ID: 1108426207

View in Genome Browser
Species Human (GRCh38)
Location 13:50303975-50303997
Sequence GAGGGTAGAGAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3907
Summary {0: 1, 1: 7, 2: 94, 3: 678, 4: 3127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108426207_1108426211 -10 Left 1108426207 13:50303975-50303997 CCTTCCTCCTGCTCTCTACCCTC 0: 1
1: 7
2: 94
3: 678
4: 3127
Right 1108426211 13:50303988-50304010 CTCTACCCTCAAGTAGGCCCTGG 0: 19
1: 160
2: 333
3: 437
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108426207 Original CRISPR GAGGGTAGAGAGCAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr