ID: 1108425854

View in Genome Browser
Species Human (GRCh38)
Location 13:50299430-50299452
Sequence ATGTGTGTGTACATGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2069
Summary {0: 1, 1: 1, 2: 52, 3: 344, 4: 1671}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108425854_1108425860 22 Left 1108425854 13:50299430-50299452 CCCATATACATGTACACACACAT 0: 1
1: 1
2: 52
3: 344
4: 1671
Right 1108425860 13:50299475-50299497 TTCAATTTAAATAACTGAAATGG 0: 1
1: 0
2: 8
3: 71
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108425854 Original CRISPR ATGTGTGTGTACATGTATAT GGG (reversed) Intronic
Too many off-targets to display for this crispr