ID: 1108423700

View in Genome Browser
Species Human (GRCh38)
Location 13:50276721-50276743
Sequence AACCTGTACTGGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108423700_1108423705 16 Left 1108423700 13:50276721-50276743 CCCTTTGTCCTCCAGTACAGGTT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1108423705 13:50276760-50276782 TCTTAAAATTTGTGTATGTAAGG 0: 1
1: 0
2: 2
3: 43
4: 424
1108423700_1108423704 -8 Left 1108423700 13:50276721-50276743 CCCTTTGTCCTCCAGTACAGGTT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1108423704 13:50276736-50276758 TACAGGTTCTATGAGTTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108423700 Original CRISPR AACCTGTACTGGAGGACAAA GGG (reversed) Intronic
902613715 1:17612257-17612279 AACCAGTTCTGCAGGAAAAAGGG - Intronic
902712350 1:18249156-18249178 AACCTTACCTGGAGAACAAAGGG + Intronic
903779766 1:25813861-25813883 AACCTGTTCAGGAAGACAGAAGG - Exonic
904904071 1:33881349-33881371 AAACTGTTCTGTAGGAGAAAGGG + Intronic
906143331 1:43546247-43546269 ACCCAGCACTTGAGGACAAAGGG - Intronic
906420079 1:45658350-45658372 AACCTATTGTGGAGGTCAAAGGG - Intronic
908165664 1:61455288-61455310 TACCAGGACTGGAAGACAAAAGG - Exonic
912354551 1:109043888-109043910 AAAGTGTAGTGGAGGGCAAAGGG + Intergenic
915800875 1:158791908-158791930 AAACTGTGCTGTAGAACAAATGG - Intergenic
918915485 1:190631553-190631575 AACGTGCACTGTAGGCCAAATGG - Intergenic
919595359 1:199554906-199554928 AATCTGTACTATAGAACAAATGG + Intergenic
924597872 1:245463144-245463166 TACCTGTACTGGCACACAAATGG - Intronic
1062803375 10:396387-396409 AGCCTGGACTGGAGGACACCAGG + Intronic
1064446833 10:15402015-15402037 AATCTGCACTGTAGAACAAATGG + Intergenic
1065116380 10:22487147-22487169 AACCCTTACTGGAAGAAAAAGGG + Intergenic
1066142667 10:32523175-32523197 AATCTGTACTACAGAACAAATGG - Intronic
1066319749 10:34289878-34289900 AACCTGAACTGGAGGATGAATGG + Intronic
1068448073 10:57149012-57149034 AATGTGTACTGGAGACCAAATGG + Intergenic
1071076588 10:81761127-81761149 AACATGGACTTGAGGACACAGGG - Intergenic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1074988695 10:118682067-118682089 AACCTGTAATAGATGTCAAAGGG + Exonic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1082020912 11:47532399-47532421 CCCCTGTACTGGAGTTCAAAGGG - Intronic
1086249108 11:84793414-84793436 AACCTGCACTTTAGGACAAATGG - Intronic
1086489676 11:87346600-87346622 TACCTGTACTCCAGGACAACAGG - Intergenic
1086864420 11:91962264-91962286 AAACTATACTGTAGAACAAATGG + Intergenic
1087262958 11:96031207-96031229 AACGTGTAATGCAGGAGAAAAGG - Intronic
1087392078 11:97548628-97548650 AACCTGCACTGCAGATCAAATGG + Intergenic
1089655256 11:119942436-119942458 CACCTGGACTGGAGGAATAAAGG - Intergenic
1091427113 12:400809-400831 AGCCTGTGCTGTAGGAAAAATGG + Intronic
1093568947 12:20643649-20643671 AACCTGTACTCGAAAGCAAAAGG + Intronic
1096713906 12:53479294-53479316 AACCAGTGCTGGAGTACCAAGGG - Intronic
1097898239 12:64847893-64847915 AATCTGTACTATAGAACAAATGG - Intronic
1100839971 12:98602993-98603015 TACCTGTGCTGCAGGAAAAAAGG + Intronic
