ID: 1108420762

View in Genome Browser
Species Human (GRCh38)
Location 13:50246729-50246751
Sequence GTCCCACTTGGCATTCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108420762 Original CRISPR GTCCCACTTGGCATTCATGC TGG Intronic
906627730 1:47339196-47339218 GGCCAACATGGCATTCATGGTGG - Intronic
906766691 1:48440515-48440537 GTCCCAGTGGGGATTCATACTGG - Intronic
909659282 1:78064269-78064291 GTCCTATTAGACATTCATGCTGG - Intronic
912558764 1:110535297-110535319 GTGTCACTTGGCCTGCATGCTGG - Intergenic
921229926 1:213059541-213059563 GTCTCACTTGTCATCCAGGCTGG + Intronic
923090381 1:230735968-230735990 GTCCCACCTGTCATTTAGGCGGG + Intergenic
923265101 1:232306582-232306604 CTCCCACTTGGCAGCCAGGCGGG + Intergenic
924471384 1:244345690-244345712 GTCTCACTTGTCACTCAGGCTGG - Intergenic
924931574 1:248737135-248737157 GTCCTACTTGTCCTTCAGGCAGG + Intronic
1064172073 10:13042457-13042479 GTCCCACATTGCTTTCATACCGG - Intronic
1065528420 10:26645543-26645565 GCCCCACCTTTCATTCATGCTGG - Intergenic
1067236310 10:44453656-44453678 CTCCCAGTTAGCATACATGCGGG + Intergenic
1073466133 10:103695477-103695499 GTCTCACTTGTCACTCAGGCTGG - Intronic
1081484662 11:43518380-43518402 GTCTCACTTGTCATCCAGGCTGG - Intergenic
1084208489 11:67609767-67609789 GTCCCATTTGGGATGCATGCAGG - Intronic
1084211031 11:67622548-67622570 GTCCCAGTTGGGATCCATACTGG - Intergenic
1084562344 11:69911915-69911937 GCCCCACCTGGCATTCCTGCAGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1104203856 12:126617583-126617605 GTCCCTCTTAGCATTGATGGTGG + Intergenic
1108420762 13:50246729-50246751 GTCCCACTTGGCATTCATGCTGG + Intronic
1110514396 13:76392640-76392662 CTCACTCTTGTCATTCATGCTGG - Intergenic
1111085951 13:83374883-83374905 GTTCAACTTGGTATTCTTGCAGG + Intergenic
1111867831 13:93792162-93792184 GCCCCACCTTGCCTTCATGCAGG + Intronic
1117738383 14:58790713-58790735 CTCCCACTGGGCTTTCTTGCAGG + Intergenic
1123051199 14:105544695-105544717 GTCTCACTTGTCACCCATGCTGG + Intergenic
1125772008 15:42174642-42174664 GTCCCTCTTGGAATCCATCCTGG - Intronic
1127363128 15:58262478-58262500 TTCCCACTCGGGATTCATTCAGG + Intronic
1129517029 15:76163131-76163153 GGCCCACCTGCCATTCCTGCAGG - Intronic
1132283332 15:100640172-100640194 GTCTCACTTGTCACCCATGCTGG + Intronic
1132914317 16:2334364-2334386 GTCCCAATGGGCAGTGATGCTGG + Intronic
1135887317 16:26322073-26322095 ATCCCACTTAGCATTTATGTAGG - Intergenic
1137453365 16:48598049-48598071 GTTCCACTTGGCATTTATAGAGG - Intronic
1138059082 16:53870176-53870198 GTCTCACTTGTCATCCAGGCTGG - Intronic
1140463647 16:75161812-75161834 GTCTCACTTGTCATCCAGGCTGG + Intronic
1141350630 16:83291751-83291773 GTCCCAGTTGGCATAAATTCAGG - Intronic
1142655792 17:1392818-1392840 TTCCCTCTTGTCATTCAGGCTGG - Intronic
1146669620 17:34727822-34727844 GTGCCACGTGGCTTTCATTCTGG - Intergenic
1147843723 17:43390493-43390515 GGCCCACTTGGCATTTATCTTGG - Intergenic
1151794268 17:76332789-76332811 GTTTCCCTTGGCATTCAAGCTGG - Intronic
1153991388 18:10403760-10403782 GTCCAGCTTTGCATCCATGCAGG + Intergenic
1154171882 18:12058037-12058059 GACCCACTAGTCATTCATTCAGG - Intergenic
1154416038 18:14175787-14175809 GACCCACTAGTCATTCATTCAGG - Intergenic
1160880728 19:1318857-1318879 CTCCCACCTGCCATTCCTGCCGG + Intergenic
1160898956 19:1417172-1417194 GTCCCACTTGGCAGCAGTGCAGG + Intronic
1162605610 19:11705185-11705207 GTCCCACATGATAGTCATGCAGG + Intergenic
1168604097 19:57744344-57744366 GCCCCACTTGGCATTTATAGGGG - Intronic
925166908 2:1721412-1721434 ATCCCACTGGGCATTCATCCAGG + Intronic
928880553 2:36092286-36092308 CTCCCACCTGGAACTCATGCTGG - Intergenic
934630741 2:95918401-95918423 ATCCCACATGTCTTTCATGCAGG + Intronic
934803165 2:97188706-97188728 ATCCCACATGTCTTTCATGCAGG - Intronic
934803305 2:97190596-97190618 ATCCCACATGTCTTTCATGCAGG - Intronic
934804566 2:97207430-97207452 ATCCCACATGTCTTTCATGCAGG - Intronic
936008269 2:108908890-108908912 GTCCCACTGGGGCTTCATGATGG - Intronic
937215401 2:120309644-120309666 GTCTCACTTGTCATCCAGGCTGG + Intergenic
938364293 2:130721845-130721867 GTCTCACTTGTCATGCAGGCTGG - Intergenic
938466221 2:131527460-131527482 GTCTCACTTTCCATTCAGGCTGG + Intergenic
938763859 2:134447619-134447641 TTCCCACCTCGCATTCATGCAGG + Intronic
939851868 2:147313889-147313911 GTCCCAGTGGGCATCCATACTGG - Intergenic
941495042 2:166189702-166189724 GTCCCACTTATTATTCATTCAGG + Intergenic
943437721 2:187886749-187886771 TTCCCACTTGGCATTCAGTGTGG + Intergenic
944222828 2:197319421-197319443 GTCCCACTGGATATTCATGTAGG - Intergenic
946207349 2:218119430-218119452 GTCCCAGTGGGCATCCATACTGG + Intergenic
1168789593 20:567397-567419 GTCTCACTTGGCAGTCAAGAAGG + Intergenic
1173342320 20:42163477-42163499 GTACCACTTGGCAAACATGGGGG + Intronic
1176177461 20:63735447-63735469 GGCCCGCTTGGCACTCTTGCTGG - Exonic
1176857306 21:13983507-13983529 GACCCACTAGTCATTCATTCAGG + Intergenic
1177281709 21:18989580-18989602 GTTCCACTTGGCATTTACACAGG + Intergenic
1178185532 21:30215634-30215656 GTCCTTCTTGGCTTTCATGATGG - Exonic
1178389170 21:32184673-32184695 GTCCCACTTGCACTTCATGCTGG + Intergenic
1180358226 22:11859759-11859781 TTCCCACTTGGCCTACATACTGG + Intergenic
1180380039 22:12132571-12132593 TTCCCACTTGGCCTACATACTGG - Intergenic
1182388433 22:29968181-29968203 GTACCACTTTACATTCCTGCCGG + Intronic
1184500466 22:44868435-44868457 GTCTCACTTGTCACTCAAGCTGG - Intergenic
1184630461 22:45774205-45774227 CTCCTACTTGGCATTTCTGCTGG + Intronic
1184928994 22:47666502-47666524 GTCCAAATTGGCATTCATTTTGG + Intergenic
957378896 3:79398614-79398636 GTCCCACTGAGAATTCATGTAGG - Intronic
960659206 3:120040339-120040361 GTCCCTCTTAGCATTGATGGCGG - Intronic
961261669 3:125606872-125606894 GTCCCAGTGGGGATTCATACTGG - Intergenic
966756917 3:183379566-183379588 GTCTCTCTTCTCATTCATGCTGG + Intronic
966812256 3:183857217-183857239 GTCTCACTTGTCACTCAGGCTGG - Intronic
969465392 4:7353335-7353357 GTCCCACTTGGCACCAAGGCTGG - Intronic
970246590 4:14070788-14070810 GTCCCATTTGGTATGCAAGCTGG + Intergenic
971792379 4:31185285-31185307 CACCCACCTGGAATTCATGCTGG + Intergenic
979645628 4:123064437-123064459 ATCCTACTTTGCATTAATGCAGG - Intronic
980048575 4:128015699-128015721 TTCACACTTGGCATTCCTTCTGG + Intronic
981585497 4:146297380-146297402 TTCCAACTTGGAAGTCATGCAGG - Intronic
983297650 4:165886537-165886559 GTCTCCCTTGGTATTCATGGGGG + Intronic
985740707 5:1614708-1614730 ACCCCACTTGGCCTGCATGCGGG + Intergenic
990470968 5:56115168-56115190 GTCTCACTTGTCATCCAGGCTGG - Intronic
991630709 5:68654020-68654042 GTCCAACGTGGCAATCAGGCAGG + Intergenic
994833513 5:104817383-104817405 TTTCCACATGGCATACATGCAGG + Intergenic
999162845 5:149519239-149519261 CTCCCAGTTGGCATTCATACAGG + Intronic
1001083024 5:168680715-168680737 CTCCCACATGGCTTCCATGCAGG + Intronic
1004455471 6:15787882-15787904 GTTCCATTTCGCATTCCTGCAGG + Intergenic
1009488118 6:64251451-64251473 ATCCCCCTTGGCATTCCTGAAGG - Intronic
1010324836 6:74552559-74552581 GTTCCACATGGCAATCATGATGG + Intergenic
1011938465 6:92812519-92812541 GCCCCACTTAGCATTCTTGCTGG - Intergenic
1021479743 7:21103072-21103094 GTCCCACTTGGCAATCAACGGGG + Intergenic
1021985983 7:26099038-26099060 GTCTCACTTGTCACTCAGGCTGG + Intergenic
1023456208 7:40341474-40341496 GTCCCTCTTGGGATTTCTGCTGG + Intronic
1027051767 7:75025343-75025365 GGCCCTCTTGGCAGTCTTGCTGG - Intergenic
1028435197 7:90795042-90795064 GTCTTACTGAGCATTCATGCAGG + Intronic
1028533779 7:91867985-91868007 GTTCCACTTGGAATTTATCCTGG + Intronic
1030695469 7:112580515-112580537 GTTCCACTTGTCAGTCAGGCTGG - Intergenic
1030939530 7:115629190-115629212 GTCCCACTTGGGAGTGATGGGGG - Intergenic
1033652835 7:143355267-143355289 CCCACACTTGGCATCCATGCTGG - Exonic
1037506197 8:19532051-19532073 GTACACCATGGCATTCATGCAGG - Intronic
1038865572 8:31435593-31435615 GTTCCACTTGGGATTTATGGGGG - Intergenic
1039275989 8:35934527-35934549 GTCCCACTGGGTATCCATACTGG - Intergenic
1040029424 8:42810990-42811012 TTTCCACTTGGGATTCATTCTGG + Intergenic
1042919594 8:73908534-73908556 GTCCCAGTGGGGATTCATACTGG - Intergenic
1043799400 8:84588582-84588604 TTCTCACTTGGCATTAATACTGG - Intronic
1055026368 9:71726697-71726719 GTTACACATGGCATTCATTCTGG - Intronic
1056216963 9:84414455-84414477 GTCCATCTTTGAATTCATGCTGG + Intergenic
1056750963 9:89350888-89350910 GGCACACTAGGCACTCATGCAGG - Intronic
1186852248 X:13592129-13592151 GTTCTATTTGGCATTTATGCTGG + Intronic
1190095157 X:47473816-47473838 GTACCACTTTACATTCCTGCTGG - Intronic
1193256503 X:79355161-79355183 GTCCCACTAGGCAGTGCTGCAGG - Intergenic
1200150787 X:153950396-153950418 GGCCCAGCTGGCCTTCATGCGGG - Exonic