ID: 1108423775

View in Genome Browser
Species Human (GRCh38)
Location 13:50277408-50277430
Sequence TTGTAGATGAAGAAAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 450}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108423764_1108423775 21 Left 1108423764 13:50277364-50277386 CCTTGGGCTAACGTCCACACCAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423769_1108423775 -2 Left 1108423769 13:50277387-50277409 CCTGCCAGGCCCATTTTCCTGTT 0: 1
1: 0
2: 1
3: 27
4: 243
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423763_1108423775 22 Left 1108423763 13:50277363-50277385 CCCTTGGGCTAACGTCCACACCA 0: 1
1: 0
2: 0
3: 8
4: 56
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423770_1108423775 -6 Left 1108423770 13:50277391-50277413 CCAGGCCCATTTTCCTGTTGTAG 0: 1
1: 0
2: 2
3: 17
4: 274
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423766_1108423775 7 Left 1108423766 13:50277378-50277400 CCACACCACCCTGCCAGGCCCAT 0: 1
1: 0
2: 5
3: 82
4: 899
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423767_1108423775 2 Left 1108423767 13:50277383-50277405 CCACCCTGCCAGGCCCATTTTCC 0: 1
1: 0
2: 10
3: 214
4: 2075
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450
1108423768_1108423775 -1 Left 1108423768 13:50277386-50277408 CCCTGCCAGGCCCATTTTCCTGT 0: 1
1: 0
2: 10
3: 138
4: 1801
Right 1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108423775 Original CRISPR TTGTAGATGAAGAAAGAGCA GGG Intronic
900894967 1:5476999-5477021 TTGTGGAAGATGGAAGAGCAAGG + Intergenic
900938658 1:5783325-5783347 TTGTAGATGAAGAGACAGAGGGG - Intergenic
902322685 1:15679676-15679698 TGGTAGAAGAAGAAACAGCATGG + Intergenic
902720384 1:18300463-18300485 TTGAAGATGATGAAATAGCCAGG + Intronic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
905341044 1:37277716-37277738 TTGTAGAGGAAGGGAGAGAATGG - Intergenic
907222117 1:52914720-52914742 TTGTAGGTGAGGTAAGAGCGAGG - Intronic
907829364 1:58049589-58049611 TTGGAATAGAAGAAAGAGCATGG + Intronic
908589730 1:65617452-65617474 TAGAAAATGAAGAAAGACCAGGG + Intronic
908601642 1:65745517-65745539 TTGAAGATGAAGGGAAAGCAAGG - Intergenic
909070885 1:70992184-70992206 ATCTGGATGAATAAAGAGCAGGG - Intronic
909878559 1:80843292-80843314 TTCTAAATGAAGAAAGAAAATGG - Intergenic
910693420 1:89987774-89987796 CTCTAGATGGAGAAAGACCATGG - Intergenic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
911805041 1:102195131-102195153 TTTCACATGAGGAAAGAGCAAGG - Intergenic
911820584 1:102414945-102414967 TTGTAGATGGAGAAAGAAGTAGG + Intergenic
911949234 1:104151823-104151845 TTCGAAATGAAGAAAGAGAATGG - Intergenic
912023749 1:105140101-105140123 TGGTTGAAGTAGAAAGAGCAAGG - Intergenic
912677957 1:111703360-111703382 TTGTATATGAAGAACGGCCAAGG + Exonic
912957064 1:114162315-114162337 TTGTATATGGTGAAAGAGAAGGG - Intergenic
913232068 1:116748183-116748205 TTACAGATTAAGAAAGACCAAGG - Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
915862999 1:159467075-159467097 TTATAGAAGAAGATAAAGCAGGG - Intergenic
915983501 1:160439159-160439181 TAATGGAGGAAGAAAGAGCATGG - Intergenic
917266358 1:173224798-173224820 GAGCAGATGAAGAGAGAGCATGG + Intergenic
917938362 1:179891859-179891881 TTCTAAATGAAGAAAGGGCCAGG - Intronic
918310754 1:183283597-183283619 TTGTAGATGAAGAAACAGAGAGG - Intronic
920548302 1:206837108-206837130 TTGGAGATTAGGAAAGAGAAGGG - Intronic
920733182 1:208507909-208507931 GGGTGGATGATGAAAGAGCATGG + Intergenic
921673155 1:217948792-217948814 TTGTAGATGAATGAACAACATGG - Intergenic
921693129 1:218176334-218176356 TTCTTGATGAAGGAGGAGCAAGG - Intergenic
922537093 1:226389428-226389450 TTATGGATGAGGAAAGTGCAAGG - Intronic
922923601 1:229329508-229329530 TTGGAGATGAAGAATCATCATGG + Intronic
924370597 1:243345712-243345734 TTCTAGAGGAAAAAAGATCAGGG + Intronic
924376026 1:243410175-243410197 TGGTAGCTGAAAATAGAGCATGG + Intronic
1063210928 10:3880676-3880698 TGGTGCATGAAGAAAGATCATGG + Intergenic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1067361529 10:45584830-45584852 TTGAAGATGAAGAAAGAAAGAGG + Intronic
1068064192 10:52108428-52108450 TTGAATATGAAACAAGAGCAGGG - Intronic
1068238781 10:54275695-54275717 TTGAAGAGGATAAAAGAGCAAGG + Intronic
1072501492 10:96022757-96022779 TTCTAGAGGAAGAAACAGAAGGG + Intronic
1072730531 10:97842928-97842950 AGGGAGATGAAGAAAAAGCAGGG - Intergenic
1073166989 10:101463681-101463703 TTATAGATGAAGAAAATGGAGGG + Intronic
1073931135 10:108578419-108578441 TTTATGATGAAGAAACAGCATGG + Intergenic
1074252396 10:111764238-111764260 TTGTAAATGCAGAAAGACCTGGG - Intergenic
1077143727 11:1035809-1035831 TTGGAGAGGAAGGAGGAGCACGG + Intronic
1077792413 11:5455520-5455542 TTGTAGATCAAAAGAGAGCGAGG + Intronic
1077933526 11:6758608-6758630 TTCTAGATGCAGGAAGGGCAAGG - Intergenic
1078188644 11:9073722-9073744 CTTTAGCTTAAGAAAGAGCAGGG + Intronic
1079247549 11:18763921-18763943 GTGTGGAGGAAGAAAGAGCATGG - Intronic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1079405991 11:20146186-20146208 TTGTAGAGAAAGAAGGAGCAAGG + Intergenic
1079559198 11:21801856-21801878 TTGTTGTTGTAGAGAGAGCAGGG + Intergenic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1081180547 11:39980933-39980955 TTGTATATGATGAAAAAGAAGGG + Intergenic
1081248985 11:40805881-40805903 ATGTTCATCAAGAAAGAGCATGG + Intronic
1081467149 11:43331565-43331587 TAGTAGGTGGAGAAAGAGGAGGG + Intronic
1082980099 11:59113355-59113377 TGGTGGATGAAGGCAGAGCAGGG + Intronic
1084913246 11:72408365-72408387 TGGTAGATCAAGAAAGAACCGGG + Intronic
1086047963 11:82555154-82555176 GTGTTGCTGCAGAAAGAGCATGG + Intergenic
1086992584 11:93320726-93320748 TTGTGAAAGAAGAAAGATCAAGG - Intergenic
1088353323 11:108914010-108914032 TTGTAGGTCAGGAAATAGCAAGG + Intronic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089917987 11:122177640-122177662 GGGTAGATGAAGAAAGAGTGTGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090703573 11:129316663-129316685 TTGGAGATAAAGGAAGAGTAAGG + Intergenic
1090775759 11:129963949-129963971 TGGCAGACCAAGAAAGAGCAGGG - Intronic
1090944177 11:131414753-131414775 TTGTAAATGAAGAAATAGGCAGG - Intronic
1090980864 11:131720506-131720528 TTGTAGGTGATGAAAGAGGCAGG + Intronic
1091352820 11:134911305-134911327 TTTTGGTTGAGGAAAGAGCAAGG + Intergenic
1091990382 12:4950537-4950559 TTGTAAATGAAGCAAAAACATGG + Intergenic
1092067425 12:5603493-5603515 TGGTAGAAGAAGAAAGAGAAAGG + Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092756063 12:11764609-11764631 TTGCAGATGTATAAAGGGCATGG + Intronic
1093380245 12:18482640-18482662 GTGAACATGAAGAAAAAGCAAGG - Intronic
1093575325 12:20721045-20721067 TTGTGGATGAACAAAGTGAATGG + Intronic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094524821 12:31224651-31224673 TTGAAGATGTGGGAAGAGCAGGG + Intergenic
1095043553 12:37472260-37472282 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1095259034 12:40077324-40077346 TTGTATATGAAGAAAGGAAAGGG + Intronic
1097092804 12:56520852-56520874 TTAAAGATGAGGAAATAGCAGGG + Intergenic
1097307102 12:58081435-58081457 TGGTAGAAGAAAAAAGAGCATGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098823859 12:75268984-75269006 TTGTAGATGAAGACAGAATCAGG - Intergenic
1099135277 12:78890337-78890359 TTTTAGATCAAGAAACAACAGGG + Intronic
1099383601 12:81986310-81986332 TTATTGATGAAGAAAGACGATGG + Intergenic
1099491915 12:83299249-83299271 TTCTACCTGAAGAAAGAGAAGGG + Intergenic
1100717396 12:97320522-97320544 TTGTAGCTGAAGAAATATTAAGG + Intergenic
1101160407 12:101968270-101968292 ATATAGATGAAAAAAGAACAAGG + Intronic
1102424131 12:112827514-112827536 GGGTAGATGGAGAAAGACCAAGG + Intronic
1102461433 12:113102086-113102108 TTTTACAGGAAGAAGGAGCACGG - Intronic
1103138675 12:118529726-118529748 TTGTTGAAGAAGAAAAAGAAGGG - Intergenic
1104264485 12:127218879-127218901 TTGAAGAGAGAGAAAGAGCATGG + Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105269081 13:18854080-18854102 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1106562632 13:30859829-30859851 TCGTAGGTGCTGAAAGAGCATGG + Intergenic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107649466 13:42529615-42529637 TAGTAAATGTAGAAGGAGCAAGG - Intergenic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1108552945 13:51564714-51564736 CTACAGATGAAGAAAGGGCAGGG + Intergenic
1108771580 13:53708373-53708395 TTTTAGAGAAAGAAAGAGTAGGG - Intergenic
1108872778 13:55006747-55006769 TTGTAGAAAAACAAAGAGCTTGG + Intergenic
1109199438 13:59414033-59414055 ATGGATATGAAGAAAGATCACGG + Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1110079784 13:71295677-71295699 TGGTAAATGAAGAAAGAAAATGG - Intergenic
1110322091 13:74172189-74172211 TTGTAGATGAAGACAGCACTGGG - Intergenic
1110726809 13:78835113-78835135 AGGCTGATGAAGAAAGAGCAAGG + Intergenic
1111257292 13:85687053-85687075 TTCTAGAAGAAGAAAATGCATGG + Intergenic
1111799203 13:92961189-92961211 TGGAAGGTGAAGGAAGAGCAAGG + Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1112704218 13:102048179-102048201 TGGTAGATGAGGAAACAGCATGG + Intronic
1113078731 13:106493697-106493719 TAGAAGATGAAGCAAGATCAAGG - Intronic
1115462397 14:33676067-33676089 TTGAAGATGAAGACAGAACCAGG + Intronic
1115725441 14:36210550-36210572 ATGTAGAGTAAGAAAGAGAAGGG + Intergenic
1115886354 14:37976070-37976092 TAATATATGAAGAAAGAGCAAGG + Intronic
1117229385 14:53700137-53700159 TTGAAGATCAAGAAAGAAAAGGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117311482 14:54528125-54528147 TAGTAAATGAAAAAAAAGCAAGG - Intronic
1117334454 14:54745017-54745039 TTGAAGATCAGGGAAGAGCAGGG - Intronic
1117380998 14:55162769-55162791 TTGCCTTTGAAGAAAGAGCAAGG - Intronic
1117618481 14:57559322-57559344 TTGTAGGTGAAATAAGAACAGGG - Intergenic
1118108254 14:62686049-62686071 TTGGAGATGAAGAAAGATTCTGG - Intergenic
1119417519 14:74483175-74483197 TTGTATATGAAGAATGGCCAAGG + Intronic
1119441695 14:74632657-74632679 TTGTACATTAAAAAAGAGTAAGG - Intergenic
1121497828 14:94409077-94409099 TTATGGAAGAAGAGAGAGCAAGG + Intergenic
1121506104 14:94478770-94478792 GAGTAGAGGAAGAAACAGCAGGG - Intronic
1122036642 14:98953908-98953930 TTGATGCTGAAGAAAGAGCTGGG - Intergenic
1202830226 14_GL000009v2_random:19908-19930 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1202942090 14_KI270725v1_random:159853-159875 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1125349022 15:38748265-38748287 GAGTGGATGAAGAAAGAACAAGG - Intergenic
1125682643 15:41541876-41541898 AAGTAGATGAAGAAAAAGTAAGG - Intronic
1126515991 15:49538560-49538582 TTTCAGATGAAGAGAGAGAAAGG - Intronic
1127358362 15:58223482-58223504 TTCTAGAAAAAGAAAGAGAAAGG - Intronic
1128488677 15:68123531-68123553 TAGTAGATTAAGAAACAACATGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129106346 15:73310132-73310154 TGGTAGATGAAAAAAGAGGTTGG + Intergenic
1129522503 15:76194716-76194738 GTGCAGATGAAGGCAGAGCAGGG - Intronic
1130585690 15:85180072-85180094 TTGTAGAGAAAAAAAGGGCAAGG + Intergenic
1131139926 15:89968617-89968639 TAATAGAAGAAGAAAGAGCCAGG + Intergenic
1131639104 15:94270589-94270611 GGGGAGATGGAGAAAGAGCAAGG - Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132390003 15:101431647-101431669 TTGCAGGTGCAGAAAAAGCAAGG - Intronic
1133478867 16:6150081-6150103 TGGTAGATGATGAAAAATCATGG + Intronic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1136254321 16:29028343-29028365 GTGAGGACGAAGAAAGAGCAGGG - Intergenic
1137405891 16:48189076-48189098 TTTTAGAGGCAGAAAAAGCAAGG - Intronic
1140906879 16:79416610-79416632 TTACAGATGAAGAAATAGAAAGG + Intergenic
1141760343 16:86025048-86025070 TGGTAGAAGAAGAGAGAGAAAGG + Intergenic
1142936316 17:3335735-3335757 TTATAGATGAAGAAAGCCCCAGG + Intergenic
1143917676 17:10305807-10305829 TCCCAGATAAAGAAAGAGCAGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146583187 17:34058367-34058389 TTATAGATGAAGAAACAGCCTGG + Intronic
1146587862 17:34098088-34098110 TTGGAGCTGAAGAAAAATCATGG + Intronic
1148204705 17:45772815-45772837 TGGTAGATGATGAATGTGCATGG + Intergenic
1148224846 17:45892169-45892191 TGGTGGGTGAAGAAAGAACAAGG + Intergenic
1148774274 17:50086741-50086763 TTGTAGGGGAAGAAAAAGAATGG + Intronic
1149408053 17:56375156-56375178 TTGGAGGTCAGGAAAGAGCAAGG + Intronic
1149422138 17:56521384-56521406 TGGTAGTTGAAAAAAGAGAAAGG + Intergenic
1150854447 17:68737610-68737632 TTGTAGGTTAAGAAAAAGGATGG - Intergenic
1150963814 17:69944749-69944771 TTCTAGAAGAAGAAACAGGAAGG + Intergenic
1153687461 18:7560749-7560771 TTGTAGATGGAGAAATACTAAGG + Intergenic
1154475546 18:14752458-14752480 TTGAAGGTAGAGAAAGAGCATGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1156278276 18:35606162-35606184 TTGTAGAAGGAAAGAGAGCAGGG + Intronic
1156549637 18:38002132-38002154 TCATAGATGAACAAAGAGCCAGG + Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157068956 18:44383689-44383711 TTCAAGATGATGAAACAGCACGG + Intergenic
1157147400 18:45177877-45177899 TTTTAGATGAAGGCAGAGTAAGG + Intergenic
1157543075 18:48525907-48525929 TTGGTGAGGAAGAAGGAGCATGG - Intergenic
1158879948 18:61768511-61768533 TGGAAGATGAAGGAGGAGCAAGG - Intergenic
1159652789 18:70997402-70997424 ATGTGGATGAATAAAGAGCAGGG + Intergenic
1162584986 19:11553096-11553118 TTGTAGAGGAAGCAAGGGCTGGG - Exonic
1162615168 19:11793901-11793923 TTGTATATGGAGAGAGATCAGGG + Intergenic
1166153049 19:40888493-40888515 GTGGAGATGAACAAAGAGAAAGG - Intronic
1167254692 19:48419986-48420008 TTGTGGATGAAGAAAGAACACGG + Intronic
1167572433 19:50297396-50297418 CTACAGATGAAGAAACAGCAGGG - Intronic
1202642465 1_KI270706v1_random:107864-107886 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926582093 2:14641921-14641943 TTGTAGTTGAAGAGAGAGTCTGG - Intronic
927334060 2:21900005-21900027 TTTTAAATGAACAAAAAGCAAGG + Intergenic
928070021 2:28205553-28205575 TTACAGATGAAGAAAGCACAGGG + Intronic
928659739 2:33489843-33489865 TTGTTGATGAGGACAGAACAAGG + Intronic
928691370 2:33802800-33802822 TTGTAGATGAAGAAATCGACAGG - Intergenic
929250027 2:39743134-39743156 TTTTAGATGGAGAAAAATCAGGG - Intronic
929427327 2:41856531-41856553 TGGAAGGTGAAGGAAGAGCAAGG - Intergenic
929727345 2:44444751-44444773 TTTTAGGGGAAGTAAGAGCATGG + Intronic
929874406 2:45784595-45784617 TTTTAGATAAAGTAAGAACAGGG + Intronic
930146692 2:48014303-48014325 TAGTACATGGAGAAAAAGCAAGG + Intergenic
930292156 2:49508680-49508702 GTGAAGATGAAGGAAGAGCAAGG - Intergenic
931610570 2:64095041-64095063 TTGTAGATGAAAAACAACCATGG - Exonic
931674137 2:64676955-64676977 TGTTAGATGAAGAAAAAACAGGG - Intronic
933270959 2:80232440-80232462 TGGGAGATGAAGAAGGAGAAGGG - Intronic
934479337 2:94621025-94621047 TTGTAGAGAAAAAAAGACCAAGG + Intergenic
934498305 2:94831304-94831326 CTGTAGAAGAAGGAAGAACATGG - Intergenic
935138733 2:100332648-100332670 TTGTACATCAATTAAGAGCAAGG + Intergenic
936233898 2:110726595-110726617 TTGGAAATGAGGAAACAGCAAGG + Intergenic
936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG + Intronic
936844686 2:116816513-116816535 TTGGAGCTGATGAAAGAGAAAGG + Intergenic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
938109667 2:128555406-128555428 TGGAAGATGAAGAAGGACCAAGG + Intergenic
938340958 2:130536224-130536246 TTGGAAATGTAGAAAGAGAACGG - Intergenic
938348872 2:130584485-130584507 TTGGAAATGTAGAAAGAGAACGG + Intergenic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
939445801 2:142309067-142309089 ATGTAGATGCATAAAAAGCAGGG - Intergenic
939817235 2:146911044-146911066 TTGGAGGTGATGAAAGACCAAGG + Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940637707 2:156319076-156319098 TTGTACATGAAGTGAGAGAAAGG - Intergenic
941173488 2:162168622-162168644 TTGAGGATGTAGTAAGAGCAAGG - Intergenic
941865849 2:170333557-170333579 TTGGATCTGAAGAGAGAGCAGGG - Intronic
942426434 2:175865374-175865396 TTGTACTTCAAGAAATAGCATGG - Intergenic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942852802 2:180510153-180510175 TTGTACATGATGAGAGATCAGGG + Intergenic
943168251 2:184360986-184361008 TTTTATAGGAAGAAAGATCAAGG + Intergenic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944911598 2:204315777-204315799 GTTCAGATGAACAAAGAGCAGGG - Intergenic
944913348 2:204331995-204332017 ATGGAGATGGAGAAAGGGCAAGG - Intergenic
945656472 2:212630384-212630406 TTTTAGAGAAAGAAAGAGGAGGG - Intergenic
945784584 2:214217156-214217178 TTTTAGATATAAAAAGAGCAAGG + Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946901405 2:224376042-224376064 TAGTTGATGAAGCAACAGCAGGG + Intergenic
947308515 2:228774576-228774598 TTGAGAAAGAAGAAAGAGCAGGG - Intergenic
947349464 2:229227670-229227692 TTAGGGATGAAGAAAGAGCAAGG - Intronic
947622174 2:231597682-231597704 TTGTAGATGAGAAAACAGCACGG - Intergenic
1169726370 20:8737674-8737696 TTTTTGGTGAAGAAAGAGAAGGG - Intronic
1169815315 20:9650422-9650444 TTGTAGGTGGAGAAAGAGGTTGG + Intronic
1171568576 20:26221595-26221617 ATGTCCATGAAGGAAGAGCATGG - Intergenic
1171779582 20:29407356-29407378 TTCTAAAGGAAGAAAGAGAAAGG + Intergenic
1171889568 20:30698047-30698069 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1172570179 20:35964157-35964179 AGATATATGAAGAAAGAGCAGGG - Intronic
1172867220 20:38109567-38109589 CTGTAAGTGAAGAAAAAGCAAGG + Intronic
1173746535 20:45441738-45441760 TTGTATCTGAAGTGAGAGCAGGG + Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175371977 20:58498508-58498530 TTGTACAGGAAGAAAGGCCAGGG + Intronic
