGG - Intronic
1110552860 13:76827905-76827927 GAAGGAGGGAAGAGGGAAGGGGG + Intergenic
1110643587 13:77854940-77854962 GCAAGGGACAAGAGGGCAGGAGG + Intergenic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1112004172 13:95240156-95240178 GAGGGTCACAAGAGGGGAGGAGG + Intronic
1112763633 13:102718142-102718164 GTATCTGACAAGAGGAAAGTAGG + Intergenic
1112958276 13:105088657-105088679 GGATTCTACAAGAGGGAAGGAGG - Intergenic
1114040424 14:18673239-18673261 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1114045462 14:18871756-18871778 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1114118750 14:19647712-19647734 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1114137624 14:19869632-19869654 GAATCAAACATGAGGGAAGGAGG + Intergenic
1114662213 14:24354256-24354278 GAATGAGGGAGGAGGGAAGGAGG - Intergenic
1115353789 14:32425591-32425613 GAAAGAGAAAGGAGGGAAGGAGG + Intronic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1117332496 14:54726842-54726864 GTAGGTCACAAGATGGAAGGTGG + Intronic
1117601887 14:57384701-57384723 GAAAGAGAAGAGAGGGAAGGGGG + Intergenic
1118821829 14:69350792-69350814 GAATGAGAGAAGATGGAAGAGGG + Intronic
1119526542 14:75327240-75327262 GAATGCTCCAACAGGGAAGGAGG - Intergenic
1119852194 14:77874142-77874164 AAATGGGACAAGAGGGTTGGAGG + Intronic
1120521994 14:85534483-85534505 GAAGGTGAAGGGAGGGAAGGAGG - Intronic
1120883105 14:89429946-89429968 GAATGTGACAATAGACAAGGGGG - Intronic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121430624 14:93884696-93884718 GAATGTGTCAGGAGTGAGGGTGG - Intergenic
1121473221 14:94173404-94173426 GAATGGGACGAGATGGAAGGGGG - Intronic
1122805645 14:104255240-104255262 AAATTGGACAGGAGGGAAGGGGG - Intergenic
1123137668 14:106044601-106044623 GGATTTGACAGAAGGGAAGGTGG + Intergenic
1123576692 15:21676701-21676723 GACTGTGCCAAGAGGAATGGTGG - Intergenic
1123613314 15:22119169-22119191 GACTGTGCCAAGAGGAATGGTGG - Intergenic
1123972625 15:25522595-25522617 GAAAGTGCCAAGAGGAAAGAAGG + Intergenic
1124854172 15:33371169-33371191 GAATGAGAGAACAGGTAAGGAGG + Intronic
1125641110 15:41231318-41231340 GACGGCGACAGGAGGGAAGGAGG - Exonic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127052756 15:55101732-55101754 CAATGTGACAAGGTAGAAGGAGG - Intergenic
1127479552 15:59365961-59365983 GAAGGGAAGAAGAGGGAAGGAGG - Intronic
1128944437 15:71811397-71811419 GAAAGGGACCCGAGGGAAGGAGG + Intronic
1129044886 15:72725784-72725806 GGATGGGGGAAGAGGGAAGGAGG - Intronic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129394860 15:75238192-75238214 GCATGTGACCAGAGGGATGGGGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129476898 15:75791763-75791785 GAATGGGCAAAGAAGGAAGGAGG + Intergenic
1129644582 15:77419292-77419314 GCATGCGACGAGAGGGGAGGGGG + Intronic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130236517 15:82140140-82140162 GAAGTAGACAAGAGGAAAGGGGG - Intronic
1130379714 15:83360936-83360958 GAATGAGAGCAGAGTGAAGGGGG - Intergenic
1130550584 15:84887942-84887964 GAATGGGGTATGAGGGAAGGTGG - Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1131330388 15:91493192-91493214 GGATGTGAGAAGAAGAAAGGAGG + Intergenic
1131549194 15:93342046-93342068 GGATGAGAGAAGAGGGCAGGTGG + Intergenic
1202985560 15_KI270727v1_random:410946-410968 GACTGTGCCAAGAGGAATGGTGG - Intergenic
1136068838 16:27776188-27776210 GAATATGCCAAGAGGGAGTGCGG - Intronic
1136537545 16:30909156-30909178 GAATGTGGCAAGGGGGATGAAGG - Intergenic
1137057597 16:35753012-35753034 GGATGTGACAAGGGTGCAGGTGG - Intergenic
1138109158 16:54309489-54309511 AAGTGTGACATGTGGGAAGGAGG - Intergenic
1138519331 16:57562144-57562166 GAATGCAACAACAGGTAAGGGGG + Exonic
1139252173 16:65506864-65506886 GGAAGTGAGAACAGGGAAGGAGG - Intergenic
1140625598 16:76790262-76790284 GCATTGGAGAAGAGGGAAGGCGG - Intergenic
1140770536 16:78199791-78199813 GATTCTGACAAGAGAGAAGAGGG - Intronic
1140895034 16:79317297-79317319 GAATGAGAGATGAAGGAAGGAGG - Intergenic
1140921579 16:79543351-79543373 GTATGAGATAAGTGGGAAGGAGG - Intergenic
1141137419 16:81475152-81475174 GAAAGAGACAGGAGGGAGGGAGG - Intronic
1141331748 16:83117362-83117384 GAATGGGCCAAGGGGGCAGGAGG - Intronic
1141563064 16:84883139-84883161 GAAGGAGGGAAGAGGGAAGGAGG + Intronic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1142842931 17:2648144-2648166 GAATGAGAGACGAGTGAAGGGGG + Intronic
1142887885 17:2924544-2924566 GGAGGGGAAAAGAGGGAAGGAGG + Intronic
1143241377 17:5445743-5445765 AAAGGTGAGAAAAGGGAAGGAGG + Intronic
1143479435 17:7220051-7220073 GTGTGTGACAAGAGGGACGGTGG + Intronic
1145994352 17:29096968-29096990 GAAGGTGAGGAGAGGGAAGTGGG + Intronic
1146646929 17:34581960-34581982 AAATCAGACCAGAGGGAAGGAGG + Intronic
1147132143 17:38415777-38415799 GAAGGAGATGAGAGGGAAGGAGG - Intergenic
1147657607 17:42099454-42099476 GAATGTAGCAGGAGGGAAGGAGG + Intergenic
1148617227 17:49010210-49010232 GGAAATGACCAGAGGGAAGGAGG - Intronic
1148739934 17:49887131-49887153 GAATGTGACTAGACTGAATGTGG - Intergenic
1148775287 17:50091802-50091824 GAAAGTGAGGAGAGGGAAAGGGG - Intergenic
1148904873 17:50905567-50905589 GCAGGTGGCAACAGGGAAGGGGG - Intergenic
1148962052 17:51401633-51401655 GAAGCGGACAAGAAGGAAGGGGG - Intergenic
1149680570 17:58504268-58504290 GCCTGTGACAACAGGGATGGGGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1152218471 17:79048100-79048122 GAAGGTGGCGAGAGGAAAGGAGG - Exonic
1152541896 17:80981025-80981047 GAATGAGTGAAGAGGGAGGGAGG + Intergenic
1153699048 18:7674105-7674127 GAATGTGAGGAAAGAGAAGGGGG + Intronic
1153885933 18:9466097-9466119 GAATATTACAAGAGAGAAAGAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155995849 18:32330825-32330847 GAAGGTGAGAAAAGGGAAGGAGG + Intronic
1156098129 18:33561283-33561305 GAATGTGACAAGAGACAAACTGG + Intergenic
1156461062 18:37321612-37321634 GAGAGAGACAGGAGGGAAGGGGG - Intronic
1156588907 18:38463724-38463746 GAATGTGAGAACATGGACGGTGG - Intergenic
1157079110 18:44502549-44502571 GAATTTGCTAAGAGGGAAGAAGG - Intergenic
1157668608 18:49509780-49509802 GAATTTTACAAGAGGAAAGATGG - Intergenic
1159602417 18:70441279-70441301 AAATGTGAGAAGAGAGAAGTGGG - Intergenic
1160119052 18:76110972-76110994 GAACTAGACAAGAGGGAAGAAGG + Intergenic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1161403852 19:4081070-4081092 GAAAGGGAAAAGAGGGGAGGAGG + Intergenic
1161482579 19:4518278-4518300 GAACGTGAGAAGCTGGAAGGGGG + Intergenic
1163144748 19:15372960-15372982 GACTGGGAGAAGAGGGACGGAGG + Exonic
1164725853 19:30465168-30465190 GAATGAGAATAGAGGCAAGGTGG - Intronic
1166296614 19:41893109-41893131 GACTGTCATAAGAGGGAGGGAGG - Intronic
1167636969 19:50660919-50660941 AAAAGGGGCAAGAGGGAAGGCGG + Intronic
1167637391 19:50662686-50662708 GAATGTGACAAGGGGGCAGTGGG + Intronic
925214334 2:2081367-2081389 GCATTTGCCAAGAGGGAAGTAGG - Intronic
925293740 2:2764637-2764659 GAATCTGGAAGGAGGGAAGGAGG + Intergenic
925865936 2:8225783-8225805 AGATGCGACAAGAGGAAAGGAGG - Intergenic
927116209 2:19904594-19904616 GAATGAGAGAACAGTGAAGGGGG + Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
928213345 2:29340341-29340363 GAATGAGAGCAAAGGGAAGGAGG + Intronic
929287269 2:40149605-40149627 AAGTGTGACAAGATGGAAAGAGG + Intronic
929560195 2:42951818-42951840 GGATGTGAGAACAGGGCAGGGGG - Intergenic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
930148394 2:48031760-48031782 GGATGGGGCAGGAGGGAAGGGGG - Intergenic
931226051 2:60333234-60333256 GAATGTGACAAGAGAGGGAGAGG + Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932861641 2:75298966-75298988 GCATGGGACAAGAGGGAGGAGGG + Intergenic
933292767 2:80455791-80455813 GAATGTCAGATGAGGGGAGGAGG + Intronic
933649534 2:84839206-84839228 GAATGAGAGAATAGGGAAGCGGG - Exonic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
934638868 2:96014084-96014106 GAATGGGAGAAAAGGAAAGGTGG - Intergenic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935106889 2:100052992-100053014 AAATGTGACAAGAGGGGAAGTGG + Intronic
935765104 2:106359161-106359183 GAATGCGACAGAAGAGAAGGTGG - Intergenic
936231889 2:110709858-110709880 AATTGTTACAAGAGGCAAGGAGG - Intergenic
936569071 2:113600319-113600341 GAAGGGGAGAAGAGGAAAGGGGG - Intergenic
936674751 2:114702123-114702145 GTAAGTTACATGAGGGAAGGTGG + Intronic
937593729 2:123647380-123647402 TAATGTGACAACAAGGAAAGGGG + Intergenic
937936145 2:127247141-127247163 GACTGTGAGAAGTGGGGAGGCGG - Intergenic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
939896082 2:147792775-147792797 AAAGGAGACAAGAGAGAAGGGGG + Intergenic
940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG + Intergenic
941040026 2:160610972-160610994 GACTTTGGCAAGATGGAAGGTGG + Intergenic
941663097 2:168215730-168215752 TAATCAGACAAGAGGAAAGGGGG + Intronic
941933035 2:170961434-170961456 GCCTGTGACAAGAGGGCAAGAGG - Intronic
942511327 2:176705453-176705475 GAATGAGACCAGAGAGATGGTGG + Intergenic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
943731994 2:191311840-191311862 GAATGTGGGTATAGGGAAGGAGG + Intronic
944528077 2:200640578-200640600 GAAAGCGACAAGTTGGAAGGAGG + Intronic
944887090 2:204074176-204074198 GAATGTGCAATGAGGAAAGGAGG - Intergenic
945044532 2:205770483-205770505 GAATGGGAAAGGAGAGAAGGGGG - Intronic
947318790 2:228894590-228894612 GAATGTAACAAGAGAGAAAATGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948123141 2:235545709-235545731 GCAGGTGACAGGAGGGAAAGAGG - Intronic
948534317 2:238634837-238634859 GGATGTGACTAGAGGGAGGAGGG + Intergenic
948629907 2:239295418-239295440 GAATGAGACAAGATGGGAGCCGG + Intronic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
948870131 2:240793544-240793566 GAATGTGAGGAGAGAGGAGGAGG + Intronic
948944317 2:241211720-241211742 GAAGGTTACAGGAGGGAAAGAGG - Intronic
948959917 2:241326507-241326529 TAATTTGAGAAGAGGCAAGGTGG - Intronic
948959939 2:241326656-241326678 TAATTTGAGAAGAGGCAAGGTGG - Intronic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1168970878 20:1929984-1930006 GACTGTGGGAGGAGGGAAGGGGG - Intronic
1169650338 20:7859609-7859631 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650342 20:7859631-7859653 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650346 20:7859653-7859675 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650350 20:7859675-7859697 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169710005 20:8550457-8550479 GAATGAGAGCCGAGGGAAGGGGG - Intronic
1170012214 20:11736464-11736486 GAATGTGGACAGAGGGAATGTGG + Intergenic
1170100659 20:12695975-12695997 GTGTGTGGCAAGAGGGAGGGAGG - Intergenic
1171070483 20:22063283-22063305 GAAGGTGAAAAAAGTGAAGGTGG - Intergenic
1171150022 20:22819675-22819697 GTATGTGATAAGAGGGAATTTGG + Intergenic
1172156664 20:32830643-32830665 CAATATAACAAAAGGGAAGGTGG - Intronic
1172518471 20:35552254-35552276 GAATGAGGAGAGAGGGAAGGAGG + Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1173856960 20:46256503-46256525 GCATGTGTCTAGTGGGAAGGAGG + Intronic
1174758381 20:53182214-53182236 GAGGGAGTCAAGAGGGAAGGAGG - Intronic
1175052486 20:56168136-56168158 GAATAAGACAAAAAGGAAGGAGG - Intergenic
1175144596 20:56886097-56886119 GAGGGTGATAAGGGGGAAGGAGG + Intergenic
1175599083 20:60258069-60258091 GAACCAGACAAGTGGGAAGGTGG + Intergenic
1175694113 20:61088456-61088478 GAAAGTGGCAGGAGGGAAGCAGG + Intergenic
1176027346 20:62992858-62992880 GAAGGGGCCAAGAGGGATGGAGG + Intergenic
1176384015 21:6127994-6128016 GAAGGAGAGAGGAGGGAAGGAGG + Intergenic
1177688019 21:24465483-24465505 GAGTGTGTGAAGAGCGAAGGGGG - Intergenic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179739459 21:43410244-43410266 GAAGGAGAGAGGAGGGAAGGAGG - Intergenic
1179805271 21:43833203-43833225 GTATGAGTCAAGTGGGAAGGTGG - Intergenic
1180092743 21:45541451-45541473 GAATGCATCCAGAGGGAAGGTGG - Intronic
1180463993 22:15594373-15594395 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1181566309 22:23740799-23740821 GAATTTGAACAGAGGGAATGAGG + Intergenic
1181661565 22:24354053-24354075 GAATGTCACATGAAGAAAGGGGG + Intronic
1182762547 22:32734407-32734429 GCATGTGACCCGAGGGATGGGGG + Intronic
1183848440 22:40562668-40562690 GAAAGGGGGAAGAGGGAAGGGGG + Intronic
1184083758 22:42245370-42245392 GAATGAGACAGGAGTAAAGGAGG - Intronic
1184495170 22:44836845-44836867 GAAAGAAACAGGAGGGAAGGGGG - Intronic
1184755170 22:46511766-46511788 GAGGGTGAGATGAGGGAAGGAGG + Intronic
1184807703 22:46806149-46806171 AAATGTGATAAGAGGGTTGGAGG - Intronic
1184933863 22:47704286-47704308 GAATGTGAAAAGCCGGCAGGGGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
952522763 3:34178727-34178749 GAATGTGACAAGATGTAAGTGGG + Intergenic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
954010179 3:47629566-47629588 GAATGTCACAAGTAGCAAGGAGG - Intronic
954495909 3:50961620-50961642 GGAAGTGACAAGGGAGAAGGTGG + Intronic
955158915 3:56445667-56445689 GAGAGTGGCAAGAGGGGAGGCGG - Intronic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957845559 3:85729612-85729634 AAATGCCACAAGAAGGAAGGAGG + Intronic
