ID: 1108420610

View in Genome Browser
Species Human (GRCh38)
Location 13:50245311-50245333
Sequence ATGAAGAAGCAGAATTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 602}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108420610_1108420611 -7 Left 1108420610 13:50245311-50245333 CCTCTCTAATTCTGCTTCTTCAT 0: 1
1: 1
2: 5
3: 76
4: 602
Right 1108420611 13:50245327-50245349 TCTTCATCCATCAAATATAGAGG 0: 1
1: 0
2: 0
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108420610 Original CRISPR ATGAAGAAGCAGAATTAGAG AGG (reversed) Intronic
902138655 1:14333475-14333497 ATGATGAATGAGAAGTAGAGTGG - Intergenic
902608018 1:17580055-17580077 AGGAAGAGGCAGAGTCAGAGTGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
903761082 1:25699326-25699348 AAGAAGAAGAAGCATGAGAGAGG + Intronic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904875273 1:33650016-33650038 GTCAAGAAGCTGAATTACAGGGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905334815 1:37237339-37237361 ATGAGGAATCAGAATGAGCGTGG + Intergenic
905722258 1:40215146-40215168 ATGAAATAGCAGAATCAAAGAGG + Intronic
906006291 1:42474730-42474752 GTGAAGAAGCAGGCTTAGAGAGG - Intronic
906141233 1:43534875-43534897 ATGAGGAAGCGGATTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
906643829 1:47458580-47458602 ATAAGGAAGGAGAATGAGAGGGG - Intergenic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
908001702 1:59686798-59686820 ATGAGTAAGCAGGCTTAGAGAGG - Intronic
908332853 1:63087808-63087830 GAGAAGAAGCAACATTAGAGGGG - Intergenic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
909606923 1:77517082-77517104 AAGAAGAAGAAGAAATAGCGGGG + Intronic
910453217 1:87368220-87368242 ATGAAGAAGTAGGGTCAGAGAGG + Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910570846 1:88700669-88700691 ATGAAGAACCAAAAATACAGGGG - Intronic
911394076 1:97284668-97284690 ATGAAGTAGCAGGATGGGAGTGG - Intronic
911402299 1:97391326-97391348 ATAAATAAGCAAATTTAGAGTGG - Intronic
912032855 1:105271774-105271796 AAGCAGAAGCAGAGTTTGAGAGG + Intergenic
912269837 1:108198025-108198047 GTGAAGAAGCAAAATCCGAGGGG - Intronic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
913679537 1:121175871-121175893 AAGTAGTAGCAGAATTTGAGAGG + Intronic
914158076 1:145104446-145104468 AAGTAGTAGCAGAATTTGAGAGG - Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
916366983 1:164040456-164040478 ACAAAGAAGCTGAATTGGAGTGG + Intergenic
916444527 1:164859931-164859953 AGGAAGAAATAGAATTAGACTGG + Intronic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919046282 1:192456630-192456652 AGGAAGAAGATGAATAAGAGAGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920466843 1:206194416-206194438 AAGTAGTAGCAGAATTTGAGAGG + Intronic
920893233 1:210014755-210014777 ATCAAAAAGCAGAACTGGAGTGG - Intronic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923289186 1:232527702-232527724 AAGAAGAAGAAGAATTAAATGGG - Intronic
923545794 1:234922567-234922589 TTGAAAAAGCAGAACTAAAGTGG + Intergenic
923685239 1:236148922-236148944 GTGAAGCAGCAGCCTTAGAGAGG - Intronic
923735558 1:236603720-236603742 ATGAAGAAACAAAATTAGAGAGG - Intronic
923791443 1:237114796-237114818 ATTAAGCAGCAGGATCAGAGAGG - Intronic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
1062995798 10:1865441-1865463 AAGAAGCAGCAGAGATAGAGAGG + Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1066546012 10:36501491-36501513 ATGAAGAAGCAGATATATAAGGG - Intergenic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067922493 10:50474360-50474382 GTGAAGAACCAGAATTCCAGAGG - Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068092959 10:52455281-52455303 AGCAAGAAGCAGAGTGAGAGAGG - Intergenic
1068700228 10:60011798-60011820 ATGCAGTGGCAGCATTAGAGAGG - Intergenic
1068894411 10:62183568-62183590 ATGAAGCAGATGAATTAGAGAGG - Intronic
1068923468 10:62510762-62510784 AAGAAGAAACAGACCTAGAGAGG + Intronic
1069513202 10:69057323-69057345 AGGAAGAGGCAAAGTTAGAGAGG + Intergenic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070383255 10:75900712-75900734 ATCAAGATTCAGAATTGGAGTGG - Intronic
1070830910 10:79417641-79417663 ATGAAGAAAGAGAAGAAGAGTGG + Intronic
1071054132 10:81489357-81489379 AAGGAGCAGCAGAATTTGAGGGG + Intergenic
1071450842 10:85790469-85790491 ATGATGAAGGAGATTCAGAGTGG + Intronic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1071836508 10:89423655-89423677 ATGTACAAGCAGAAAGAGAGGGG - Intergenic
1072028567 10:91492144-91492166 ATCAGGAAACAGAATTAGAGAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1073103931 10:101021629-101021651 AAGAAGAAACAGGTTTAGAGAGG - Intronic
1073264520 10:102217270-102217292 AAGAAGAACCAGCATTAAAGAGG + Intergenic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1073668917 10:105565228-105565250 AGAAAGAACCAGAATGAGAGAGG - Intergenic
1073865397 10:107797893-107797915 TTGAAGGAGCTAAATTAGAGTGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074744487 10:116517997-116518019 ATGCAGCAGCAGAGTTTGAGAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078585500 11:12583518-12583540 TTGAAGAAGAAGAAATGGAGAGG + Intergenic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079307833 11:19339491-19339513 AGGAAGAAACAGCATCAGAGAGG - Intergenic
