ID: 1108430817

View in Genome Browser
Species Human (GRCh38)
Location 13:50351965-50351987
Sequence CTTAGGCTGCACAATGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108430817_1108430820 -8 Left 1108430817 13:50351965-50351987 CCTAGACCATTGTGCAGCCTAAG 0: 1
1: 0
2: 2
3: 11
4: 142
Right 1108430820 13:50351980-50352002 AGCCTAAGGAAGCTTCAGCAAGG 0: 1
1: 2
2: 0
3: 19
4: 175
1108430817_1108430823 21 Left 1108430817 13:50351965-50351987 CCTAGACCATTGTGCAGCCTAAG 0: 1
1: 0
2: 2
3: 11
4: 142
Right 1108430823 13:50352009-50352031 TGGAGTCTGTGAACCAAAGTTGG 0: 1
1: 0
2: 2
3: 13
4: 158
1108430817_1108430822 1 Left 1108430817 13:50351965-50351987 CCTAGACCATTGTGCAGCCTAAG 0: 1
1: 0
2: 2
3: 11
4: 142
Right 1108430822 13:50351989-50352011 AAGCTTCAGCAAGGTTGTTATGG 0: 1
1: 0
2: 0
3: 19
4: 903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108430817 Original CRISPR CTTAGGCTGCACAATGGTCT AGG (reversed) Intronic