958858479 3:99416454-99416476 GAATGGGGTAAGAGGGAAGTGGG + Intergenic
958916294 3:100054230-100054252 GAACATATCAAGAGGGAAGGGGG - Intronic
959406834 3:105971085-105971107 GAATGAGAGCAGAGTGAAGGGGG + Intergenic
959445722 3:106436209-106436231 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
960519451 3:118638244-118638266 GACTGTGACAAGGAGCAAGGTGG + Intergenic
960995333 3:123336614-123336636 GGAGGTGAGAAGAGGGAGGGTGG + Intronic
961919465 3:130410768-130410790 GAATGTCACAAGTGGGCAGTGGG - Intronic
962891512 3:139677053-139677075 GAATGTGGCTTGAGGAAAGGAGG - Intronic
964592484 3:158379838-158379860 AAATGGGACAAGAGGGAGGGAGG - Intronic
965267152 3:166558911-166558933 GAATGGGAAAAGAAGGAAGCAGG - Intergenic
965491965 3:169348876-169348898 AAATATGACATGAGGGCAGGGGG - Intronic
966124222 3:176556697-176556719 GAATAGGGCAAGAGGCAAGGAGG - Intergenic
966585150 3:181615340-181615362 AAATGAGAGAAGAGGGAAAGGGG + Intergenic
966638973 3:182168266-182168288 GCATGGGAAAAGGGGGAAGGAGG - Intergenic
967436608 3:189454980-189455002 AGAGGTGAAAAGAGGGAAGGAGG + Intergenic
967596788 3:191334695-191334717 GAAGGGGAAGAGAGGGAAGGAGG - Intronic
968328960 3:197847422-197847444 GATAGTGACAGGAGGGAAGATGG - Exonic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
968978661 4:3835056-3835078 GAGAGAGAGAAGAGGGAAGGAGG + Intergenic
969971921 4:11056667-11056689 AAATGTGACAAGAATGAAGAAGG + Intergenic
970099661 4:12505616-12505638 GAGTGAGAAAAGAGTGAAGGAGG - Intergenic
970242447 4:14023451-14023473 GAAGGTGACAGTGGGGAAGGTGG + Intergenic
970367219 4:15371987-15372009 GAATGTGTCATGAGGGGAGCAGG + Intronic
971897290 4:32614281-32614303 GAAACTGATAAGAGGGAGGGAGG - Intergenic
973156240 4:46956797-46956819 GAATCTGACAATAGGAAATGTGG - Intronic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
975698991 4:77043635-77043657 GTATTTGGAAAGAGGGAAGGAGG - Intergenic
976117119 4:81739623-81739645 GAAGGTGGGAAGAGGGAATGAGG + Intronic
977348209 4:95845130-95845152 GAATGGGAGCAGAGTGAAGGGGG + Intergenic
977397010 4:96484006-96484028 GTCTGTGGAAAGAGGGAAGGAGG - Intergenic
977694204 4:99949205-99949227 GGAGGCGGCAAGAGGGAAGGAGG - Intronic
977758986 4:100708059-100708081 AAAAGTGGCTAGAGGGAAGGAGG + Intronic
978018054 4:103772949-103772971 GAAGGAGAAAAGAGAGAAGGGGG - Intergenic
981074597 4:140578615-140578637 GAATGAGACAAAGGGAAAGGGGG - Intergenic
982933397 4:161437762-161437784 GAATGTGAGAAGTGAGATGGTGG + Intronic
983119104 4:163858473-163858495 AAATTTGAGAATAGGGAAGGTGG - Intronic
984509913 4:180666969-180666991 AAATGTGACAAGTGAGAGGGTGG - Intergenic
985652202 5:1112360-1112382 GAAGGGGACAAGAGGGGAGGCGG - Intergenic
986174479 5:5340448-5340470 GCATGTGGCAAGAGCGTAGGAGG - Intergenic
986313352 5:6571071-6571093 GAAAGAGGGAAGAGGGAAGGAGG + Intergenic
986660757 5:10057722-10057744 GTATGTGAAAAGAGGGTAGAGGG - Intergenic
987025581 5:13923661-13923683 GGCAGTGAAAAGAGGGAAGGAGG + Intronic
987370288 5:17186761-17186783 AAATGTGAAAAGGGGGAAGCCGG - Intronic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
987909088 5:24118183-24118205 GAATGGGGAAAGAGGAAAGGTGG - Intronic
988517715 5:31919004-31919026 GAAAGTGACAAAGGGGAAAGTGG - Intronic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
990353848 5:54945919-54945941 GAATGTGACAAGAGCCTAAGAGG + Intergenic
990407280 5:55503923-55503945 GAATGGGAGAGGAGGGAGGGAGG + Intronic
991089375 5:62679215-62679237 AAAAGGGAAAAGAGGGAAGGGGG + Intergenic
991630032 5:68647377-68647399 TAGTGTGACAAGAGGAAAAGAGG - Intergenic
992058840 5:73021321-73021343 GATGGCGACAGGAGGGAAGGAGG + Intronic
992297092 5:75336709-75336731 GAATATAAAAAAAGGGAAGGTGG - Intronic
992301258 5:75383091-75383113 GAATGGGAGGAGAGGGAATGGGG + Intronic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
994692298 5:103034111-103034133 GAAGGAGAGAAGAGAGAAGGAGG - Intergenic
997091206 5:130860851-130860873 AAAGGAGACAAGAGGGAGGGAGG - Intergenic
998049094 5:139016481-139016503 GAAAATGAAAAGAGAGAAGGAGG + Intronic
999089305 5:148921359-148921381 GAATGTGGAAGGAGAGAAGGAGG + Intergenic
999590493 5:153139788-153139810 GAATGTGAGATGGGGAAAGGAGG - Intergenic
999631885 5:153579991-153580013 GTATGTGACATGAGGGAAGAGGG - Intronic
999636601 5:153629400-153629422 GAAAGTGAGAAGAAGGCAGGTGG + Intronic
999702693 5:154242602-154242624 GAGAGTGACAGGAGGGAAGCAGG - Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000809008 5:165837584-165837606 GTATGTGAGAAGAGGGAGAGAGG + Intergenic
1001076014 5:168628693-168628715 GGAAGAGAAAAGAGGGAAGGAGG - Intergenic
1001078422 5:168647673-168647695 GAATGAGAATAGAGCGAAGGAGG + Intergenic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1001293611 5:170483881-170483903 GAATGTGACAAAGGAGAAGTAGG + Intronic
1001942642 5:175751450-175751472 GAATGTAACCAGAGGGAGAGTGG + Intergenic
1002669530 5:180855489-180855511 GAATGTCTCAAGGTGGAAGGAGG - Intronic
1002826872 6:781959-781981 TATTGTGACAAGAGGCAAAGGGG - Intergenic
1002958971 6:1896539-1896561 GAATCTGACAGCGGGGAAGGGGG + Intronic
1003190481 6:3870187-3870209 GATTGTGCAAAGACGGAAGGGGG - Intergenic
1003342970 6:5239647-5239669 GAAAGTGACAAGAAGGAAGGTGG + Intronic
1003591546 6:7441128-7441150 GGAGGTGCCAAGAGCGAAGGGGG - Intergenic
1003799820 6:9651132-9651154 GAATGTGACGAAAGAGAGGGAGG - Intronic
1003876384 6:10441337-10441359 GAATGTGATCACAGGGGAGGGGG + Intergenic
1004139266 6:13000586-13000608 GAAAGAGAAGAGAGGGAAGGAGG + Intronic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1005233856 6:23736805-23736827 GACTGCGCCAAGAGGGAAGGAGG - Intergenic
1005695801 6:28351632-28351654 GAGGGAGACAAAAGGGAAGGAGG - Intronic
1005897274 6:30189010-30189032 GAAAGTGCAAAGAGGGAGGGGGG + Intronic
1006236859 6:32641278-32641300 GAAGATGACAAGCAGGAAGGCGG - Intronic
1006246868 6:32745127-32745149 GAAGGTGACAAGCAGGAGGGTGG - Intronic
1006823379 6:36916089-36916111 GAAGGGGAGAAGAGAGAAGGAGG - Intronic
1008319016 6:50083791-50083813 GAATGTGACAAGACGTGTGGTGG - Intergenic
1009918920 6:70031819-70031841 GAATGTGATAAAAGTGAAAGAGG - Intronic
1011970206 6:93212802-93212824 GAATTTGAGAAAAGGGCAGGAGG + Intergenic
1012305903 6:97656823-97656845 CTATGTAACAGGAGGGAAGGAGG + Intergenic
1013270556 6:108542010-108542032 GAAAGGGAAAAGAGAGAAGGAGG - Intergenic
1013308564 6:108872469-108872491 GGATGAGGCAAGAGGGATGGAGG - Intronic
1013958447 6:115868335-115868357 TATTGTTACAAGAGGGACGGAGG + Intergenic
1014747247 6:125214406-125214428 GATTGTGGGAAGAGGAAAGGAGG - Intronic
1015548332 6:134385616-134385638 GAAAGTAACATGAGGGAAGGTGG - Intergenic
1015661108 6:135574307-135574329 GAATCTGAGAAGAGGAAAGCTGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016775720 6:147902816-147902838 GAATGTGATAAGAGGGCTGCAGG - Intergenic
1016908623 6:149175714-149175736 AAATGTGACAACAGAGCAGGAGG - Intergenic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018635327 6:165855037-165855059 GAATGAATGAAGAGGGAAGGAGG + Intronic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1019256412 7:55241-55263 TAATGTGACTGGAGGGAAAGTGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1020586858 7:10079544-10079566 GAAGGAGAGAAGAGAGAAGGAGG + Intergenic
1021649863 7:22822634-22822656 GAAAGTGACTGGAGGGAAGAGGG - Intronic
1021887131 7:25150198-25150220 GAATGTGACATGAGGAAAACAGG + Intronic
1022953955 7:35364392-35364414 GAAGGTGAAAGGAGGGAATGTGG - Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023542654 7:41282896-41282918 GAATATCTCAAGAGGGAACGGGG + Intergenic
1023547053 7:41329167-41329189 GAAAGCAAGAAGAGGGAAGGAGG + Intergenic
1024951058 7:54860753-54860775 GGGTGTGACAAGAGTGAATGTGG + Intergenic
1026206235 7:68260282-68260304 GAAAGAGACAAAAGAGAAGGAGG - Intergenic
1026651167 7:72217062-72217084 GAATGTGACAAGATGTTAAGAGG + Intronic
1027893532 7:84009751-84009773 GGATGAGGAAAGAGGGAAGGAGG + Intronic
1028018047 7:85739477-85739499 GAAGGAGAAGAGAGGGAAGGGGG + Intergenic
1028098662 7:86793561-86793583 GAAGCTGACCAGAGAGAAGGGGG - Intronic
1028538200 7:91912928-91912950 GAAAGTGATAACAGAGAAGGTGG - Intergenic
1029799840 7:102934876-102934898 GACAATGACAGGAGGGAAGGAGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032539208 7:132689424-132689446 GAATGGGATGAGAGGAAAGGGGG - Intronic
1032566534 7:132952833-132952855 AATTATGACAACAGGGAAGGTGG + Intronic
1032856947 7:135842759-135842781 GAATTGGCCAAGAGGGAAGGAGG + Intergenic
1033394541 7:140961345-140961367 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1033921487 7:146398366-146398388 GAATGAGAGCAGAGCGAAGGGGG + Intronic
1034083702 7:148304035-148304057 GAATGTATCTAGAGGGAGGGAGG - Intronic
1034182775 7:149151101-149151123 GAATGGGACAAGCGGCATGGAGG + Intronic
1034337381 7:150332254-150332276 GGATGGGAGAAGAAGGAAGGGGG + Exonic
1035308657 7:157951421-157951443 GAAGGTGCCAATAGGGAAGATGG - Intronic
1035391089 7:158505646-158505668 GACAGTGAGAAGAGGGAATGGGG + Intronic
1035443264 7:158921590-158921612 GATTGTGACGAGGTGGAAGGAGG + Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1036480403 8:9134135-9134157 GGAGGTGACAAGAAGGAATGAGG + Intergenic
1036684528 8:10900429-10900451 TCATGTGACATGATGGAAGGAGG - Intronic
1037042588 8:14255300-14255322 GAATGTGACAAGATCATAGGAGG - Intronic
1037643386 8:20769175-20769197 GAAGGTGAGAAGAGAGAAAGAGG + Intergenic
1037785191 8:21898756-21898778 GACTTTGCCAAGAGGGAATGAGG - Intergenic
1038075596 8:24069817-24069839 GAATGTGACAAGTTGGGAGATGG + Intergenic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1039350511 8:36759026-36759048 GAAGGGGACAAGAGTGCAGGTGG - Intergenic
1039591374 8:38752693-38752715 GAATGAAAAGAGAGGGAAGGAGG - Intronic
1040445970 8:47493996-47494018 GAAGGAGAAAAGAAGGAAGGAGG - Intronic
1041939107 8:63367180-63367202 GAAGAAGACAAGAGGGCAGGTGG + Intergenic
1043037744 8:75218976-75218998 GAAGGAGAGAAGGGGGAAGGAGG + Intergenic
1043144399 8:76634231-76634253 GAATGAGAGCAGAGTGAAGGTGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1043638342 8:82414830-82414852 TAATGTGAGTAGAGGGAGGGAGG - Intergenic
1044132877 8:88548346-88548368 GAAAGTGACAAAAGTGAAGATGG - Intergenic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1046106270 8:109670848-109670870 TAAAGAAACAAGAGGGAAGGAGG + Intronic
1046287720 8:112116507-112116529 GACTCTGAAAAGAGGGAAGCAGG + Intergenic
1049393663 8:142385552-142385574 GAATACGACAAGAGGGAGTGAGG + Intronic
1049883459 9:13210-13232 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1053273325 9:36765218-36765240 GAATGAGACAAGAGGAAGGGAGG + Intergenic
1054963592 9:70997157-70997179 AAATGTGACAAGGGGGTAGGAGG - Intronic
1054967557 9:71046621-71046643 ATAAGTGACAATAGGGAAGGAGG - Intronic
1055015591 9:71614447-71614469 GAATGTGAGGAAAGGGCAGGTGG + Intergenic
1055120323 9:72652535-72652557 GACAGTTACCAGAGGGAAGGTGG + Intronic
1055776717 9:79774355-79774377 GAATGAGGCATAAGGGAAGGAGG + Intergenic
1056443519 9:86642975-86642997 GAATGTGGTAAGAGGCAAAGGGG - Intergenic
1056588339 9:87944107-87944129 GAGTGTGCCAACAGGGCAGGTGG + Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1058645396 9:107127279-107127301 GACAGTGACAAGAAGGAGGGAGG + Intergenic
1058672693 9:107373871-107373893 GAAGGTGACAGGAGGTGAGGAGG + Intergenic
1059344083 9:113616484-113616506 GAATGAGACAAGATGACAGGAGG - Intergenic
1060001322 9:119961629-119961651 GAATATGACAGCTGGGAAGGGGG + Intergenic
1060446131 9:123690002-123690024 GAAAGGGAAAGGAGGGAAGGAGG + Intronic
1060909716 9:127339937-127339959 GCAGGTGACAGGATGGAAGGTGG - Intronic
1061783769 9:133011389-133011411 GAAAGTGAAAAGATGGAAGATGG + Intergenic
1062050513 9:134444418-134444440 GAAGGAGAAAGGAGGGAAGGAGG - Intergenic
1062356498 9:136166829-136166851 GAAGGAGAGAAGAGAGAAGGAGG - Intergenic
1062537530 9:137027541-137027563 GGATGTGCCAGGAGGGGAGGCGG + Exonic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1186077582 X:5897906-5897928 GAGAGAGAAAAGAGGGAAGGGGG - Intronic
1186519625 X:10193927-10193949 GATGGTGACTAGAGGGAAAGTGG + Intronic
1188606898 X:32042406-32042428 GAATGAGTGAGGAGGGAAGGGGG + Intronic
1188987976 X:36784949-36784971 GAATGTGAGAAAAGGCAAAGAGG + Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189594245 X:42547601-42547623 GAATGGAGCAAGAGAGAAGGAGG + Intergenic
1189614161 X:42767060-42767082 GGATGTGCCAAAAGGCAAGGGGG - Intergenic
1189861159 X:45273841-45273863 GGATGAGACAGGAGGGCAGGAGG + Intergenic
1190107414 X:47570214-47570236 GGATGTGAGAAGAGGGAAGTTGG - Intronic
1193086582 X:77452408-77452430 GATTGAGACAAGACGGTAGGAGG - Intronic
1194727564 X:97416184-97416206 TGATGTAACAAGATGGAAGGGGG - Intronic
1195747671 X:108135123-108135145 GAGAGTGACAACAGGTAAGGTGG - Intronic
1195878171 X:109563997-109564019 GAAGATGACAAAAAGGAAGGAGG - Intergenic
1196540938 X:116907191-116907213 AACTGTGACAAGAGGCAAAGAGG - Intergenic
1200120712 X:153789030-153789052 GACTGTCTCAGGAGGGAAGGAGG + Intronic
1200402357 X:156026939-156026961 GAAGGGGAGAAGAGGAAAGGGGG - Intergenic