1079561805 11:21830382-21830404 ATGAACAAATTGAATTAGAGTGG - Intergenic
1079706450 11:23626551-23626573 ATGAAGAAGAACATCTAGAGGGG + Intergenic
1079893093 11:26082720-26082742 ATGATGATGCAAAATTACAGTGG + Intergenic
1080259785 11:30335369-30335391 AAGCAGAGGCAGAATTTGAGAGG + Intronic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1081086470 11:38808208-38808230 ATAAAGCAGCAGAATTTGAGAGG + Intergenic
1081583185 11:44366316-44366338 TTGAAGAAACAGACGTAGAGAGG - Intergenic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1082888664 11:58114762-58114784 ATGAGGAAGCAGACCCAGAGGGG + Intronic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083582832 11:63836218-63836240 ATGAATTTGCAGATTTAGAGAGG + Intergenic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085366761 11:75954828-75954850 ATGAAGTAGCAGATTTCCAGAGG + Intronic
1085468228 11:76738662-76738684 AACAAGAAGCAGAAAGAGAGGGG + Intergenic
1085484899 11:76854658-76854680 ATGAAGATACAGAGATAGAGTGG + Intergenic
1085798256 11:79563628-79563650 ATGAAGAAACTGAAGCAGAGAGG + Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086004275 11:82017932-82017954 ATGAAGAAACAGAGATACAGAGG + Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087547985 11:99608706-99608728 ATGAAGGACCACAAATAGAGTGG - Intronic
1087572402 11:99945648-99945670 ATGAAGAAACAGAACTGAAGAGG + Intronic
1087641904 11:100764002-100764024 AAGAAGAAGAAGAAGAAGAGGGG - Intronic
1087784367 11:102338459-102338481 ATGAAGATCCAAAATTACAGGGG + Intronic
1088126425 11:106430359-106430381 ATAGATACGCAGAATTAGAGTGG + Intergenic
1088132102 11:106505706-106505728 AGGAAAAAGAAGAAATAGAGGGG - Intergenic
1088560070 11:111105707-111105729 CTGAAGAAGCAGATTCACAGGGG - Intergenic
1088565921 11:111173013-111173035 AAGAAGAAGGAGAAGTACAGTGG + Intergenic
1088584165 11:111345932-111345954 AAGAAGAAACAGACTTAAAGAGG - Intergenic
1089316868 11:117597749-117597771 ATGAAAAATCAGAATTAGCCAGG - Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1090140871 11:124259376-124259398 ATCAATTATCAGAATTAGAGAGG + Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1091316698 11:134618895-134618917 AGGAAGCAGCAGGATTAGGGAGG + Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091553338 12:1553548-1553570 ATGAAAAATAAGAATTAGACAGG + Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092131602 12:6117012-6117034 GAGAAGAGGAAGAATTAGAGGGG - Intronic
1092265856 12:6979927-6979949 ATGAAGGAGCAGATTCAAAGTGG - Intronic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093122483 12:15288998-15289020 ATGAACAAAAAGAAATAGAGTGG + Intronic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1093996362 12:25646975-25646997 AGTAAAAAGCAGAATTAAAGTGG + Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094469630 12:30791690-30791712 ATATAAAAACAGAATTAGAGAGG - Intergenic
1094486386 12:30928682-30928704 AAGAAGAAGCAGACCCAGAGAGG - Intronic
1094535510 12:31319208-31319230 ATGAGGAAACAGGATTAGTGAGG - Intronic
1094552852 12:31469356-31469378 AAGAAGAAGAAGAAATATAGAGG + Intronic
1094582574 12:31748075-31748097 ATGAGGAAACAGACTTGGAGAGG - Intergenic
1094775045 12:33716859-33716881 TTGAGGAACTAGAATTAGAGTGG - Intergenic
1095506573 12:42905172-42905194 AAGTTGAAGCAGAATTAAAGAGG + Intergenic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1096497228 12:52045603-52045625 ATGAGGAAGCAGTCTTGGAGAGG + Intronic
1096867285 12:54572156-54572178 ATGAAGAAGATGACCTAGAGAGG - Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097178099 12:57155004-57155026 ATGAAAAAGCAGGATCAAAGAGG + Intronic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097355584 12:58597322-58597344 AGGTAGAAGCAGATTTATAGAGG - Intronic
1097370649 12:58775793-58775815 ATGAACAAGAAGATTTTGAGGGG - Intronic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098121438 12:67244377-67244399 ATAAAGAAATGGAATTAGAGAGG + Intergenic
1098841590 12:75484391-75484413 GTGAATAAACAGACTTAGAGAGG + Intronic
1099594205 12:84637659-84637681 ATAAAGTAGCAGAAATGGAGAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100120085 12:91359471-91359493 AGGAAGAAGAAGGAATAGAGAGG + Intergenic
1100389774 12:94138325-94138347 ATGAAGAAACAGAAGTAAATCGG + Intergenic
1101656661 12:106727497-106727519 ATGAAATAGAAGAATTAGAAAGG + Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1102019687 12:109673658-109673680 ATGAAGAAGCAGAAATGTTGGGG - Intergenic
1102564187 12:113784026-113784048 ATGAGGAAGCAGATTCAGAGAGG - Intergenic
1102710207 12:114919309-114919331 ATGGGGAAGCAGATTCAGAGAGG - Intergenic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1103076224 12:117985005-117985027 AAGAAGTTGCAGAATTGGAGGGG + Intergenic
1103191912 12:119008840-119008862 AGGCAGAGGCAGGATTAGAGGGG - Intronic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1104299585 12:127552175-127552197 AGGAAGGAGCAGGATTAGTGTGG - Intergenic
1104991693 12:132627960-132627982 AAGCAGCAGCAGAATTTGAGAGG - Intronic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1106793024 13:33175509-33175531 CTGGAGAAACTGAATTAGAGAGG - Intronic
1107613197 13:42137436-42137458 ATGAAGAATCTGAAACAGAGAGG + Intronic
1107659213 13:42621999-42622021 ATGAGGGAGAAGAATTGGAGAGG - Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108516611 13:51209267-51209289 TTGGAGAGGCACAATTAGAGTGG + Intergenic
1109166365 13:59040144-59040166 ATGAGGAAGAAAAAGTAGAGTGG - Intergenic
1109566844 13:64129505-64129527 ATGAAGTATTAGAATTACAGTGG + Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110134915 13:72054785-72054807 TTGAAGATGGAGAATTGGAGAGG - Intergenic
1110188859 13:72706493-72706515 ATGAAGAGGCACAACTGGAGAGG - Intergenic
1110393240 13:75000563-75000585 ATGGAAAAACAGAATTTGAGAGG + Intergenic
1110447361 13:75601261-75601283 AAGCAGCAGCAGAATTTGAGAGG + Intronic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1112140687 13:96638408-96638430 ATGAAGAAACTGCAGTAGAGAGG - Intronic
1112173424 13:96996434-96996456 AGGAGGACACAGAATTAGAGTGG + Intergenic
1113019028 13:105861383-105861405 TTGAAAAGGCAGATTTAGAGAGG - Intergenic
1113213483 13:108010642-108010664 ATGAAGAAGCAGTAATACAAAGG - Intergenic
1114975247 14:28088516-28088538 AGGAAGAGGGAGAATTAGACAGG - Intergenic
1115577517 14:34725549-34725571 ATGATGGAGCAGAAAGAGAGAGG + Intergenic
1115846465 14:37541007-37541029 ATGCAGAAGCTGGAGTAGAGGGG - Intronic
1116417937 14:44700685-44700707 ATGAAAATGTAGAACTAGAGGGG + Intergenic
1116804121 14:49475013-49475035 AGGAAAAACCAGACTTAGAGTGG - Intergenic
1116896314 14:50318493-50318515 ATTAAGCAGGTGAATTAGAGTGG - Intronic
1117029038 14:51651220-51651242 CTGGAGAGGTAGAATTAGAGGGG + Intronic
1117243801 14:53862886-53862908 ATGAAGAAACTGAATTTCAGAGG + Intergenic
1118437458 14:65784719-65784741 AGGAAGCAGCAGGTTTAGAGTGG - Intergenic
1118584282 14:67337732-67337754 ATGAAGATGAAGCATTTGAGTGG - Intronic
1118605307 14:67498598-67498620 AGGAATGAGCAGAATTAGGGTGG + Intronic
1118757405 14:68854773-68854795 CTGCAGAAGCAGCATTACAGGGG + Intergenic
1119010056 14:70976247-70976269 ATGAGGAAACAGATTTACAGGGG + Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1120007795 14:79379774-79379796 AAGGAGAAGGAGAATTAGAGTGG - Intronic
1120071536 14:80108754-80108776 ATGAAGGAGAAGTATAAGAGTGG + Intergenic
1120430791 14:84411825-84411847 CAAAAGAAGTAGAATTAGAGTGG + Intergenic
1120888109 14:89467765-89467787 AGGAAGAAGAAGAATTAGCTGGG - Intronic
1121018518 14:90563718-90563740 ATGCAGCAGCAGGGTTAGAGAGG - Intronic
1121240626 14:92427500-92427522 AGGAAGGAGCAGATTGAGAGAGG + Intronic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1123791975 15:23730834-23730856 TTGTAGAAGCAGAATTTCAGAGG - Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1125063566 15:35454800-35454822 AGGAAAAAGAAGAAGTAGAGGGG - Exonic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1126378948 15:48026413-48026435 ATGAAGAAGCAAAATAAAAAAGG - Intergenic
1127177854 15:56381013-56381035 AAGAAGAGGCAGAAAGAGAGAGG - Intronic
1127235472 15:57046200-57046222 AGGAAGAAGCAGACTTAGATAGG + Intronic
1127736879 15:61849395-61849417 AGGAAGAAGTAGAGATAGAGAGG + Intergenic
1127873685 15:63093994-63094016 ATGAGGAAACAGACTTAAAGAGG - Intergenic
1127948714 15:63783111-63783133 ATGCAGTAGCAGAGTTAGAGAGG + Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1130380082 15:83364103-83364125 ATGAAGAAGCACAGTTAGCGAGG + Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1133873830 16:9714287-9714309 ATGAAGAAGAAAAAGCAGAGTGG - Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1135375744 16:21945671-21945693 AAGAAGAAGGAGAAATAAAGTGG + Intergenic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1136141088 16:28289109-28289131 AGGAAGAAACAGACCTAGAGAGG - Intergenic
1137722778 16:50637607-50637629 AGGAAGAAGAAGAAAGAGAGAGG + Exonic
1137764987 16:50971127-50971149 ATGAAGATGGAGGATGAGAGGGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138251674 16:55506493-55506515 ATGAAGAAACAGACTTAAAGAGG - Exonic
1138269882 16:55687949-55687971 ATGTAGAAACACAATGAGAGAGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138629974 16:58285745-58285767 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
1138989409 16:62373192-62373214 ATGAGGAAGCAGCATTTCAGAGG + Intergenic
1139093025 16:63671914-63671936 ATGAAGAAGCAAAAGGAAAGAGG - Intergenic
1139285799 16:65812781-65812803 AGGAAGAAGCAGAAGTAAACTGG + Intergenic
1139803784 16:69546386-69546408 AAGCAGCAGCAAAATTAGAGAGG + Intergenic
1140912163 16:79464095-79464117 AGGTAGAAGCAAAATAAGAGTGG - Intergenic
1141148397 16:81547746-81547768 AAGATGAAGAAGAATTGGAGAGG + Intronic
1141571401 16:84936023-84936045 AAGAAGAAGTAGAATTGGATTGG + Intergenic
1142591402 17:1007701-1007723 ATGAAGAAACCGAAGTACAGAGG + Intronic
1142607345 17:1089409-1089431 ATGAGGAAGCTGATTCAGAGCGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1146935523 17:36810390-36810412 AAGAAGAAGAAGAAGAAGAGGGG + Intergenic
1146960750 17:36974858-36974880 AAAAAAAAGGAGAATTAGAGTGG - Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147977228 17:44254858-44254880 ATGAGGAAAGAGAATCAGAGAGG + Intronic
1148271089 17:46262356-46262378 AAGAAGAAGAAGAAGAAGAGGGG - Intergenic
1148444591 17:47729803-47729825 ATGAAGACTCAAAATGAGAGAGG - Intergenic
1148705151 17:49623571-49623593 AAGATGAAGCAAACTTAGAGAGG - Intronic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149646372 17:58244526-58244548 GTGAAGAAGCAGAAGTGAAGGGG + Intronic
1150319712 17:64202380-64202402 GTGAAGGGGCAGAATTAGGGAGG - Intronic
1150325632 17:64254721-64254743 ATTAAGAAGCAGTATTTTAGTGG - Intronic
1150434221 17:65141470-65141492 ATGCAGAAGCAGAAATATTGAGG + Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1153706076 18:7747331-7747353 ATGAAGAGGCAGAAAAGGAGAGG + Intronic
1153849162 18:9077247-9077269 ATGAAGATGCAGAACAGGAGGGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1156413796 18:36865774-36865796 ATGAAGAGTCAGAACCAGAGAGG - Intronic
1157123723 18:44935906-44935928 ATGAAGGGGCAAAATTAGTGTGG - Intronic
1157136227 18:45058537-45058559 ATGAAGAAACAGAGATGGAGGGG + Intronic
1157269463 18:46260406-46260428 TTGAAGTAGGAGAAATAGAGAGG + Intronic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1157484580 18:48077927-48077949 ATGTCTATGCAGAATTAGAGGGG + Intronic
1157571277 18:48713923-48713945 ATCTAGAAGAGGAATTAGAGCGG - Intronic
1158735161 18:60071126-60071148 ATGAAGAGGAAGAATTAATGTGG - Intergenic
1159926659 18:74275840-74275862 ATGAAGAAGCTGAAAAGGAGAGG + Intronic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161772074 19:6236349-6236371 ATGAAGATGCTGAATCAGACAGG + Intronic
1162425802 19:10594690-10594712 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1165131026 19:33632097-33632119 AAGAAAAAGCAGAACTTGAGGGG - Intronic
1165776701 19:38408865-38408887 AAGAAGAAGAAGAAGTAAAGGGG + Exonic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168719629 19:58547859-58547881 ATGAAGGAGCTGAATAAGCGGGG + Exonic
925436047 2:3838238-3838260 ATGAGGTAGGAGAATTGGAGCGG + Intronic
925767573 2:7251434-7251456 GAGAAGAAGCAGAATAAAAGGGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926587358 2:14701868-14701890 ATGAGGAATCAGATTTGGAGAGG - Intergenic
926875399 2:17471164-17471186 ATGGAGAAGCCAAATTAAAGTGG - Intergenic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
927672365 2:25079435-25079457 ATAAAGAGGCAGGATCAGAGAGG - Intronic
928082135 2:28320839-28320861 ATGAAGGAGCAGGCTTGGAGAGG - Intronic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928513525 2:32023452-32023474 ATGAGGAAACAGACTTGGAGAGG - Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928617110 2:33051776-33051798 ATGTAGAAGCAGACATAAAGTGG - Intronic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
930757353 2:54990111-54990133 ATGAAGAAACTGAAATATAGAGG - Intronic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931494272 2:62784914-62784936 ATGATGAATCAGAATCATAGAGG - Intronic
931829314 2:66034585-66034607 ATGATGAAAAAGAATTATAGAGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
933367280 2:81368673-81368695 ATGGAGAAGAACAAATAGAGTGG + Intergenic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935329590 2:101967094-101967116 TTGAGGAAGCAGACTCAGAGAGG + Intergenic
936044828 2:109179358-109179380 ATGAAAAAGCAGAACGTGAGAGG + Intronic
936663891 2:114572804-114572826 ATGAAGAAACTGAAGTTGAGTGG + Intronic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937733734 2:125264327-125264349 GAGAAGAATCAGATTTAGAGAGG - Intergenic
937861353 2:126713951-126713973 CTGAAGATGCAGACTTAGACAGG + Intergenic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
938665104 2:133526586-133526608 ATGAAGAAACAGAATTGCATGGG + Intronic
939261216 2:139812136-139812158 ATGAAGGAAAAGAAGTAGAGTGG - Intergenic
939389149 2:141544293-141544315 AAGAAGAAGAAGAAGAAGAGTGG - Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939495653 2:142924941-142924963 ATGAAGAAGCAGACTCTGTGTGG + Intronic
939615117 2:144353851-144353873 ATAAAGAAACATAATTACAGAGG - Intergenic
940428110 2:153553756-153553778 ATGAAGAAGCAACACTTGAGGGG + Intergenic
940549559 2:155136222-155136244 ATGAAAAAATAGAAATAGAGGGG - Intergenic
942512735 2:176719369-176719391 AGGAAGGAGCAGATTTATAGTGG + Intergenic
942542680 2:177031125-177031147 AGGTAGAAACAGGATTAGAGAGG - Intergenic
943438426 2:187896308-187896330 AGGAATAAGCAGAGATAGAGAGG + Intergenic
943595531 2:189850691-189850713 ATGAAGAGGAGGCATTAGAGAGG + Intronic
944126282 2:196296664-196296686 ATGAAGAAGGAGAATTATAGGGG + Intronic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944933178 2:204541343-204541365 ATGAGGAAACTGGATTAGAGAGG - Intergenic
944980816 2:205118051-205118073 AAGAAGAGGCTAAATTAGAGAGG - Intronic
945571954 2:211479266-211479288 TTGCAGGAGCAGAAATAGAGGGG - Intronic
945813025 2:214570899-214570921 ACCAAAAAGCAGAATTAAAGTGG - Intronic
946055624 2:216899472-216899494 ATAAAGAAAGAGTATTAGAGAGG - Intergenic
947071493 2:226292482-226292504 TTGAAGGAGCAAATTTAGAGTGG + Intergenic
947123848 2:226846353-226846375 CAGAAAAATCAGAATTAGAGGGG - Intronic
948540944 2:238691145-238691167 CTCAAGAAGCAGAGTGAGAGAGG - Intergenic
948766151 2:240220557-240220579 GAGAAGCAGCAGAATTAGACAGG - Intergenic
1169054141 20:2606012-2606034 ATGTACATGCTGAATTAGAGAGG - Intronic
1169459889 20:5785350-5785372 ATGAGGAAACAGTTTTAGAGAGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170786377 20:19471143-19471165 AAGAAGAAGCAGAGTAAGAGGGG + Intronic
1171507393 20:25648766-25648788 AGGAGGAAGCAGATTTAGAGAGG + Intergenic
1172214347 20:33224470-33224492 ATACAGAAGCAGAATCTGAGAGG + Intronic
1172224363 20:33295505-33295527 ATGAGGCAGGAGAATCAGAGAGG + Intronic
1172325701 20:34032825-34032847 AAGAAAAATCAGAATTAGAGAGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173936479 20:46870513-46870535 CTAAAGAAGCAGAATCTGAGTGG + Intergenic
1174666030 20:52258576-52258598 AGGAAGAAAGAGAATGAGAGGGG - Intergenic
1174943533 20:54958721-54958743 TTGATGAAGCAGAAGCAGAGAGG - Intergenic
1175020131 20:55837378-55837400 ATGAAGAAACAAAATTGGAATGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1177793511 21:25747072-25747094 ATGTAGAAACAGATTTAAAGAGG + Intronic
1178205930 21:30465079-30465101 ATAAAGAAACTGAATCAGAGAGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179606174 21:42516796-42516818 ATGGAGAAGCAGCACTTGAGAGG + Intronic
1179805835 21:43836300-43836322 ATGGAGAAACAGATTTGGAGGGG - Intergenic
1181416994 22:22767400-22767422 ATGAAGAGCCAGGAGTAGAGAGG + Intronic
1181829006 22:25544153-25544175 ATGATGAAGCTGAACTACAGGGG - Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1183223373 22:36531786-36531808 ATGAATAAGCAGGTTTAGAGAGG - Intergenic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
949348129 3:3096293-3096315 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
950144637 3:10640361-10640383 AGGAAGAGGCCGATTTAGAGAGG - Intronic
950167236 3:10810695-10810717 ATGGCGAACCAGAATTGGAGAGG - Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
951181525 3:19664725-19664747 ATGAGGAAGGAGAATGAAAGTGG - Intergenic
951312776 3:21149395-21149417 ATGAAGAAGCAAAATCCGAGAGG - Intergenic
951403648 3:22266548-22266570 ATGAGAAAGCACAATTAGAAAGG + Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954204013 3:49044161-49044183 AGGAACAAGCAGAACTAGTGGGG - Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955521567 3:59780334-59780356 ATGAAGAAGTAGAATGTCAGTGG + Intronic
955940658 3:64144309-64144331 TTGAAGAAACAGAAATGGAGAGG - Intronic
956014673 3:64869238-64869260 ATGAAGAACCAAAATAATAGTGG + Intergenic
956077268 3:65518884-65518906 GAGAAAAAGCAGAATAAGAGTGG + Intronic
956190689 3:66605187-66605209 ATGAAAAAACAGACATAGAGAGG - Intergenic
956432427 3:69200609-69200631 AGGAAGGAGTAGAATTAGGGAGG - Intronic
957476811 3:80736188-80736210 ATGCAGTAACAGAATTTGAGAGG + Intergenic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
958061730 3:88492218-88492240 ATAAAGCAGCAGATTAAGAGTGG - Intergenic
958507746 3:95002735-95002757 ATGATTAAGCACAATTAGAATGG + Intergenic
958715781 3:97778524-97778546 ATAAAAAAACAGTATTAGAGGGG - Intronic
959413067 3:106048982-106049004 ATGAAGAAGCTGAATTCTACAGG + Intergenic
959625195 3:108442020-108442042 ATAAAGAAGACAAATTAGAGGGG - Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959813631 3:110649417-110649439 ATAAACAAGCAGAGATAGAGAGG - Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960038184 3:113122865-113122887 ATGAAGAAGCTGGATTATAATGG + Intergenic
960159584 3:114335613-114335635 AGGAAGAAGCTGGATTGGAGTGG - Intergenic
960652444 3:119966432-119966454 AAGAAGAAACAAATTTAGAGAGG + Intronic
960675133 3:120186226-120186248 ATTAGGAAACAGACTTAGAGAGG + Intronic
960781065 3:121317980-121318002 ATAAATAAGAAGAATTAGAAGGG - Intronic
961119435 3:124361090-124361112 ATGAGGAATCAGGCTTAGAGAGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961953731 3:130778189-130778211 ATGAAGAAGCAGAATTTCTGGGG - Intergenic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
963031959 3:140987556-140987578 ATGAAAAAGCAAAAATGGAGGGG + Intergenic
963115586 3:141726439-141726461 AAGAAGAAGAAGAAGAAGAGAGG + Intergenic
964039736 3:152245884-152245906 ATGAAGAAGCACAATTGTAACGG - Intronic
964389209 3:156180232-156180254 ATAAGGAAGCAGACTTGGAGAGG + Intronic
964529406 3:157651099-157651121 ATGAAGAAGAAAATTTTGAGAGG + Intronic
964575375 3:158160901-158160923 ATGAAGAAACAGACTTACAGAGG + Intronic
964660047 3:159110526-159110548 GTGAAGAAGGAGCATTAAAGAGG - Intronic
964737520 3:159931822-159931844 TTTAGGAAGCAGAATTGGAGAGG - Intergenic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964881446 3:161427753-161427775 ATCAAGAAGCAGAATAAAATTGG + Intergenic
965149824 3:164957866-164957888 ATGAGGAAAAAAAATTAGAGAGG - Intergenic
965210047 3:165773478-165773500 TTGATGAAGCAGAATGGGAGTGG - Exonic
965259365 3:166460589-166460611 ATGAAGAAACACAAGTAGACAGG - Intergenic
965606886 3:170506719-170506741 GTGACTCAGCAGAATTAGAGAGG - Intronic
965833592 3:172826548-172826570 ATGCAGAGGCAGGATTTGAGAGG + Intergenic
965870770 3:173262041-173262063 ATGAAAAGGAAGAATTTGAGAGG + Intergenic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
966316573 3:178653399-178653421 ATAAAGAATAAGAATTAGAAGGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966430365 3:179825738-179825760 ATGAAGAAACTGAGTTAAAGAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966900077 3:184475865-184475887 AAGAAGAATAAGAATAAGAGGGG - Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
968539564 4:1157551-1157573 AAGCAGCAGCAGAATTGGAGAGG - Intergenic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969112851 4:4854490-4854512 ATGAAAGAACAGAATCAGAGAGG - Intergenic
969657308 4:8505654-8505676 ATGAGGAAGCAGAGACAGAGAGG + Intergenic
970031446 4:11679791-11679813 ATGAAGAAACTGAAGTTGAGAGG + Intergenic
970222161 4:13822248-13822270 AAGAAGAAGAAGAAAAAGAGTGG - Intergenic
970916268 4:21338819-21338841 ATGAAGAAAAAGAATCTGAGTGG - Intronic
971021435 4:22540447-22540469 ATGAATAAACAGCCTTAGAGAGG + Intergenic
971130150 4:23799430-23799452 ATGAAGAAGCAGAACTGAAGGGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971503984 4:27346649-27346671 ATAAAGAAACTGAAGTAGAGTGG - Intergenic
973153956 4:46924876-46924898 ATGAGGAATCAGTCTTAGAGAGG + Exonic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
975273539 4:72466908-72466930 TTGAGGAGGCAGATTTAGAGAGG - Intronic
975537610 4:75468623-75468645 ATGATGAAGGAGGAATAGAGGGG - Intergenic
977449545 4:97177138-97177160 ATGCATCAGGAGAATTAGAGGGG + Intergenic
977771980 4:100870692-100870714 AGGAAGAAGCAAAATTGCAGGGG - Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978798664 4:112733364-112733386 ACAAAGAAGCAGAATTGGATAGG - Intergenic
978844780 4:113260175-113260197 GTGAAGAAGCAAAGTAAGAGTGG - Intronic
979163076 4:117488761-117488783 ATGAAGAAGCAGAAGCCTAGAGG + Intergenic
979479392 4:121198900-121198922 ATAAAAATGAAGAATTAGAGAGG + Intronic
979980594 4:127249757-127249779 GAGAAGCAGCACAATTAGAGAGG + Intergenic
980261235 4:130450484-130450506 CAGAAGAAGCAGAACTAAAGTGG + Intergenic
980479895 4:133375041-133375063 ATAAAGAAGAAACATTAGAGAGG + Intergenic
980613902 4:135194107-135194129 AAGAAAAAGCATTATTAGAGAGG + Intergenic
980765666 4:137300766-137300788 ATGAAGATTGAGAATAAGAGTGG - Intergenic
981153862 4:141411360-141411382 ATGAGGACTGAGAATTAGAGTGG - Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981995515 4:150969869-150969891 ACGCAGTAGCAGAATTTGAGAGG + Intronic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982369909 4:154623704-154623726 CTGAAGAAGAGGAATCAGAGAGG - Intergenic
982383650 4:154776935-154776957 ATTAAGAATCAGAATTGGAGTGG + Intergenic
982425493 4:155253888-155253910 ATCTAGAGGCTGAATTAGAGAGG + Intergenic
983573616 4:169236545-169236567 GTGAGGAAGCAGACATAGAGAGG - Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984052136 4:174877452-174877474 TTGAAGAGGCAGTATCAGAGAGG + Intronic
984502673 4:180576340-180576362 ATGAAGAAACAAACTTAGAGAGG + Intergenic
984694058 4:182761423-182761445 AAAAAGAAGAAGAATTAGAGAGG + Intronic
984830623 4:183969563-183969585 ATGAATAAGCAGAAATCTAGCGG - Intronic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
986307793 5:6528626-6528648 ATGAACAGCCAGAATCAGAGGGG + Intergenic
986596010 5:9422930-9422952 ATGAAGAAGCAATATTGCAGGGG + Intronic
986672349 5:10153582-10153604 ATGAAGAACATGAATCAGAGAGG - Intergenic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987107749 5:14657248-14657270 TTTAAAAAACAGAATTAGAGGGG - Intergenic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987244923 5:16039136-16039158 ATGAAAATGCACAATTAGAGTGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987604714 5:20118023-20118045 ATAATGAAGCAGAATTACAGTGG - Intronic
988371883 5:30380501-30380523 ATGAAGAAGCCGATCTAGATTGG + Intergenic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
989435343 5:41406437-41406459 AAGAAGGAGCAGATTTAAAGGGG - Intronic
989550855 5:42734618-42734640 ATGAAGAAACAGATATTGAGAGG + Intergenic
990436749 5:55800198-55800220 ATGAAGAAACAAATATAGAGAGG + Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991029245 5:62065801-62065823 ATGAAGAGTGGGAATTAGAGTGG + Intergenic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
993340619 5:86720694-86720716 ATCAAGAAGGAGAATTTGTGAGG + Intergenic
993425399 5:87757506-87757528 ATGAAGTATAAGCATTAGAGAGG - Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993799609 5:92316587-92316609 ATGAGGAAGCAGAAAGACAGAGG + Intergenic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
994410308 5:99399852-99399874 ATGAAGAAACAGAAATAGCTTGG - Intergenic
994483512 5:100365424-100365446 ATGAAGAAACAGAAATAGCTTGG + Intergenic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
995830918 5:116354958-116354980 ATAAAAAAGAAAAATTAGAGAGG + Intronic
996171421 5:120296366-120296388 ATGAGGAAATAGATTTAGAGAGG - Intergenic
996185918 5:120475160-120475182 ATGAAGAAGCACAGACAGAGAGG + Intronic
996442435 5:123507328-123507350 CTAAAGAAACATAATTAGAGAGG + Intergenic
996489844 5:124080919-124080941 ATAAAGATGCACAATTAAAGAGG - Intergenic
996613711 5:125414603-125414625 AGAAAGAAGTAGAATTACAGAGG + Intergenic
996968432 5:129332769-129332791 ATCAAGCAGAAGAATTAGTGAGG + Intergenic
997276034 5:132591297-132591319 ATGAAAAAGCAGACTTAGACAGG + Exonic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997701986 5:135908935-135908957 ATGAGGAAACAGAGGTAGAGAGG + Intergenic
998501225 5:142634560-142634582 ATGAGGAACCAGACTCAGAGCGG - Intronic
998532875 5:142901686-142901708 ATGAGGAAGCAGGTTCAGAGAGG - Intronic
999039057 5:148386366-148386388 ATGAACAAACAGAACCAGAGAGG - Intronic
999075490 5:148791584-148791606 ATCAACAAGCTGAATGAGAGGGG + Intergenic
999152713 5:149436958-149436980 AAGAAGAAGAAGAAAAAGAGTGG + Intergenic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
1000010545 5:157227462-157227484 CTGAAGAAGCTCAATTAGGGAGG + Intronic
1000293097 5:159889561-159889583 ATGAAGAAGTAGAGACAGAGAGG + Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001880188 5:175236682-175236704 ATAAAGAAGCAGACATTGAGGGG + Intergenic
1002259464 5:177983707-177983729 AAGAAGAAGCTGAACTAAAGAGG - Intergenic
1002835392 6:861285-861307 ATGAAGGGGCAGAGCTAGAGGGG + Intergenic
1003593068 6:7452259-7452281 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1005049091 6:21666962-21666984 ATGAATATGCAGAAATTGAGAGG + Intergenic
1005143454 6:22661141-22661163 ATGAAGAAACTGAAGCAGAGAGG - Intergenic
1006064134 6:31449758-31449780 AAGAGGAAGCAGAATCAAAGTGG + Intergenic
1006140237 6:31924371-31924393 ATAAAGAAACAAAATTAAAGAGG - Intronic
1006549867 6:34813161-34813183 ATAAAGATGCTGAATTACAGAGG + Intronic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007267397 6:40607331-40607353 ATGAAGGAGCAGCAATAAAGGGG + Intergenic
1007303604 6:40887366-40887388 ATGAGGAAACAGACTTTGAGAGG - Intergenic
1007350794 6:41272148-41272170 AGGAAGATGCAGAAAAAGAGAGG + Intronic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1007892188 6:45305970-45305992 AGGTATATGCAGAATTAGAGAGG - Intronic
1008221642 6:48861566-48861588 AATATGAATCAGAATTAGAGTGG - Intergenic
1008383243 6:50857472-50857494 CTGATGAAGCAGATTCAGAGAGG - Intergenic
1009451671 6:63808302-63808324 ATGAAGAAGAAAAGTGAGAGTGG + Intronic
1010870501 6:81031405-81031427 AGGGAGTGGCAGAATTAGAGGGG + Intergenic
1011165734 6:84443911-84443933 ATGAAGAAGCAGAAACTCAGGGG + Intergenic
1011178482 6:84591633-84591655 AAGCAGCAGCAGAATTTGAGAGG - Intergenic
1012427514 6:99130751-99130773 AGGAAGAGGGAGAATGAGAGAGG - Intergenic
1012438721 6:99242075-99242097 AAAAAGAAGCAAAATTAGAATGG + Intergenic
1012892274 6:104909625-104909647 ATCAAGCAGAAGAATTAGTGAGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013135371 6:107277197-107277219 TTGAAGAAGCTAAATTTGAGCGG + Intronic
1013651774 6:112202256-112202278 AGGAAGAAGAAGAAAGAGAGAGG - Intronic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1013996990 6:116320682-116320704 GTGAAGAGGCAGCAATAGAGTGG - Intronic
1014032885 6:116727238-116727260 ATGAAGAAACTAGATTAGAGGGG - Intronic
1014721072 6:124919354-124919376 ATGCTGAAGAAGCATTAGAGTGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015455896 6:133425762-133425784 ATGTGGAGGCTGAATTAGAGAGG - Intronic
1015560622 6:134511329-134511351 ATGAGGAAGATGAATTAGAATGG - Intergenic
1015599131 6:134895410-134895432 ATGAAGAGAGAGAACTAGAGAGG + Intergenic
1015693965 6:135958264-135958286 AAAATGAACCAGAATTAGAGAGG - Intronic
1016413566 6:143809288-143809310 ATGAAGAAGCACAATAAAATTGG + Intronic
1017406141 6:154121305-154121327 ATGAAGGAGCAAAATAACAGTGG - Intronic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1018007060 6:159632021-159632043 ATGAGAAAGCAGGAGTAGAGAGG - Intergenic
1018756668 6:166855503-166855525 AAGAAGAAGAAGAATAAGAAGGG + Intronic
1019521149 7:1461059-1461081 ATCAAGAAGCAGAAGCAGCGGGG + Intergenic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1019979403 7:4610148-4610170 AAGAAGAAGAAGAATTAGCTGGG + Intergenic
1020791009 7:12628180-12628202 ATGAGGAGGCAGAATGAAAGTGG + Intronic
1021526905 7:21598069-21598091 AGCAAGAATCAGAACTAGAGAGG - Intronic
1021906987 7:25344299-25344321 ATGAAGGAGCAAAATTAAAAGGG - Intergenic
1021942256 7:25689430-25689452 TTGATGAAACAGAACTAGAGAGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024634083 7:51272910-51272932 ATGAAAACGCAGACATAGAGAGG - Intronic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1027509383 7:79060573-79060595 ATGAGGAAGCAGAAATTAAGAGG + Intronic
1028546049 7:92001767-92001789 CACAAGAAGCTGAATTAGAGAGG + Exonic
1029043167 7:97598778-97598800 ATGAGGAAACAGACTTACAGAGG - Intergenic
1030300255 7:107967368-107967390 AAGAGGAAGAAGAATTTGAGAGG - Intronic
1031077134 7:117223628-117223650 ATGAAGAGGCATTAGTAGAGTGG - Exonic
1031257754 7:119478327-119478349 AAGAATGAGCAGAAATAGAGTGG + Intergenic
1031382823 7:121109533-121109555 AAGAAGAAGCTGATGTAGAGGGG - Intronic
1032612375 7:133429107-133429129 ATGATGAAGGAGAAGTAGTGAGG + Intronic
1034882428 7:154772703-154772725 ATTAAGGAGCAGAATTAATGTGG - Intronic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1036474968 8:9084832-9084854 CTGAAGAAGCTGAAGTGGAGAGG + Intronic
1036537309 8:9662786-9662808 ATGAAAGAGCAGTATTTGAGAGG + Intronic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037158104 8:15731126-15731148 CAGAAGAAGGAGATTTAGAGTGG + Intronic
1038308314 8:26424523-26424545 AGGAGGAAGCAGAAGTAGATGGG + Intronic
1038512246 8:28149677-28149699 ATAAATAATAAGAATTAGAGTGG - Intronic
1038881312 8:31616304-31616326 ATAAATAAGCAGAATTATAGAGG - Intergenic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039471876 8:37818539-37818561 ATGTAGGAGCAGTACTAGAGTGG + Intronic
1040356785 8:46626085-46626107 GTGAAGAAACAGAATCTGAGGGG - Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1041094110 8:54332255-54332277 ATGAAGAAGGAGGTTCAGAGAGG - Intergenic
1041179979 8:55237009-55237031 AAGAAGAAGCACAACCAGAGGGG - Intronic
1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG + Intergenic
1043157826 8:76807408-76807430 CTGAACAAGCAGAATTAGATTGG + Intronic
1043992188 8:86769090-86769112 ATAAAGACACAGAAATAGAGGGG - Intergenic
1044083335 8:87912286-87912308 ATGTAGAAGCTGAATTGGAAAGG + Intergenic
1044444431 8:92257936-92257958 GTGAAAAAGATGAATTAGAGGGG + Intergenic
1044553964 8:93542088-93542110 ATGAAGAAACAGAGGTACAGAGG + Intergenic
1045663049 8:104457956-104457978 GTGAAGACGCAGGAGTAGAGAGG - Intronic
1045729987 8:105226661-105226683 AATAAGAAGCAGAAGTTGAGAGG - Intronic
1045835073 8:106510533-106510555 CTGAAGAGGCAGAATTAGTTTGG + Intronic
1045837346 8:106537688-106537710 AAGAAGAAGAAGAATTCTAGAGG + Intronic
1045845343 8:106628411-106628433 ATGAAGAAACAGATTTTGAGAGG + Intronic
1045906146 8:107347431-107347453 ATGAAAAAATAGAATCAGAGAGG + Intronic
1046316683 8:112511803-112511825 AAGCAGAGGCAGAATTTGAGAGG - Intronic
1047481175 8:125284447-125284469 ATGAGGAAACAGAACCAGAGAGG + Intronic
1047665301 8:127085330-127085352 AGGAAGAAGGAGAATGAAAGTGG - Intergenic
1047820976 8:128520306-128520328 ATGAAGAAAGAGTTTTAGAGAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048444919 8:134486124-134486146 ATGAAAAACCAGAATGACAGTGG + Intronic
1050408051 9:5330661-5330683 AAGAAGAAGAAGAATTAGAGAGG + Intergenic
1051072375 9:13187119-13187141 ATACAGAAGAAGAATTATAGGGG + Intronic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1055434936 9:76283183-76283205 AAGTAGCAGCAGAATTTGAGAGG + Intronic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055807051 9:80107599-80107621 ATCAAGATGCAGGATCAGAGAGG + Intergenic
1055825993 9:80325533-80325555 ATGAACAAATAGAATTAGATGGG + Intergenic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1057431487 9:94998603-94998625 ATGAGGAAGGAGGCTTAGAGGGG + Intronic
1057945677 9:99326057-99326079 ATGAAAAAGAACAAATAGAGGGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058751110 9:108039018-108039040 AAGAGAAGGCAGAATTAGAGAGG - Intergenic
1058805097 9:108582902-108582924 ATTAAGAAGCAGAACTAATGTGG - Intergenic
1058898500 9:109420832-109420854 ATAAACAGGCAGAATTAGATGGG + Intronic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059976434 9:119722822-119722844 AGGCAGAAGCAGAACGAGAGAGG - Intergenic
1060237266 9:121873639-121873661 AAGAAGAAGAAGAAGAAGAGAGG - Intronic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061079654 9:128362221-128362243 ATGCAGAGGCAGAACTGGAGTGG + Intergenic
1061193188 9:129094052-129094074 ATGAGGAAGCAGGCTTAGCGAGG - Intergenic
1061608611 9:131730720-131730742 AAGAAGAACCAGCATTAGAAAGG + Intronic
1062662923 9:137648783-137648805 ATGAACCAGCTGAATTTGAGAGG - Intronic
1185793426 X:2945009-2945031 AAGAAGAAGAAGAAGAAGAGGGG + Intronic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1186949925 X:14613052-14613074 ATGATGAAACAAACTTAGAGAGG - Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1188776413 X:34225444-34225466 ATGAAGAAGCAGGGGTAGATGGG - Intergenic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1188992651 X:36841528-36841550 AAAAAGAAGAAGAATGAGAGTGG - Intergenic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189898399 X:45680762-45680784 AAGAAGGAGAAAAATTAGAGTGG - Intergenic
1190725979 X:53190849-53190871 ATGAGAAAGCAAAATAAGAGTGG + Intergenic
1192812058 X:74555832-74555854 ATCAACATGCACAATTAGAGCGG + Intergenic
1192867885 X:75155242-75155264 ATGAAGAATCAAAATTTAAGAGG + Intronic
1193357698 X:80541034-80541056 ATGAAGAATAAGTATTGGAGAGG - Intergenic
1193509912 X:82386782-82386804 ATGAATAATCAAAATTACAGTGG + Intergenic
1193843551 X:86439630-86439652 AGAAAGAAGAAAAATTAGAGTGG - Intronic
1194294505 X:92111731-92111753 ATGAAAAATGAGAATTAGAGTGG - Intronic
1194769647 X:97886043-97886065 AAAAAGAAGGAGAAATAGAGGGG + Intergenic
1194935902 X:99948588-99948610 ATGAAAAAGGAGAATTACAAGGG + Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195577549 X:106468143-106468165 AGGAAGAAGAAGAAGGAGAGGGG - Intergenic
1196060230 X:111400324-111400346 ATGAAGAACCTGATTTGGAGGGG + Intronic
1196129654 X:112141560-112141582 CTCCAAAAGCAGAATTAGAGGGG - Intergenic
1197551105 X:127893840-127893862 AAGAAGACGCAAAATCAGAGTGG - Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1198151776 X:133917776-133917798 ATGAACCAGCAGTATTTGAGAGG - Intronic
1198235932 X:134735975-134735997 AAGAAGAAGAAGAAGTAAAGGGG + Intronic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic