ID: 1108425854 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:50299430-50299452 |
| Sequence | ATGTGTGTGTACATGTATAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2069 | |||
| Summary | {0: 1, 1: 1, 2: 52, 3: 344, 4: 1671} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108425854_1108425860 | 22 | Left | 1108425854 | 13:50299430-50299452 | CCCATATACATGTACACACACAT | 0: 1 1: 1 2: 52 3: 344 4: 1671 |
||
| Right | 1108425860 | 13:50299475-50299497 | TTCAATTTAAATAACTGAAATGG | 0: 1 1: 0 2: 8 3: 71 4: 748 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108425854 | Original CRISPR | ATGTGTGTGTACATGTATAT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||