1100914661 12:99406148-99406170 AATCTGTACTATAGGTCAAATGG + Intronic
1101052551 12:100878403-100878425 ATCAGGTACTTGAGGACAAATGG - Intronic
1106212830 13:27666770-27666792 AACCAATACTGGGGGAAAAAAGG - Intronic
1106244175 13:27933228-27933250 CCACTGGACTGGAGGACAAAGGG - Intergenic
1106949292 13:34864917-34864939 AACCTGTACTTGGGGACAAAGGG - Intergenic
1108224842 13:48278097-48278119 AATCTGTAATGGAGGACATTGGG + Intergenic
1108423700 13:50276721-50276743 AACCTGTACTGGAGGACAAAGGG - Intronic
1110917239 13:81036724-81036746 AACCTGCACTATAGGCCAAATGG + Intergenic
1112944366 13:104908777-104908799 AACCTGCACTAAAGAACAAATGG - Intergenic
1114998431 14:28389930-28389952 AAACTGGACTTGAGGCCAAATGG - Intergenic
1117510772 14:56448714-56448736 CACTTGTAGTGGAAGACAAAGGG - Intergenic
1119643399 14:76330772-76330794 ATCCTGGGCTTGAGGACAAAGGG + Intronic
1120431066 14:84416574-84416596 AAACTGTACTGTAGACCAAATGG - Intergenic
1121130645 14:91443192-91443214 AATCTGCACTGTAGAACAAATGG + Intergenic
1121224453 14:92311069-92311091 AGCCTGGGCTGGAGGGCAAAAGG + Intergenic
1123830265 15:24128918-24128940 AAACTGTTCTGGAAGCCAAAAGG + Intergenic
1124129303 15:26970902-26970924 AACCTGCACTGGGGTAGAAATGG + Intergenic
1126182229 15:45796826-45796848 AAACTGTACTGAAAGTCAAAGGG - Intergenic
1127019040 15:54724828-54724850 AATCTGTACTATAGAACAAATGG - Intergenic
1127483420 15:59398022-59398044 AACTTGCACTGGAGGAGAAATGG + Intronic
1128014790 15:64334049-64334071 AAACTGCACTTGAGAACAAATGG + Intronic
1130693893 15:86110875-86110897 AACCTCTGCTGGAGGAGAAAGGG - Intergenic
1135902091 16:26470271-26470293 AAGCTGCACTGTAGCACAAATGG + Intergenic
1136525632 16:30828145-30828167 ATCCTGTGCTAGAGGAGAAATGG + Intergenic
1138024115 16:53509496-53509518 ACTCTATCCTGGAGGACAAAGGG - Intergenic
1139528330 16:67529617-67529639 ACCCTGGAGAGGAGGACAAAGGG - Exonic
1139729983 16:68935198-68935220 ATCCTGTACTACAGGACAAGTGG - Intronic
1140754084 16:78051938-78051960 TACCTGGAGTGGAGGATAAACGG - Intronic
1142539934 17:650666-650688 AAGCTTTGCTGGAGGGCAAATGG + Intronic
1143981507 17:10874073-10874095 AACATAAACTGGTGGACAAAGGG + Intergenic
1145057448 17:19712809-19712831 ACCCAGTCCTGGAGGACACAGGG - Intronic
1146215552 17:30976466-30976488 AATCTGTACTGTAGATCAAATGG - Intronic
1147708000 17:42441111-42441133 AAACTGTACTGAAGGAGAAGTGG + Intergenic
1151916597 17:77122844-77122866 AACCTGTGATGGAGGAGACACGG - Intronic
1155411150 18:25546562-25546584 AATCTGCACTGTAGAACAAATGG + Intergenic
1158533700 18:58287391-58287413 AGCCTATACTAGAAGACAAACGG - Intronic
1158948769 18:62472393-62472415 AATCTGCACTGTAGAACAAATGG - Intergenic
1159607454 18:70489806-70489828 AATCTGTCCTGGAAGCCAAATGG + Intergenic
1159648479 18:70948579-70948601 AATCTGCACTGTAGGCCAAATGG + Intergenic
1161609092 19:5231213-5231235 AACCTGGGCTGGTGGTCAAAGGG - Intronic
1168333300 19:55581787-55581809 AACCTATTCTGGAGCAGAAAAGG + Intergenic
926478896 2:13363412-13363434 AATGTGTACTGTAGAACAAATGG + Intergenic
927897515 2:26793414-26793436 AACCTTTACTAGAGAACAAAGGG - Intronic
928194464 2:29205122-29205144 AACCATAAATGGAGGACAAAAGG - Intronic
930865995 2:56122257-56122279 AACCTTTTATGGTGGACAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
935709417 2:105884193-105884215 GACCTGTCCTGGTGGACAAGTGG + Intronic
935805349 2:106741391-106741413 AACCTGTATTTGGGGATAAAAGG + Intergenic
936824899 2:116570274-116570296 AATCTGCACTGTAGGCCAAATGG - Intergenic
940795695 2:158075250-158075272 AATCTGTACTGTAGAACAAATGG + Intronic
941470179 2:165874623-165874645 AACCTCTGCTGGAGAAAAAAGGG + Exonic
941788994 2:169530058-169530080 AACCTCTACTGGAAGCCAAGTGG + Intronic
942624867 2:177889227-177889249 CTCCTGTGCTGGAGGACAATGGG - Intronic
945743379 2:213690638-213690660 TACCTGCACTGGCAGACAAATGG - Intronic
947017657 2:225639117-225639139 AACCTGTTCTGGGGGAGCAAAGG - Intronic
947517437 2:230818835-230818857 AACCTGGACTGAAAAACAAAAGG - Exonic
1169947395 20:11003747-11003769 AACTTGTACTGCAAGACAACAGG + Intergenic
1170661597 20:18346393-18346415 AAACTGTACTGAAGGAAGAAGGG + Intergenic
1172450707 20:35020698-35020720 AACCTACAGTGGAGGAAAAAGGG - Intronic
1177024003 21:15898990-15899012 AATTTGTACTGTAGGCCAAATGG + Intergenic
1179962951 21:44781159-44781181 AACCTGAAGTGGATGACTAAGGG + Intronic
1180185394 21:46136789-46136811 AAACTTTACTGGAGGTCACATGG + Intronic
1181028011 22:20136766-20136788 AACCTGTTCTGGTGCACAGAAGG - Intronic
1181990288 22:26832018-26832040 GACCTGAACTGGTAGACAAAAGG + Intergenic
1184833444 22:47006199-47006221 AACCTCTCCTGGAGGAGACAGGG - Intronic
950685815 3:14618050-14618072 AACCGGTAAGGGAGGAGAAAAGG + Intergenic
954471828 3:50704286-50704308 AACCTGCACTATAGAACAAATGG - Intronic
956173264 3:66449850-66449872 AACTTGAACTCGTGGACAAACGG + Intronic
957377368 3:79375841-79375863 AACCTGTTCTGGGCAACAAAAGG + Intronic
957622171 3:82607627-82607649 AACCTGCACTGTAGACCAAATGG + Intergenic
960607275 3:119519740-119519762 AAACTGTACTGTAGATCAAATGG + Intronic
961021515 3:123511492-123511514 AACATTTATTGGAGGACTAATGG - Intronic
962644483 3:137422788-137422810 AAACTGTACTTTAGAACAAATGG + Intergenic
963514849 3:146295649-146295671 AAGCAGTACTGTAGAACAAATGG - Intergenic
966151514 3:176872285-176872307 AATCTGTACTGTAGACCAAATGG + Intergenic
967455817 3:189685323-189685345 AACCTGCAATGCAGGGCAAAGGG - Intronic
971105183 4:23516850-23516872 AAGCTGCACTGTAGAACAAATGG - Intergenic
971736112 4:30454710-30454732 AACATGAACTGGATGACAACAGG + Intergenic
974337360 4:60567158-60567180 AATCTGTACTGTAGACCAAATGG - Intergenic
975544884 4:75550218-75550240 AACCTGTTGTGGAGGACATCAGG + Intronic
977762981 4:100761509-100761531 AAACTGTACCCTAGGACAAATGG + Intronic
977923806 4:102675557-102675579 AACCTACACAGGAGCACAAAAGG + Intronic
978214276 4:106179753-106179775 AAACTGTACTGTAGACCAAATGG - Intronic
978619512 4:110624406-110624428 GACCTATGCTGGGGGACAAAAGG - Intronic
979470064 4:121084968-121084990 TCCCTGTCCTGGAGCACAAAGGG - Intergenic
985310094 4:188588495-188588517 AAATTGGACTGGAGGACAAAGGG + Intergenic
988148228 5:27338951-27338973 AAACTATACTGTAGCACAAATGG + Intergenic
988674879 5:33422324-33422346 AACCTGTTCTCGAAGACACAAGG + Intergenic
989202343 5:38776120-38776142 AAACAATACTGCAGGACAAATGG + Intergenic
989324299 5:40173079-40173101 AGCCTCTATTGGAGGACTAAGGG - Intergenic
989543783 5:42648466-42648488 CACATGTATTGGAGGATAAAAGG + Intronic
991339186 5:65587233-65587255 AGGCTGTGTTGGAGGACAAATGG - Exonic
993773937 5:91967277-91967299 AACTTGTACTGAAATACAAATGG + Intergenic
995240866 5:109884526-109884548 AGCCTGTACAGGAGGACGGAGGG + Exonic
996764678 5:127023918-127023940 CACCTGCATTGGATGACAAAAGG + Intronic
997180304 5:131821509-131821531 AATCTGCACTGTAGAACAAATGG - Intronic
1001624882 5:173123457-173123479 AACCTTTCATGGAGGACAAAAGG + Intronic
1004563110 6:16770251-16770273 AAACTGTAAGGGAGGTCAAATGG - Intergenic
1005112735 6:22301688-22301710 AAAATGTATTGGAGGATAAAGGG - Intergenic
1005501110 6:26430006-26430028 ACACTGTCCTGGAGGATAAAGGG - Intergenic
1005505663 6:26467154-26467176 ACACTGTCCTGGAGGATAAAGGG - Intronic
1005611653 6:27531584-27531606 GTCCTTTACTGGAGGTCAAAGGG + Intergenic
1006875047 6:37288283-37288305 AAACTGTATGGGAGGATAAAGGG - Intronic
1009603151 6:65829746-65829768 AACATGTAATGGAGGACACCAGG - Intergenic
1009624618 6:66124034-66124056 AAACTGTACTCCAGGACAAATGG - Intergenic
1009745132 6:67802964-67802986 AATCTGCACTGAAGGTCAAATGG + Intergenic
1009800034 6:68525646-68525668 AAACTGTACCCTAGGACAAATGG - Intergenic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1011698318 6:89932926-89932948 AGCCTGAACTGGAGGACAGAAGG + Intronic
1015148795 6:130017260-130017282 AACATGTACTCCAGAACAAACGG - Intronic
1017529767 6:155277914-155277936 AACTTTTACTGTAGGACTAAAGG - Intronic
1018662280 6:166099258-166099280 AACCTGTCCTGGTGCCCAAAAGG - Intergenic
1019226021 6:170510204-170510226 AACCTGTGCTGGAGAACTGAGGG + Intergenic
1020422802 7:8028087-8028109 AATCTGCACTGTAGAACAAATGG + Intronic
1020915851 7:14191667-14191689 AAACTCTTCTGGGGGACAAAGGG + Intronic
1021578989 7:22132686-22132708 AACCTGTAATGCAGGGGAAATGG - Intronic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1024368804 7:48556316-48556338 AATCTGTACTATAGAACAAATGG - Intronic
1026509107 7:71013259-71013281 AACCTATTTTGGAGGACAAGGGG + Intergenic
1028036978 7:85996688-85996710 AATCTGCACTGTAGAACAAAGGG - Intergenic
1028323761 7:89496411-89496433 AAATTATACTGGAGGACCAAGGG - Intergenic
1028783097 7:94759579-94759601 AAACTATACTGTAGAACAAATGG + Intergenic
1030471461 7:109968469-109968491 AACCTATACTGTAGACCAAAAGG + Intergenic
1031553251 7:123141423-123141445 AATCTGTACTACAGGCCAAATGG - Intronic
1032336588 7:131030452-131030474 ACCTGGTGCTGGAGGACAAAGGG + Intergenic
1033833457 7:145281297-145281319 AATCTGTACTGTAGACCAAATGG - Intergenic
1033963144 7:146938989-146939011 AGCCTTTACTGTAGGACAAATGG + Intronic
1035139347 7:156741774-156741796 AATCTGTACTGTACAACAAATGG + Intronic
1035480326 7:159176853-159176875 AATCTATACTGCAGGAAAAATGG + Intergenic
1039163207 8:34645914-34645936 TACTTGTACCGGAGGACATATGG + Intergenic
1041364192 8:57083692-57083714 ACCCAGTAGTGGAAGACAAAGGG + Intergenic
1041644195 8:60234900-60234922 AACCTCTACTGGTGTAGAAAGGG - Intronic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1045552448 8:103184585-103184607 AGCATGGACTGGAGGACAGATGG - Intronic
1046233162 8:111384954-111384976 AACCTGTACTCTAGAACAAATGG - Intergenic
1046716824 8:117577091-117577113 AACCTGTACTGAAGGACAAGTGG + Intergenic
1046951121 8:120020575-120020597 AACATGGGCTGGAAGACAAAGGG - Intronic
1051029964 9:12661629-12661651 AATCTGTACTGTAGACCAAATGG + Intergenic
1052275122 9:26666761-26666783 AACTATAACTGGAGGACAAAAGG + Intergenic
1055112483 9:72573486-72573508 GACCTGGAATGAAGGACAAAAGG + Intronic
1055564500 9:77554770-77554792 ACCCTGTGCTGGAAGCCAAATGG + Intronic
1056079356 9:83074757-83074779 ACCCTGCACTGTAGGAAAAAGGG + Intergenic
1056379249 9:86042133-86042155 AACTTGAACTGGAGGACACTCGG + Intronic
1056592415 9:87974268-87974290 AAACTGTACTGGATGTAAAAAGG + Intronic
1059410766 9:114130888-114130910 AACCAGTACTGGAGGGGGAAGGG - Intergenic
1061638569 9:131931972-131931994 AACCTGGACTACAGAACAAATGG + Intronic
1188269967 X:28127245-28127267 GAACAGTACTGGAGGACAATAGG - Intergenic
1188874506 X:35413471-35413493 AACATGCTCTGGAAGACAAATGG - Intergenic
1189756663 X:44278778-44278800 AACTGTGACTGGAGGACAAAAGG - Intronic
1191102295 X:56744341-56744363 AATCTGTACTGTAGACCAAATGG - Intergenic
1191198839 X:57755361-57755383 AATCTGGACTAGAGGACAAATGG + Intergenic
1191223078 X:58012083-58012105 AAACTGTACTCCAGGACAAATGG - Intergenic
1192413003 X:70951545-70951567 TCCCTGTCCTTGAGGACAAATGG + Intergenic
1192904090 X:75531634-75531656 AAACTGTACTCTAGAACAAATGG - Intergenic
1193120437 X:77817726-77817748 AACATGTACTGAAGAACAGAGGG + Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1193933554 X:87586253-87586275 AATCTGCACTGAAGAACAAATGG + Intronic
1194083340 X:89495896-89495918 AATCTGCACTGCAGAACAAATGG - Intergenic
1194165937 X:90515978-90516000 AATCTGCACTGTAGAACAAATGG + Intergenic
1194272759 X:91838691-91838713 ATCCTATTCTGCAGGACAAAGGG - Intronic
1194338455 X:92679357-92679379 AATCTGTACTATAGAACAAATGG - Intergenic
1194546623 X:95242804-95242826 AACCTGCACTGTAGACCAAATGG + Intergenic
1195245657 X:102992824-102992846 AAACAGTATTGGAGGAGAAAGGG + Intergenic
1195896974 X:109755374-109755396 AATCTGTACAGTAGGCCAAACGG + Intergenic
1197078044 X:122376796-122376818 AATCTGCACTGTAGAACAAATGG - Intergenic
1197435425 X:126422318-126422340 AATCTGTACTGTAAAACAAATGG - Intergenic
1197452320 X:126635118-126635140 AATCTGCACTGTAGAACAAATGG - Intergenic
1199016626 X:142823855-142823877 AACCTTTACTCAAGAACAAAAGG + Intergenic
1199104346 X:143845043-143845065 AAACTGTACTTGAGACCAAATGG - Intergenic
1199837375 X:151605409-151605431 AGCCAGTACTGAAGGAGAAAAGG - Intronic
1200435992 Y:3151771-3151793 AATCTGCACTGCAGAACAAATGG - Intergenic
1200589999 Y:5060105-5060127 ATCCTATTCTGCAGGACAAAGGG - Intronic
1200643948 Y:5758217-5758239 AACCTGTACTCTAGAACAACTGG - Intergenic
1200646859 Y:5796140-5796162 AATCTGTACTATAGAACAAATGG - Intergenic