1175633043 20:60558077-60558099 AGGGAGAGGAAGAAAGAGCAAGG - Intergenic
1175738329 20:61402814-61402836 TTATAGATGAAGAAACAGAATGG + Intronic
1176581080 21:8527077-8527099 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1176609413 21:8864746-8864768 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1176854359 21:13953375-13953397 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1176980592 21:15376681-15376703 TTCTAGATGAAGAAAGAAAAGGG + Intergenic
1177866077 21:26514407-26514429 TGATAGAGGAAGCAAGAGCAGGG - Intronic
1177952058 21:27551330-27551352 CAGAAGATGAAGGAAGAGCAAGG + Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1178331254 21:31694702-31694724 TTGAATATGAAGAAAGACCTGGG - Intronic
1178865491 21:36323606-36323628 TTATAATTAAAGAAAGAGCAAGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1180282344 22:10714049-10714071 ATGTCCATGAAGGAAGAGCATGG + Intergenic
1180359507 22:11874592-11874614 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1181088349 22:20455374-20455396 TTGTAGAAGAAGGAAGCCCAAGG - Intronic
1182457244 22:30459795-30459817 TTGCAGAAGAGGAAAAAGCAAGG - Exonic
1182779836 22:32858655-32858677 TTGAAGATGAAGTGAGAGAATGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1183664385 22:39238969-39238991 CTGTAGCGGAGGAAAGAGCAAGG + Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949280531 3:2341627-2341649 TGGTAGAGGAAGAAAGGCCAGGG - Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
951028487 3:17854968-17854990 TTGTATATGATGAAAGAGAGGGG + Intronic
951138055 3:19127195-19127217 TTGTACAAGAAGAAAGAGATAGG - Intergenic
951275868 3:20685209-20685231 TTGCACATGAAGAAAGAACCTGG + Intergenic
951800751 3:26593294-26593316 TTGTAGATTAAGTAAGATCATGG + Intergenic
952471709 3:33660954-33660976 TTGTACATGAAGTAATATCATGG - Intronic
953163821 3:40446325-40446347 TAGGAGATGAGGAAAGAGAAAGG + Intergenic
954045054 3:47922747-47922769 TTGTACATGAAAAAAAAGCAGGG + Intronic
955430656 3:58841224-58841246 TTGTAGCTGAAGGGAGAGAAGGG + Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
956425428 3:69129641-69129663 TTGAAGCTGAAGAAAGAGATGGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957110267 3:75946753-75946775 ATGTCCATGAAGGAAGAGCATGG + Intronic
957165514 3:76668277-76668299 TTGTAGAGAGAGAAAGAGAAAGG + Intronic
957217233 3:77336199-77336221 TTGTAGGTGAATAAAGAGCCAGG + Intronic
957774579 3:84739949-84739971 ATGTATTTGAAGACAGAGCAAGG - Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958699417 3:97568960-97568982 TTGTTGCTGAAGACAGACCAGGG + Intronic
958779894 3:98528216-98528238 TTGAAGATGAAGACAGAGAAAGG - Intronic
958915185 3:100041973-100041995 ATATAGCTGAAGAAAGAGGAAGG - Intronic
959146329 3:102550128-102550150 TAGTAGATGAACACTGAGCAGGG - Intergenic
960002336 3:112746033-112746055 TTATTGATGATGAAACAGCAGGG + Intronic
960081050 3:113540704-113540726 TTGTAGAGGAAGAGAGGGAAGGG - Intronic
960100046 3:113732289-113732311 TTGAAGATGAAGGAAGAGCCAGG + Intronic
960395653 3:117133539-117133561 GAGTAGATCAAGAAAAAGCAAGG - Intronic
960518779 3:118631364-118631386 GTGTAGGTGAAGAAAGGTCATGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960878164 3:122317222-122317244 TTTAAGATGAAGAAATAGAATGG - Intergenic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961080033 3:124018810-124018832 TTCCAGATGAAGAAACTGCAGGG - Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
963045311 3:141098048-141098070 TTGGTGAAGAAGAAAGGGCATGG - Intronic
963145193 3:141987078-141987100 TTGTAAATGAAGAAATAAAATGG - Intronic
964824391 3:160809264-160809286 TTATAGATGAAGAAATGCCAAGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965604917 3:170488665-170488687 TTGTAGATGATGAGAGATAAAGG - Intronic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
966812362 3:183858514-183858536 TTTTTGATCAAGAAGGAGCAAGG - Intronic
967274244 3:187758106-187758128 TTGGAGAGGAAGAAAGTGCATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967766834 3:193290245-193290267 CTGAAGGTGAAGACAGAGCATGG - Intronic
969246207 4:5934584-5934606 TTGGAGCTGAGGAAAAAGCATGG - Intronic
969598908 4:8164171-8164193 TTAGAGATGAAGAAAGGACAAGG - Intergenic
970018981 4:11545642-11545664 TGGCAGGGGAAGAAAGAGCACGG - Intergenic
970528607 4:16958726-16958748 TGGTAGATGAAGAAAGATGTTGG + Intergenic
971428938 4:26543420-26543442 TTTTATATGAAGTAAAAGCATGG + Intergenic
972002113 4:34050598-34050620 ATGTATATAAAGGAAGAGCAAGG + Intergenic
973178568 4:47240226-47240248 TTTGAGAGGAAGAAGGAGCAAGG + Intronic
974499599 4:62683688-62683710 TTGGAGATCAAGGAAAAGCAGGG + Intergenic
976332998 4:83853115-83853137 TTCTTGCTGAAGAAAGACCAGGG - Intergenic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976907076 4:90251453-90251475 TTATAGATGCAGAAACAGCATGG - Intronic
977303933 4:95299646-95299668 TGGAAGATGAAGGAAGAGCAAGG + Intronic
977689961 4:99894781-99894803 TTGTAGATGAAGAAATTTGAGGG + Intergenic
977842872 4:101730173-101730195 TGCTAGAGGAAGAAAGAACATGG - Intronic
978125700 4:105132733-105132755 TTGTAGATGAGCAAAGAAAATGG - Intergenic
979538309 4:121849939-121849961 TTTTAGATAAAGAAAGAATATGG + Intronic
979600290 4:122580191-122580213 TGGCAGATGAAGAAAGAGGAAGG + Intergenic
979962862 4:127041856-127041878 TTGTATATGATGAAAGATAAGGG - Intergenic
980338194 4:131502659-131502681 TTGTAAATGAGAAAAGAGAAAGG + Intergenic
980489319 4:133505391-133505413 ATGGAGAGGAAGGAAGAGCAGGG + Intergenic
980856596 4:138447871-138447893 TTATAGATAAAGAAAGAAAACGG - Intergenic
982134036 4:152256981-152257003 TTGTGAAGGAAGAAAGAGCAAGG - Intergenic
982534673 4:156595372-156595394 TTGTAGATGAGGAAACAGAGAGG - Intergenic
982647224 4:158038543-158038565 TTCTAGATAAAGAAAGAAAAGGG + Intergenic
982709287 4:158744100-158744122 TTGTAGTTGCAGGAAGAGGAAGG + Intergenic
982833258 4:160089826-160089848 CAGAAGATGAAGGAAGAGCAAGG - Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984701783 4:182822971-182822993 TTGTGGAAGTAGGAAGAGCAAGG + Intergenic
984869149 4:184311422-184311444 TTGGAGCTGAAGAAAAGGCATGG - Intergenic
1202769830 4_GL000008v2_random:193762-193784 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
985858151 5:2447237-2447259 TTGGAGCTGAAGTAAAAGCAGGG + Intergenic
986553664 5:8987275-8987297 TTGTAGATGGTGAAAGATAAAGG + Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987451513 5:18089586-18089608 TTGGAAATCAAGAAAGAGAAAGG + Intergenic
988259897 5:28872700-28872722 TTGTAGATGAACAAAGAAAGCGG - Intergenic
989162670 5:38406782-38406804 TTCAAGATGAACACAGAGCATGG - Intronic
989360639 5:40597731-40597753 TTGCAGAGGAGAAAAGAGCAAGG + Intergenic
989653994 5:43724354-43724376 TCGTTGATGAAGAAAGAGCAGGG - Intergenic
990674953 5:58173490-58173512 TTGAAGATCAAGAAAGAGTAAGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990999975 5:61772809-61772831 TTGTAAAGGCAAAAAGAGCATGG - Intergenic
991711901 5:69416269-69416291 TTTTAGAGAAAGAAAGAGAAAGG + Intronic
992202640 5:74399399-74399421 TGGCATATGAGGAAAGAGCAAGG - Intergenic
992376242 5:76190462-76190484 TTCTTGCTGAAGACAGAGCAGGG + Intronic
992416810 5:76559705-76559727 ATGTTGATGAAGAAAAAGAAGGG + Intronic
993764628 5:91841003-91841025 TTGTAGCTGAGGAAAGAGGTTGG + Intergenic
994028396 5:95112356-95112378 ATGTAGATGAAGAAATACCATGG - Intronic
996277267 5:121681990-121682012 TTATAAATGGAGACAGAGCAAGG - Intergenic
996484003 5:124009719-124009741 CTATAGATGAAGAAACATCATGG + Intergenic
996710725 5:126540819-126540841 TTGGGCATGACGAAAGAGCATGG - Intergenic
996903899 5:128575893-128575915 TTGTAGCAGGAGCAAGAGCAGGG - Intronic
998144350 5:139718104-139718126 TTATAAATGAAGAAACAGCCAGG + Intergenic
999472479 5:151867663-151867685 TTATAGATGAAGAAAGTGCAGGG + Intronic
999509549 5:152234360-152234382 TTTTAGATAAAGAAACAGCAGGG - Intergenic
999737774 5:154525591-154525613 TTCCAGATAAAGAAAAAGCACGG - Intergenic
1000703412 5:164481143-164481165 TGGAAGATGAAGAAAGAGCAAGG + Intergenic
1001779687 5:174357296-174357318 TGGCAGATGGGGAAAGAGCAAGG + Intergenic
1003901248 6:10657808-10657830 GTCTAAATGAAGCAAGAGCAGGG - Intergenic
1004582131 6:16964663-16964685 TCGGAGCAGAAGAAAGAGCATGG + Intergenic
1005021671 6:21424399-21424421 TTGTAGATGGAGAAACATAATGG - Intergenic
1005199955 6:23333611-23333633 TTGTAGATGAGGAAACAGAAAGG - Intergenic
1005449265 6:25957166-25957188 TTGAAGTTGAAGAAATAACAGGG + Intergenic
1008144401 6:47873740-47873762 TTGAAGATGGGGAAATAGCAAGG + Intergenic
1008456977 6:51722388-51722410 TTGCACATTAAGAAAAAGCATGG + Intronic
1009676702 6:66833415-66833437 TTGTTAGTGAAGACAGAGCATGG - Intergenic
1009780661 6:68265080-68265102 ATGGAGATGAATGAAGAGCATGG + Intergenic
1010004797 6:70983946-70983968 TTCTTGATGAAGACAGACCAGGG + Intergenic
1011177096 6:84575703-84575725 TTTTGGATGAAGAAAGGGCAGGG + Intergenic
1011499889 6:87976313-87976335 TTATAGATGAAAAAAAATCAAGG - Intergenic
1012117078 6:95314625-95314647 GTGTACATGAACATAGAGCATGG + Intergenic
1012821882 6:104094790-104094812 TTGTAAATGTATAAATAGCATGG + Intergenic
1012932866 6:105334892-105334914 TTGTATCTTAAGAAAGAGCTGGG - Intronic
1014422217 6:121260499-121260521 ATGGAGAGGAAGGAAGAGCAGGG + Intronic
1015485175 6:133761554-133761576 TTTTAGTTTAGGAAAGAGCATGG - Intergenic
1015619725 6:135118463-135118485 GGGCAGATGAAGAAAGGGCAGGG - Intergenic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016781079 6:147959168-147959190 TTGGAAATGAAGAAAGGGTAGGG - Intergenic
1016966995 6:149728412-149728434 CTGTAGATGAAGTTATAGCATGG + Intronic
1017193424 6:151676930-151676952 TTGGAGATGGAGACAGAGTATGG + Intronic
1018399974 6:163413248-163413270 TTACAGATGAAGAAAGAATACGG - Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1020493267 7:8815700-8815722 TTGTAGATGAAGAAACTGAGAGG + Intergenic
1020520912 7:9185964-9185986 TTTTAGTTGAAGAAATAGCGGGG + Intergenic
1020741032 7:12018568-12018590 CTGTCGATAAAGCAAGAGCAGGG + Intergenic
1021377920 7:19931792-19931814 TGGAAGGTGAAGGAAGAGCAAGG + Intergenic
1021673782 7:23060045-23060067 TTTTGGAAGAAGAAAAAGCAGGG + Intergenic
1022228978 7:28394612-28394634 TTATATATGAGGAAAAAGCAAGG - Intronic
1022249777 7:28595694-28595716 CTGATGATGAAGACAGAGCATGG + Intronic
1023094102 7:36642620-36642642 ATTTGGATGATGAAAGAGCAAGG + Intronic
1023098848 7:36691978-36692000 TGGTAGATGATGAAATGGCAGGG - Intronic
1023314029 7:38916862-38916884 TTATACATAAAGAAAGAGTATGG + Intronic
1023779182 7:43640235-43640257 TTATAAATGAATAAAGGGCATGG - Intronic
1024417835 7:49128390-49128412 ATTTAGTTGAAGAAATAGCATGG - Intergenic
1025289461 7:57701820-57701842 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1027596304 7:80178204-80178226 TTGTAGATGAACAAAGAAAATGG + Intronic
1027649355 7:80846228-80846250 TTGTAGGTGCATAAAGATCAAGG - Intronic
1027846544 7:83384740-83384762 ATTTAGATGATGAAAGAGCGGGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028579431 7:92390976-92390998 TTCTAGATTATGAAAGAGAAAGG - Intronic
1029132648 7:98344412-98344434 ATATACTTGAAGAAAGAGCAAGG + Intronic
1029232170 7:99079246-99079268 TTGCAGATGGAGAACGAGCCTGG - Intronic
1029870165 7:103682262-103682284 CTGTAGGTGAAAAGAGAGCACGG + Intronic
1030844770 7:114395532-114395554 TTTTAGATAAAGAGAAAGCAAGG + Intronic
1031832657 7:126646350-126646372 TGGTAGCTGAAGAAGGATCAGGG - Intronic
1032658839 7:133961170-133961192 TTGAAGATGAGGAAGGAGCCAGG + Intronic
1034058111 7:148058155-148058177 TAGTACATGAAGAGAGAGCATGG + Intronic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1036444436 8:8809380-8809402 TTGTAGAGCAACAAAGGGCAGGG - Intronic
1036977730 8:13433398-13433420 TTACAGATCAAGAAAAAGCATGG + Intronic
1038415223 8:27389998-27390020 TTGTTGATGTGGAAACAGCAAGG + Intronic
1038971971 8:32646680-32646702 TTGTAGAGAAAGAAAGAAAAAGG + Intronic
1039575067 8:38616514-38616536 GTGTAGCTGAAGACAGAGCAAGG - Intergenic
1040837345 8:51746404-51746426 TTCTAGATGAAGAGAGGACAGGG - Intronic
1041404306 8:57480931-57480953 TAGTAGATAAAGCAACAGCAGGG + Intergenic
1041569831 8:59324980-59325002 TTCCAGATGAAGAGTGAGCATGG + Intergenic
1041692890 8:60706474-60706496 GTGTAGGTGATGAAAGAACAAGG + Intronic
1041924313 8:63220871-63220893 TTATAGATGAAGAAACAGCCTGG + Intergenic
1042105352 8:65320434-65320456 TTGTAGATGTGAAAAGAGAAAGG - Intergenic
1042313233 8:67399163-67399185 TTGAAGATTGAGAAAGAGCTGGG - Intergenic
1043021859 8:75011994-75012016 TTGTGAAGGAAGAAAGAGTAGGG + Intronic
1043028208 8:75098316-75098338 TTGTAAATGAGAAAAGAGTAAGG - Intergenic
1043510202 8:80943615-80943637 TTGGACATGAAGAGGGAGCAAGG - Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1044931648 8:97257740-97257762 TTGCAGATGAAGAAAGTGGTAGG + Intergenic
1045345173 8:101287603-101287625 TTCAAGAAGAGGAAAGAGCAGGG - Intergenic
1046707552 8:117472267-117472289 TTATATATGAACAAAGTGCAAGG + Intergenic
1046789578 8:118306632-118306654 TTGCAGAGGTAGGAAGAGCAGGG - Intronic
1047494179 8:125397953-125397975 ATGAAGATGAAAAAAGAGCGGGG - Intergenic
1047758819 8:127939116-127939138 TTATGGAGGAAGAAAGAGCTGGG + Intergenic
1048942363 8:139412479-139412501 TTGTAGATCTAGACAGAGGAGGG - Intergenic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050736909 9:8774416-8774438 ATGAAGATGAAGAAAAAACAGGG + Intronic
1051127197 9:13817899-13817921 TTGGTGATGAAGACAGATCAGGG - Intergenic
1052147512 9:25068327-25068349 TTACAGATGAAGAAACAGAAAGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052191329 9:25666384-25666406 ATGTAGATGAAGCAATGGCAAGG + Intergenic
1052539239 9:29786710-29786732 TTGTATATGATGAAAGACAAGGG - Intergenic
1053658852 9:40249227-40249249 CTGTAGAAGAAGGAAGAACATGG + Intronic
1053909221 9:42878499-42878521 CTGTAGAAGAAGGAAGAACATGG + Intergenic
1054359515 9:64100194-64100216 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1054370972 9:64395517-64395539 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054525746 9:66126995-66127017 CTGTAGAAGAAGGAAGAACATGG - Intronic
1054678603 9:67885246-67885268 CTGTAGAAGAAGGAAGAACATGG + Intronic
1055017017 9:71629698-71629720 CTGAAATTGAAGAAAGAGCAAGG + Intergenic
1055603704 9:77946824-77946846 TTGCAGATGAAGAAAGTGACAGG - Intronic
1057051721 9:91928851-91928873 ATGTAGATGAGGAAAGTGCAGGG - Intronic
1058643115 9:107106142-107106164 TTGGAGGTGAAGAAAAATCAGGG + Intergenic
1058744061 9:107972717-107972739 TCATACATGAAGCAAGAGCAGGG - Intergenic
1058757846 9:108100296-108100318 TTGTGGAGGAAGACAGAGGAGGG + Intergenic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1061217152 9:129228137-129228159 ATGTAGATGGAAAGAGAGCAAGG - Intergenic
1061324561 9:129855587-129855609 TGGTAGGAGGAGAAAGAGCAAGG + Intronic
1061857240 9:133448995-133449017 TTGGAGGTGAGGAAAGAGCCAGG - Intronic
1203694730 Un_GL000214v1:87440-87462 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203559184 Un_KI270744v1:35819-35841 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203611094 Un_KI270749v1:5120-5142 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1203641543 Un_KI270751v1:16623-16645 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1185623496 X:1467272-1467294 CTCTGGAGGAAGAAAGAGCAGGG - Intronic
1185720912 X:2380710-2380732 TGATGGATGAAGAGAGAGCAAGG - Intronic
1186174161 X:6907571-6907593 TTGTAGCTGAAGACAAAACAGGG - Intergenic
1187136455 X:16552022-16552044 TGGAAGGTGAAGGAAGAGCAAGG + Intergenic
1187279850 X:17849937-17849959 TTCTAGATGAAGAAAATGGAAGG - Intronic
1187637502 X:21247130-21247152 TTCTAGATGAAGGCAGAGGAAGG + Intergenic
1187668661 X:21645699-21645721 TTCTAAAGGAAGAAAAAGCAAGG + Intronic
1188970420 X:36608379-36608401 TTGTAGATGAGGAAAATGTAAGG + Intergenic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189695874 X:43661398-43661420 TTGAATATGAACAAAGTGCAGGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190113278 X:47609089-47609111 TTATAGATGAAAAATGTGCAGGG - Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190593843 X:52033123-52033145 TAGAACATGAAGAAAGAGCAAGG + Intergenic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1192127902 X:68519247-68519269 TTGTAGGTAAAGGAAGAGGACGG + Intronic
1192543004 X:71990896-71990918 TTGAAGATGAAGAACAAGCCTGG + Intergenic
1193867168 X:86748011-86748033 TTATGGATGAACAAAGAACATGG - Intronic
1195043657 X:101036756-101036778 TTTTAGAGGAAGAAAGGGCGAGG + Intronic
1195319164 X:103707285-103707307 TTGAAGATGAGGAAAGTGAAAGG + Exonic
1196041766 X:111212278-111212300 TATTAGATGAAGAAAGATTAAGG - Intronic
1196461893 X:115940957-115940979 TTGTGGATGAAAAAACACCAGGG - Intergenic
1196753374 X:119137226-119137248 TTGTAGATGAGGAAACAGAAAGG + Intronic
1197551033 X:127893004-127893026 TTTGAGATGGAGCAAGAGCAAGG - Intergenic
1197607202 X:128597954-128597976 ACGTAGAAGAAGGAAGAGCAGGG - Intergenic
1197809841 X:130431402-130431424 TTGTAAATGTATAAAGGGCAAGG + Intergenic
1197896058 X:131316985-131317007 TGATAGCTGAAGAAACAGCAAGG + Intronic
1198109544 X:133490839-133490861 TTGTATATGATGAAAGATAAGGG + Intergenic
1198441630 X:136668858-136668880 TTTGAGATTAAGAAAGAGCCAGG - Intronic
1198473624 X:136974189-136974211 TTTTAGAAGAATAAAGAGTAAGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199350972 X:146799271-146799293 ATGTAGAATAAGAAAGACCAAGG - Intergenic
1199619189 X:149684489-149684511 TGGTACATGAAGAAAGACCATGG + Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic