ID: 1108422867

View in Genome Browser
Species Human (GRCh38)
Location 13:50268359-50268381
Sequence AAGCTGTTATTAATAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108422867_1108422869 21 Left 1108422867 13:50268359-50268381 CCATGTTCTATTAATAACAGCTT 0: 1
1: 0
2: 0
3: 12
4: 261
Right 1108422869 13:50268403-50268425 TTATAATGCTTTAAACTATGTGG 0: 1
1: 0
2: 3
3: 27
4: 409
1108422867_1108422870 22 Left 1108422867 13:50268359-50268381 CCATGTTCTATTAATAACAGCTT 0: 1
1: 0
2: 0
3: 12
4: 261
Right 1108422870 13:50268404-50268426 TATAATGCTTTAAACTATGTGGG 0: 1
1: 0
2: 0
3: 25
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108422867 Original CRISPR AAGCTGTTATTAATAGAACA TGG (reversed) Intronic
906329020 1:44869035-44869057 AAAAGGTTTTTAATAGAACAAGG + Intronic
907299586 1:53478251-53478273 AAGTTGTTATTAAGAAAAGAAGG + Intergenic
907517179 1:55000178-55000200 AAGGTGTTATTTATAGATGAAGG + Intronic
909387916 1:75081477-75081499 TAGCTATTATTAATGGATCAGGG - Intergenic
910115795 1:83730380-83730402 AATCTGTTTTTATTAGAATAGGG + Intergenic
910135933 1:83969839-83969861 AAGATGTAATTATTTGAACAAGG + Intronic
910456180 1:87399476-87399498 GAGCTGTTGTTAACTGAACATGG + Intergenic
910575000 1:88751620-88751642 AAAATGATATAAATAGAACATGG - Intronic
910886062 1:91964743-91964765 AAATTGTTATTTATATAACAAGG + Exonic
910923435 1:92373935-92373957 AAGCTGTATGTAATAGTACAGGG + Intronic
911748415 1:101467089-101467111 ATTCTGTTATGAATAGAGCAAGG + Intergenic
911936784 1:103986528-103986550 AAGCTGATATTATTAGGACCTGG + Intergenic
912107367 1:106296175-106296197 TAGGTGCTATGAATAGAACATGG - Intergenic
912155051 1:106907982-106908004 AGGCTGCAGTTAATAGAACAGGG + Intergenic
913459946 1:119074079-119074101 AAGCTGTTTTTAATACAAGCTGG - Intronic
915627923 1:157127243-157127265 AAACTGTTTTTACTAAAACATGG - Intronic
916859089 1:168783683-168783705 AAGCTGTGCTCCATAGAACATGG - Intergenic
917106707 1:171499479-171499501 AAGCACTTATTAATAGAAAAGGG + Intronic
917224962 1:172771860-172771882 CAACTGTTAATAATAGTACAGGG + Intergenic
917643899 1:177010471-177010493 AATGGGTTATTAAAAGAACATGG - Intronic
918764979 1:188469899-188469921 ATGGTATTATTAATAGAAAATGG + Intergenic
918978183 1:191518408-191518430 AAGCTATAGTTCATAGAACAAGG + Intergenic
919503436 1:198367699-198367721 AAGGAGTTATTAATAGAAATGGG - Intergenic
919719865 1:200821753-200821775 AATGAGTTAATAATAGAACAGGG - Intronic
920533642 1:206723220-206723242 AAGGTGTTATTAATAGCTCTGGG - Intronic
920962220 1:210673542-210673564 AAGCAGTTAGTAATTGAAAAAGG - Intronic
923501215 1:234566414-234566436 AAGCAGTAACTAATAGAACCAGG - Intergenic
1063417474 10:5885847-5885869 AAGCTATCACTAATAGAACGGGG - Intronic
1064888682 10:20142930-20142952 AAGCTATTGTTAAAATAACAAGG + Intronic
1065169911 10:23016635-23016657 AAGCCCTTATTAATATAACCTGG + Intronic
1065415770 10:25483762-25483784 AATTTGTTATTAATAATACAAGG - Intronic
1068541085 10:58295621-58295643 AAGCTGGGATAAACAGAACAGGG - Intergenic
1068819882 10:61362289-61362311 AAGGTGTTATCAAGAGAGCAGGG + Intergenic
1068987515 10:63120945-63120967 AAGTTGTTATCTATAGAGCAGGG + Intergenic
1070035434 10:72717955-72717977 AAAATGTTAATAATAGAAGAAGG - Intronic
1070489656 10:76964669-76964691 AAGATTTTAGTAATAGAAAATGG - Intronic
1071206323 10:83283681-83283703 AAGGTGTTACTAAATGAACACGG + Intergenic
1071775299 10:88780119-88780141 TTGCTATTTTTAATAGAACAAGG + Intergenic
1074563563 10:114555959-114555981 AGGTTGTTATTAATAGAAAGTGG + Intronic
1074949115 10:118311761-118311783 CAGATGTGATTAATAAAACATGG + Intronic
1078080004 11:8197283-8197305 AAGTTGTTATTGATAGAGAAGGG - Intergenic
1079624864 11:22604820-22604842 AAACTGTAATTAATAGAGAATGG + Intergenic
1081493292 11:43583019-43583041 AAGCTATTATTAATCTAACGTGG - Intronic
1083558256 11:63649973-63649995 AATCTGTAATTACAAGAACATGG - Intronic
1084337154 11:68465738-68465760 AAGCTGTTAAGAATTGTACATGG + Intronic
1084885556 11:72203750-72203772 AACCTATTATTATTAGAACCTGG + Intergenic
1085551826 11:77380740-77380762 AAGCTGTGATTAATTTGACATGG - Intronic
1086112129 11:83211182-83211204 AGGCTGTTCTTAATACAAGAAGG - Intronic
1087231172 11:95666969-95666991 AAGCTGTTGTAAAGAAAACATGG - Intergenic
1087672120 11:101119704-101119726 GAGCTGTTCTGAATAGAAGAAGG + Intronic
1087939762 11:104081337-104081359 AGGCTCTTATTGATAGAAAATGG + Intronic
1090615770 11:128513179-128513201 AAGTTGTTATTAACAGAATTTGG + Intronic
1093401436 12:18751960-18751982 AAGCTGTTAATTCTAGGACAAGG - Intergenic
1093526812 12:20113198-20113220 AAGCTGTTATTGAAACACCAGGG - Intergenic
1095612556 12:44147225-44147247 AAGCTGTAAATAAAACAACATGG + Intronic
1097549527 12:61049671-61049693 AACCGGTTATTAACAGGACATGG - Intergenic
1097577376 12:61411906-61411928 AAGATGTTTAAAATAGAACAAGG - Intergenic
1098541875 12:71666053-71666075 AAGCTGTAGTAAATAAAACAAGG + Intronic
1100023105 12:90095746-90095768 AAGCTTTTATTAATAGGAGAGGG + Intergenic
1101319642 12:103662313-103662335 AAGCTGTCATTAATACTGCAGGG + Intronic
1102882820 12:116498871-116498893 AAACTGTTATTAAAAGACAACGG - Intergenic
1106373295 13:29158534-29158556 GAGCTGTTTTTCATAGAGCAAGG + Intronic
1106997950 13:35509281-35509303 AAGCTGTTACTTATAGATCCTGG + Intronic
1107032356 13:35866283-35866305 ATGCTGCTATGAATATAACATGG - Intronic
1107991865 13:45825857-45825879 AAGCTGTAACTCAGAGAACAAGG - Intronic
1108422867 13:50268359-50268381 AAGCTGTTATTAATAGAACATGG - Intronic
1108969778 13:56359114-56359136 AAGAGATGATTAATAGAACATGG + Intergenic
1109272503 13:60270087-60270109 AATCTGTTTTTAAATGAACATGG - Intergenic
1109419864 13:62098168-62098190 TATCTGTTATTAATAGAATTTGG - Intergenic
1109858270 13:68162391-68162413 AAGCAATTAATAATAAAACATGG - Intergenic
1110662296 13:78071472-78071494 AAGCAGTTTTTAAAAGAATAAGG + Intergenic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111088726 13:83413321-83413343 AAGTAGTTATTAATAAAAGAAGG + Intergenic
1111230382 13:85337745-85337767 AAGCTGTTACTAGCAGAACTCGG - Intergenic
1111316074 13:86561874-86561896 AAAGTGTTATTTAAAGAACATGG + Intergenic
1114860788 14:26518415-26518437 AAGGTGTTATTGATAAAAGAGGG - Intronic
1114937179 14:27554386-27554408 AAGCTGTTAATACTCCAACAGGG + Intergenic
1115261052 14:31454954-31454976 GAACTTTTAATAATAGAACAGGG + Intronic
1117924555 14:60764842-60764864 AAGCTGTAATTAGGAGAAAAAGG + Intronic
1119455684 14:74753586-74753608 AATCTGTTATTAAAGGAAGAAGG - Intergenic
1120307588 14:82790136-82790158 AAGCTATTATGAGTAGAAGAAGG - Intergenic
1120815420 14:88852137-88852159 AAGATGTGATTAATAGAAGCTGG - Intronic
1122567561 14:102671661-102671683 AAGCTGTTATTTAAAAAGCAAGG - Intronic
1125860455 15:42994240-42994262 AATCTGTTATTAATAATCCATGG + Intronic
1127617298 15:60699861-60699883 AAGCTTGTATAAATAGCACAAGG - Intronic
1130959204 15:88648604-88648626 TAGTTGTTATTATTAGCACAAGG - Intronic
1131362672 15:91807120-91807142 CAGCTGTTATTATCAGCACACGG - Intergenic
1131898995 15:97067400-97067422 AAGATGTTAATAATAGAACTGGG + Intergenic
1132137970 15:99362560-99362582 AAGCTGTCATTAATAAAAGCAGG - Intronic
1132924317 16:2420584-2420606 AAGCTGTTATAAAAAGAAGGAGG + Intergenic
1133098268 16:3462689-3462711 ACGCTTTTCTTAATAGAAGAGGG - Intronic
1133464418 16:6016596-6016618 AAGCTGGTTTAAAAAGAACAAGG - Intergenic
1133964646 16:10521713-10521735 AATCTGTTACTGCTAGAACATGG - Intergenic
1135102140 16:19615296-19615318 AAGCTATTTTTAATAAAAAAGGG - Intronic
1136175538 16:28513945-28513967 TAGCTGTTATTAGTAGCACAAGG + Intergenic
1136864436 16:33733360-33733382 AATATGTATTTAATAGAACATGG + Intergenic
1137427833 16:48394705-48394727 AAGCTATTACTGAGAGAACAGGG + Intronic
1140645313 16:77023484-77023506 AAGCTTTGATTAAGAGAATATGG + Intergenic
1203125925 16_KI270728v1_random:1581486-1581508 AATATGTATTTAATAGAACATGG + Intergenic
1143910920 17:10248150-10248172 AAGAGGTTATTAAAAGAAGATGG - Intergenic
1149418435 17:56484673-56484695 CAGCTGTTATTAATAGACACTGG - Intronic
1149936082 17:60808522-60808544 AACATGTTAATAATATAACATGG + Intronic
1150983764 17:70172006-70172028 AAGCTATCATTAAAAAAACAGGG - Intronic
1151072335 17:71229636-71229658 TAGCTTTTAATGATAGAACAGGG + Intergenic
1153756340 18:8287430-8287452 AAGCTGTTATAAACATACCAGGG - Intronic
1154989868 18:21590526-21590548 AAGCTGCTTTTCATAGAAAAAGG - Intronic
1155938509 18:31779116-31779138 AAGCTATTATAAATATACCAAGG - Intergenic
1156432295 18:37089108-37089130 AGGAAATTATTAATAGAACATGG - Intronic
1157634346 18:49135400-49135422 AAGCAGTAAATAGTAGAACAAGG - Intronic
1157928102 18:51788449-51788471 AAGCTGTTTTTAAGAAGACAGGG + Intergenic
1158582293 18:58694565-58694587 AAGTTGTAATTAATAAAACTGGG - Intronic
1158655324 18:59325576-59325598 AAGGTGTTACTAATAGGAGATGG + Intergenic
1158967973 18:62639268-62639290 AGCATGTTAGTAATAGAACATGG + Intergenic
1158997250 18:62934831-62934853 AAGCTGTTAATAAAAAAATAAGG + Intronic
1159866716 18:73714218-73714240 AAACTTTCATTAATAAAACAAGG + Intergenic
1163934542 19:20431042-20431064 AAGGTCTTATTAATAGCAAAGGG - Intergenic
1164839262 19:31380377-31380399 AAGGTGTTGTTAACAGAAGAAGG - Intergenic
1164956107 19:32386860-32386882 AACCTGTGGTTAATAGAACTTGG - Exonic
1167027069 19:46928256-46928278 AATCTGTTTTTAAAAGAACTGGG + Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
925311513 2:2887648-2887670 AAAGTGTTATTAACAGAAAACGG + Intergenic
926272440 2:11376797-11376819 AAGCTGTTATTAAAAAACAATGG + Intergenic
927432392 2:23037979-23038001 AACCAGTCATTAATAGAACTGGG + Intergenic
930748649 2:54910750-54910772 AAGCTGTGATTTTTAGAATATGG - Intronic
931973987 2:67622696-67622718 AAGCTGTTATTAATGCAAATTGG + Intergenic
933000678 2:76918676-76918698 AGGCTGTTATTAAGAAAAAAAGG - Intronic
933510149 2:83230727-83230749 AAGCAGTTTATAATAGCACAGGG + Intergenic
934632746 2:95947080-95947102 AATATGTATTTAATAGAACATGG + Intronic
934800754 2:97156177-97156199 AATATGTATTTAATAGAACATGG - Intronic
934892229 2:98080675-98080697 GATCTGTTATGAATAGAATAAGG - Intergenic
936124933 2:109780974-109780996 AAGTTGTTATTAATTGTACCTGG + Intergenic
936219760 2:110590494-110590516 AAGTTGTTATTAATTGTACCTGG - Intergenic
938002782 2:127758067-127758089 AAGGTGTATTAAATAGAACATGG - Intronic
941148511 2:161884471-161884493 AATCTGAAATTTATAGAACATGG - Intronic
941405937 2:165088365-165088387 AAGCTATTACAAATATAACATGG - Exonic
942625003 2:177890862-177890884 AAGCTGTTTTTATCAGAACATGG - Intronic
942888579 2:180959707-180959729 AAGCTGTTACTAATGGAGAATGG - Intergenic
943916548 2:193642349-193642371 AGGTTGTTATCAATTGAACATGG - Intergenic
944083508 2:195817367-195817389 AAGCTGTTTTTACTGGAGCATGG - Intronic
945260470 2:207838204-207838226 AAGTTGCTAGTAATAGAAAAGGG - Intronic
945702431 2:213188759-213188781 AATATGTTATTTATATAACAAGG + Intergenic
946343849 2:219091779-219091801 AATTTGTTATTAAATGAACAAGG + Intronic
946462086 2:219877803-219877825 AAGTTGTTATTTAAAGTACAAGG + Intergenic
946959565 2:224969597-224969619 AATCTGTGATTAATAGAACTGGG - Intronic
948093078 2:235312124-235312146 AAGCTGTTATTAAAAGTGGAGGG + Intergenic
1169435174 20:5580826-5580848 AAGATGATATTGATAGAACCAGG - Intronic
1169943319 20:10961522-10961544 AAGATTTTTTTAATATAACAAGG - Intergenic
1170390029 20:15862282-15862304 AACCTGTTAGTATTTGAACAAGG - Intronic
1170856256 20:20058438-20058460 AAGTTGCTATTAATAGAATGTGG - Intronic
1180018521 21:45103718-45103740 AAGATCTTAATAATAGAAAATGG + Intronic
1181757392 22:25033878-25033900 AAGCTGTTTTTAAAAAAACTGGG - Intronic
951544882 3:23814705-23814727 CAGCTGTTATTTATAGCCCAGGG + Intronic
953331458 3:42057003-42057025 CAGCTGCCATGAATAGAACAGGG + Intronic
955379723 3:58427796-58427818 AATTTGTTATTCAAAGAACATGG + Exonic
955647415 3:61154823-61154845 AAGCTGTTTTGACAAGAACAGGG - Intronic
955655333 3:61239423-61239445 GAGCTGGTATTAATAGAATGGGG - Intronic
956398324 3:68849314-68849336 AAGTTTTCATTAATAGAATATGG + Intronic
957337276 3:78847577-78847599 AAGGTGTTATTATTTGAAAAGGG - Intronic
961081266 3:124031011-124031033 ATGCAGTAATTAATAGAATAAGG - Intergenic
962933370 3:140057997-140058019 AAGGCCTTATTAGTAGAACATGG + Intronic
963106880 3:141654881-141654903 AAACTGTTCTGAAGAGAACAGGG - Intergenic
963960983 3:151308829-151308851 AAGCTGTGATTACAAGAATAAGG - Intronic
964730309 3:159857722-159857744 TAGCTGTTATTAATATTAAAAGG - Intronic
967528440 3:190521208-190521230 AAGCTGTTATTATTTCAACCTGG - Intronic
968841320 4:3008385-3008407 TACCTGTAATTTATAGAACAAGG - Intronic
969318846 4:6398291-6398313 AAACTGTTATGAAAAGAAAATGG + Intronic
971160479 4:24128742-24128764 AAGCTGCTTTTAAGAGAAGATGG - Intergenic
971955040 4:33406753-33406775 AAGCTTTTAATCACAGAACATGG + Intergenic
972703919 4:41521906-41521928 AAGCTGTTTTTAATATTTCATGG - Intronic
972718874 4:41675773-41675795 AACCTTTTATTAATACAAAAAGG + Intronic
973886171 4:55324318-55324340 AAGATGTTATTGATAGATCATGG - Intergenic
974697625 4:65396662-65396684 AAGCTATTCATGATAGAACAGGG + Intronic
974738452 4:65972645-65972667 AAGCTGTTATTTACAAAATATGG - Intergenic
978395630 4:108276830-108276852 AAGATGTTATTATCAGAAGAGGG - Intergenic
980405464 4:132349359-132349381 AAGTAGTTATTAATAGAATGTGG - Intergenic
980573431 4:134653496-134653518 TAACTGTTATTAATATAACTGGG - Intergenic
981168758 4:141596272-141596294 AAGCTGGTAACAATAGATCATGG - Intergenic
981597116 4:146438052-146438074 AAGTTATTATTATTAAAACATGG + Intronic
982399618 4:154952669-154952691 AAGTTTTTATTAATAGAAAAAGG - Intergenic
983075287 4:163318093-163318115 AAGCTCTTACTTATAGAAGAAGG + Intergenic
984018591 4:174456213-174456235 AAGCTATGAATAATAAAACATGG + Intergenic
984147779 4:176084983-176085005 AAGCTATTATAATTAAAACAGGG - Intronic
984722172 4:182983780-182983802 AAGCTTTTATAGACAGAACACGG + Intergenic
985759841 5:1742659-1742681 AAGCTGTGATTAATATACTAAGG - Intergenic
990728118 5:58778921-58778943 ACGCTATTATTAATTGAGCAAGG - Intronic
990829871 5:59944253-59944275 AAGCTGGAATAAATAGAAAAAGG - Intronic
992347211 5:75891923-75891945 AAGCTGTTTTTAATGGACCAGGG - Intergenic
993287062 5:86012770-86012792 TAGCTGTTATGAAAAAAACATGG + Intergenic
994925346 5:106110645-106110667 AAGCTGTCATTATTTGAAGATGG - Intergenic
995251163 5:109994890-109994912 ATGCAGTTATTAATAGAATGAGG + Intergenic
995684759 5:114759956-114759978 AGGGTGTTAAAAATAGAACATGG - Intergenic
998083995 5:139301193-139301215 CAGCTGTTTGTAATAGAACCAGG + Intronic
999945317 5:156589557-156589579 AAGCAGATTTTCATAGAACATGG + Intronic
1000234114 5:159341782-159341804 AAGCTGCTTTTATTAGGACAAGG - Intergenic
1001716120 5:173817857-173817879 AAGCTGTTTTTCCTAGATCAGGG + Intergenic
1002552390 5:180005020-180005042 AAGATGATATTAATAAAATAAGG - Intronic
1004258084 6:14083351-14083373 ATGCTGAGATAAATAGAACATGG + Intergenic
1004451386 6:15750760-15750782 GAGCTGTTATCATTATAACAGGG - Intergenic
1005159838 6:22846365-22846387 AAAGTGTTATAAAAAGAACAGGG - Intergenic
1005684701 6:28242590-28242612 AAGCTGTTATTATATGGACAGGG - Intergenic
1006493650 6:34405635-34405657 AAGTTGTTATCTATAGAGCAGGG - Intronic
1007797380 6:44360967-44360989 AAACTGGTATAAATAGATCATGG + Intronic
1008166075 6:48140135-48140157 AAGATGTTATTACAACAACATGG - Intergenic
1008390277 6:50942600-50942622 AAGGTGTCAGTAATAGAAAAAGG + Intergenic
1008895803 6:56553403-56553425 AATCTGTTATTAAAAACACAAGG - Exonic
1010533768 6:76998269-76998291 AGGATGTTATTAAGAGAAAAAGG + Intergenic
1012003376 6:93682411-93682433 AAAATGTTAATAATAGCACATGG - Intergenic
1012489487 6:99765061-99765083 AAGCTTTTATTAAGACAAAAGGG + Intergenic
1012803144 6:103860388-103860410 AAGCTGATAGTAATAGCAAAGGG + Intergenic
1012804977 6:103882405-103882427 AAGCAGTTGGTAATAGAGCAAGG - Intergenic
1013326740 6:109053420-109053442 AAGCTGGTGTTAATAAAGCATGG + Intronic
1014051681 6:116962451-116962473 AAGCTTTTATTCATGGAAAATGG - Intergenic
1014304066 6:119718329-119718351 AAGCTCTTTTAAATAGAAAATGG + Intergenic
1014458696 6:121668776-121668798 AAGATGTTAATAAAAGAAGAAGG + Intergenic
1015192173 6:130483687-130483709 ATGCTGTTTTGAACAGAACATGG + Intergenic
1016121825 6:140352999-140353021 AAGGTGTGATTACAAGAACAAGG - Intergenic
1016300004 6:142619967-142619989 TAGCTGTTATTAATACGAAAAGG + Intergenic
1017478581 6:154825675-154825697 AAGCTTTTATTATTAGACCATGG + Intronic
1017850841 6:158304407-158304429 AAGCTGTAATTATTAGAAACAGG + Intronic
1019982325 7:4630552-4630574 AAGCTGGAATTCATGGAACATGG - Intergenic
1020816045 7:12907518-12907540 AAGCTGTTATTAAAAGTAATGGG + Intergenic
1021284541 7:18764014-18764036 AAACTTTTATTCATAAAACATGG + Intronic
1023210396 7:37797870-37797892 GACTTCTTATTAATAGAACAAGG + Intronic
1024230785 7:47361663-47361685 AAGCTTTTAATAATTGACCATGG - Intronic
1026645791 7:72167080-72167102 AAGCAGTTAATAATAAAAGAAGG + Intronic
1027680507 7:81214674-81214696 TAGCTGTAATCAAAAGAACAGGG + Intergenic
1029446828 7:100618040-100618062 AAGCTGTGATTAAAGGCACACGG + Intergenic
1031515214 7:122691293-122691315 AAGCAGTTAGTAATAGCAGATGG - Intronic
1032891833 7:136204642-136204664 AAGATGTTATAAATAAAATATGG - Intergenic
1033009630 7:137606897-137606919 AATCTGTGATTTCTAGAACACGG - Intronic
1033555329 7:142484035-142484057 AAGCTGTTGTTGTTAGAAGAGGG + Intergenic
1034573684 7:151979415-151979437 AAGCTGTTTTTAAGAGTAAAAGG - Intronic
1035418927 7:158711129-158711151 AAGCTGTTATTAAAAATTCACGG + Intergenic
1036079165 8:5534647-5534669 AAGATGTTAATAATACAACTGGG - Intergenic
1037406957 8:18553121-18553143 AAGCTGTTAGTAATAACACCAGG - Intronic
1037555936 8:20022482-20022504 AAGCAGCTTTTAATAGAACCTGG + Intergenic
1038113093 8:24522205-24522227 AAGCACTCATTTATAGAACACGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041200425 8:55448749-55448771 AAGCTTTGCTTCATAGAACAGGG + Intronic
1041555600 8:59151210-59151232 AAGCTGTTATCAAAAAAACCAGG - Intergenic
1043052323 8:75399151-75399173 ATACTGTAATTGATAGAACAAGG + Intergenic
1043742104 8:83827201-83827223 AAGATGTAATTAATGGAAAAAGG + Intergenic
1045546845 8:103137268-103137290 GAGCTGTAATTAAAAGAGCACGG + Intronic
1046935627 8:119882904-119882926 AGGCTGATAATACTAGAACAAGG - Intronic
1047868646 8:129057650-129057672 CAGATTTTATTAATAAAACATGG + Intergenic
1048058063 8:130887966-130887988 GAGCTATTTTTAATAGAATAGGG + Intronic
1048181516 8:132199136-132199158 AAGCTGTTTTAAATACAGCAGGG + Intronic
1048496474 8:134940001-134940023 CAGCTGTTTTGAATAGAACAGGG - Intergenic
1048541970 8:135350206-135350228 AAGCATATATTAATGGAACATGG + Intergenic
1048579721 8:135720805-135720827 AATATATTATTAATAGAGCATGG - Intergenic
1049127678 8:140806848-140806870 CATCTGTTATAAAGAGAACAGGG + Intronic
1050209750 9:3240040-3240062 AAGCTGTTCATAATATAAGATGG + Intronic
1051389533 9:16549059-16549081 AAGAGGTTATTATTAGAAAAAGG - Intronic
1052044726 9:23781079-23781101 AATCTGTTCTTAATAGATGAGGG - Intronic
1052655517 9:31353807-31353829 AAGATTTTATTAGTAAAACACGG + Intergenic
1055861833 9:80760329-80760351 GAACTTTTATTAACAGAACAGGG + Intergenic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1060065909 9:120500989-120501011 CATCTATTATTAATAGAACCCGG - Intronic
1060244504 9:121933079-121933101 AAGTGGTGATTAATATAACACGG + Intronic
1060563777 9:124570612-124570634 AAGCTGTTATTTGTAATACAAGG + Intronic
1061471234 9:130827507-130827529 AACCTGATATTAATAGATAAAGG + Intronic
1061499637 9:130994408-130994430 AAGCTGTTAATAACAACACAAGG - Intergenic
1186537042 X:10360604-10360626 AAGATGTTTTTAATAGAAAAAGG - Intergenic
1188164416 X:26844469-26844491 AAAATATTATTAAGAGAACAGGG - Intergenic
1188173418 X:26957467-26957489 TAGTTCTTATTAATAGAAGAAGG - Intergenic
1190512645 X:51189847-51189869 AAGGTGTTATTAATATGAGAGGG + Intergenic
1193682035 X:84533494-84533516 AAGCTGTTAATTATAAAAAAGGG - Intergenic
1193990662 X:88302728-88302750 AAGATGTTATTAATATTACTTGG - Intergenic
1194486184 X:94490149-94490171 AAGATTTTATTAAGAAAACAGGG + Intergenic
1195426614 X:104739610-104739632 AAACTGTTATGGAGAGAACAGGG + Intronic
1197889405 X:131253271-131253293 AAGATGTTAGAAAAAGAACAAGG - Intergenic
1198396108 X:136220870-136220892 AAGCTGGTATTTCTAGAAGATGG - Exonic
1198475442 X:136992582-136992604 AAGGTGTGAGTAATAGACCATGG - Intergenic
1200945793 Y:8835667-8835689 AAGCTTATATTGATAAAACATGG - Intergenic