ID: 1108433862

View in Genome Browser
Species Human (GRCh38)
Location 13:50382368-50382390
Sequence GAGAGCTCTGACCAGGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108433862 Original CRISPR GAGAGCTCTGACCAGGCCCA TGG Intronic
900746635 1:4365391-4365413 GAGAGAGCTGACAAGGGCCAGGG - Intergenic
902047984 1:13540184-13540206 GACAGCTCGGACGAGACCCATGG - Intergenic
902988417 1:20169892-20169914 GAATGCTCTGCCCTGGCCCAGGG - Intronic
904862582 1:33549944-33549966 GTCAGCCCTGACCATGCCCAGGG - Intronic
905015714 1:34777150-34777172 TAGAGCTCTGCCCAGGCCTCAGG - Intronic
907400842 1:54223835-54223857 TAGAGCTCTGGCCTGGCCCCAGG + Intronic
909407281 1:75305619-75305641 GAGAGCTCTGAGTGTGCCCAAGG - Intronic
909925206 1:81430404-81430426 GAGAGCTCTGTCAATGCCCCAGG + Intronic
915343232 1:155187421-155187443 GGGGGCTCTGATCAGGGCCAGGG + Intronic
917103730 1:171471526-171471548 GTGAGCTCTGACCACACCCGAGG + Intergenic
918052580 1:180987305-180987327 GAGAGCCCTGACTTAGCCCAAGG - Intronic
919234371 1:194819623-194819645 GAAAACTCTGGCCAAGCCCAAGG - Intergenic
919835542 1:201570653-201570675 GAGGGCTACGACCAGGGCCAGGG + Intergenic
919943568 1:202304518-202304540 CAGAGCTGGCACCAGGCCCAGGG - Intronic
920087490 1:203428357-203428379 GCTAGCACTGACCAGTCCCATGG + Intergenic
920512881 1:206563874-206563896 GAAAGCTCTGAGCAGGACCCAGG - Intronic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922477357 1:225915806-225915828 GAGAGGTGTGTGCAGGCCCATGG - Intronic
922672682 1:227523631-227523653 GAGTGCTCTGATCAGGATCAGGG - Intergenic
923907233 1:238398904-238398926 GCGAGCCCTGCCCAGGCACAAGG - Intergenic
924832036 1:247606375-247606397 GACAGCTATGCCCAGGACCAAGG + Exonic
1062774291 10:132845-132867 GACAGCTCTGAGAAGCCCCAGGG + Intergenic
1063187525 10:3664724-3664746 GAGATCTCTGAACAGCCTCAGGG - Intergenic
1063375607 10:5552525-5552547 GAGACCTCTGTCCAGGGCGATGG + Intergenic
1063440486 10:6068984-6069006 GGGAGCTCTGCCCAGGCTCTGGG + Intergenic
1063604920 10:7514729-7514751 GAGAGCGCAGACAAGGACCATGG - Intergenic
1064301484 10:14126911-14126933 GACAGCTCTGTGCAGGGCCAAGG - Intronic
1067066424 10:43106517-43106539 GAGACCTCGGTCCAGGCCAACGG + Exonic
1067466257 10:46501555-46501577 GAGAGGGCAGTCCAGGCCCAGGG + Intergenic
1067571245 10:47372772-47372794 GAGAGCACCGACCTCGCCCATGG + Intronic
1067620931 10:47883050-47883072 GAGAGGGCAGTCCAGGCCCAGGG - Intergenic
1069299725 10:66890961-66890983 GAGACCTCTGGCCAGTCCCCAGG + Intronic
1074477194 10:113784209-113784231 GTGGCCTCTGAGCAGGCCCAGGG - Intergenic
1076115252 10:127891119-127891141 GAGAGCCCTGAAGGGGCCCAGGG - Intronic
1076538998 10:131201933-131201955 GAAAGCTCTAACAAGTCCCAGGG + Intronic
1076594468 10:131617390-131617412 GGGAGGGCTGACCAGGGCCATGG - Intergenic
1076848189 10:133080303-133080325 GAGGGCCATGAGCAGGCCCATGG - Intronic
1077160269 11:1109506-1109528 GGCAGCTCAGACCAGGCCCGAGG - Intergenic
1077877246 11:6319294-6319316 CAGCGCTCCGGCCAGGCCCAAGG + Exonic
1078043899 11:7895440-7895462 GAGACTCCTGACCAGGCTCAAGG - Intergenic
1078620060 11:12899047-12899069 CCCAGCTCTGACCTGGCCCAGGG + Intronic
1078885729 11:15497862-15497884 GAGAGGTATGACCTGGTCCACGG + Intergenic
1081663841 11:44904854-44904876 GGAAGCACTGACAAGGCCCATGG - Intronic
1083616046 11:64027207-64027229 CAGAGAGGTGACCAGGCCCACGG + Intronic
1083630435 11:64092401-64092423 GAGGGCTCTGACCCTGCCTATGG + Intronic
1083870082 11:65481847-65481869 GGGGGCTCTGGCCAGACCCAGGG + Intergenic
1083979561 11:66155872-66155894 GAGAGCTCTGAGCAGGAAAAAGG + Intronic
1084489567 11:69471104-69471126 GTGGGCGCTGAGCAGGCCCAGGG + Intergenic
1085264652 11:75230057-75230079 CAGTGCTCTGCCCAGGCACATGG - Intergenic
1085305986 11:75486386-75486408 CAGAGCTCTGGCCCTGCCCAAGG + Intronic
1085640718 11:78191007-78191029 GAGAGTTCTGAGCAGGGGCATGG + Intronic
1087337950 11:96867571-96867593 GAGGGCTATGTTCAGGCCCAAGG + Intergenic
1087673243 11:101129574-101129596 GAGAGGTCCGACTAGCCCCAGGG - Exonic
1089342123 11:117765151-117765173 GAGGCCTTTGTCCAGGCCCAGGG + Intronic
1089539678 11:119182294-119182316 GGCAGCTCTGGCCAGGGCCAGGG - Exonic
1089561272 11:119344470-119344492 GAGAGTTTTGGCCATGCCCATGG + Intronic
1089593441 11:119559799-119559821 GAGGGCTCTAAGCAGGCCCCAGG - Intergenic
1089748988 11:120636926-120636948 GACACCTCTGACCATGGCCATGG - Intronic
1090520719 11:127476090-127476112 GAGAGCTCTGACCTGGACAGAGG + Intergenic
1090629268 11:128632399-128632421 GAGGGGTCTGCCCAGGCCCAGGG - Intergenic
1090678959 11:129032259-129032281 CAGAACTCTGTGCAGGCCCATGG - Intronic
1091999996 12:5024081-5024103 GAGAGCTCTGAGGAGCCACAGGG - Intergenic
1092963961 12:13624019-13624041 GAGAGGTCTGAGAAGGGCCAAGG - Intronic
1096869575 12:54584885-54584907 GAGAGCTGGGGCCAGGACCAGGG - Intronic
1096963856 12:55608483-55608505 GAGAGCTCCCACCAGGCCATAGG - Intergenic
1097503673 12:60438110-60438132 CAGAACTCTGTGCAGGCCCACGG + Intergenic
1099008245 12:77260465-77260487 AAGAGCCCAGGCCAGGCCCAGGG - Intergenic
1101275597 12:103197872-103197894 GGGGGCTGGGACCAGGCCCATGG + Intergenic
1101360378 12:104020792-104020814 TAGAGCTCTTTCCAGCCCCAGGG - Intronic
1101898458 12:108772941-108772963 TAGAGCACTTACCAGGGCCAGGG + Intergenic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1103409252 12:120699010-120699032 GCCAGCTGTGACCAGCCCCAGGG - Exonic
1103918561 12:124388153-124388175 GCGAGCTCTGGCCAGGCGCCTGG - Intronic
1104145678 12:126031539-126031561 GCTAGCACTGACCAGTCCCATGG - Intergenic
1104190817 12:126480254-126480276 GAGAGTTCTGACCAGAGCCTGGG - Intergenic
1107395879 13:40016865-40016887 GAGCGCTCTGAACAGGCACAAGG - Intergenic
1108433862 13:50382368-50382390 GAGAGCTCTGACCAGGCCCATGG + Intronic
1109301323 13:60592901-60592923 GAGAGTTTTGGCCAAGCCCACGG - Intergenic
1110060103 13:71029978-71030000 GCTAGCACTGACCAGTCCCATGG + Intergenic
1111866470 13:93774914-93774936 GAGAGCTCAGCCAAGGCCCCTGG + Intronic
1111991745 13:95123775-95123797 GAAAGCACGGACCATGCCCAAGG + Intronic
1113268682 13:108648257-108648279 GACACCACTGACCATGCCCAGGG - Intronic
1113461681 13:110486323-110486345 GAGAGCCCTGCCCAGGGTCAGGG - Intronic
1113881008 13:113626199-113626221 GAGAGCTCTCCACAGGGCCAGGG - Intronic
1114264000 14:21060490-21060512 GAGAGCTCAGAACAGGACCCTGG - Intronic
1115224402 14:31088051-31088073 GGGAGCTCTAGCCAGGGCCATGG + Intronic
1118296794 14:64577441-64577463 GAAAGTTTTGACCAGGCCAAAGG - Intronic
1118819749 14:69337591-69337613 CAGAGCTCTGACCAGGAGAAGGG + Intronic
1119357607 14:74019749-74019771 GAGATCTCTGAAAAGGCCCAAGG - Intronic
1120107654 14:80515283-80515305 GTGAGCTCTGCCCCAGCCCAGGG + Intronic
1121328762 14:93036632-93036654 GAGAGCCCTCACCCGGCCCCTGG - Intronic
1123930625 15:25170125-25170147 GAGGGCTCCCACCATGCCCAGGG + Intergenic
1125930799 15:43598739-43598761 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1125943965 15:43698553-43698575 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1127321723 15:57853130-57853152 GAGAGCTCTTACCAGACACCAGG + Intergenic
1128543060 15:68550376-68550398 GAGATCACTAACCAGGCCCCTGG - Intergenic
1128760828 15:70215067-70215089 GAGAGCTAGGCCCAAGCCCAGGG + Intergenic
1129167019 15:73784473-73784495 GAGAGCTCTCATCAGGCCCGAGG - Intergenic
1131086369 15:89578919-89578941 GAGTGCTCTGTCCAGGAGCAGGG + Intronic
1131897175 15:97046308-97046330 GAGCGCTCTAATCAGGGCCAAGG - Intergenic
1132676127 16:1121950-1121972 GAGAGCTGGGGACAGGCCCAGGG - Intergenic
1132881362 16:2163088-2163110 GGGAGTGCTGGCCAGGCCCAGGG - Intronic
1133067716 16:3221209-3221231 GAGCGCCCCGACCAGGACCAGGG - Intergenic
1134348967 16:13418592-13418614 GAGACTCCTGCCCAGGCCCATGG + Intergenic
1135412495 16:22245672-22245694 GTGAGGCCTGGCCAGGCCCAGGG + Intronic
1135547139 16:23373986-23374008 GGGAGCTCTGCCCATCCCCATGG + Intronic
1136383343 16:29907218-29907240 GAGAGGCCAGGCCAGGCCCAAGG - Intronic
1136661446 16:31766605-31766627 GCTAGCACTGACCAGTCCCATGG + Intronic
1137323533 16:47410899-47410921 GGTAGCTCTAACCAGGGCCAGGG + Intronic
1137608694 16:49804508-49804530 GAGACCTGGGAACAGGCCCAGGG + Intronic
1137769737 16:51006464-51006486 GAGGTCTCTGACCAGGCCTGTGG + Intergenic
1139595481 16:67955297-67955319 GAGAGTCATGACCAGGCCCCAGG + Intronic
1140229584 16:73106536-73106558 GACTGATTTGACCAGGCCCAAGG - Intergenic
1141550951 16:84806448-84806470 AGAAGCTCTGGCCAGGCCCAGGG - Intergenic
1142590895 17:1005516-1005538 GAAAGCTCTGAAGAGGCCCTGGG - Exonic
1145260468 17:21351803-21351825 GACAGCACTAACCACGCCCAGGG + Intergenic
1146011918 17:29201376-29201398 GAAAGGACTGACCATGCCCATGG + Intergenic
1146402693 17:32512463-32512485 GAGGGCACTAAGCAGGCCCAGGG + Intronic
1146653311 17:34620564-34620586 GAGACCTCTGTGCAGGCACAGGG + Intronic
1146923209 17:36727521-36727543 GAGAGCTCTCACCAGAGCCTAGG + Intergenic
1147840675 17:43369179-43369201 GAGAGCTCAGACAAGCCACAGGG + Intergenic
1147947373 17:44087576-44087598 GGGAGCCCTGACCATGCCCCGGG - Exonic
1150132824 17:62678534-62678556 AAGAGCTGGGTCCAGGCCCAGGG + Exonic
1151321370 17:73354577-73354599 GAGGGGTCTGGCTAGGCCCAGGG - Intronic
1151583205 17:74991930-74991952 GAGAGCTCTGACCTGGCAACGGG + Intronic
1152466272 17:80468392-80468414 GACAGCTCCCACCTGGCCCACGG + Exonic
1152744653 17:82033161-82033183 GAGAGCTGTGACCACCACCACGG - Intronic
1153962357 18:10150318-10150340 GGGAGCTCAGCCCATGCCCATGG - Intergenic
1155106998 18:22676984-22677006 GAGAGATCTGAACAAGCCCTTGG + Intergenic
1155312817 18:24541037-24541059 GAGAACGATGACCAGGCCCTGGG - Intergenic
1156360638 18:36381569-36381591 CAGAGCTCAGACCAGGACCAAGG - Intronic
1158725704 18:59969673-59969695 GGGAGCGCGGACGAGGCCCACGG + Intergenic
1160443950 18:78913151-78913173 GGAGGCTCTGACCCGGCCCAGGG + Intergenic
1161097527 19:2401441-2401463 GGGAGCACTCACCAGCCCCAGGG - Intronic
1161348148 19:3778104-3778126 GGGGGCACTGACCAGGCCCAAGG - Exonic
1162700910 19:12513908-12513930 GCGAGCTCTGAACAGTCCAATGG - Intronic
1162830538 19:13281853-13281875 CAGTGCTCAGACCAGGCCCCAGG - Intronic
1163522049 19:17797321-17797343 AAGAGCTCTGACCAGCCTGAAGG + Intronic
1163755979 19:19106340-19106362 CCGCGCTCTGACCAGGTCCAGGG - Exonic
1165102620 19:33447756-33447778 GGCAGCTGTGGCCAGGCCCATGG + Intronic
1166250784 19:41569653-41569675 GAGAGCCCTGGCCAGGCTGATGG + Intronic
1166909066 19:46138332-46138354 GGGAGCTGGTACCAGGCCCATGG + Intergenic
1168122470 19:54259560-54259582 CTGGGCTCTGCCCAGGCCCAGGG + Intronic
1168405544 19:56108418-56108440 GAGAGCTCTGGGCAGGGGCAGGG - Intronic
1168651182 19:58093259-58093281 GCCAGCTCTGCCCAGGCCAAGGG - Intronic
925329435 2:3047048-3047070 GGGATCTCTGAGAAGGCCCATGG - Intergenic
925557523 2:5147877-5147899 GAAGGCTCTGATGAGGCCCAGGG - Intergenic
925571336 2:5315799-5315821 CAGAGCTCTGCCCAGACCAAGGG + Intergenic
925989440 2:9242236-9242258 TAGAGATCTGACCTGGTCCATGG + Intronic
926885277 2:17591977-17591999 TAGAGTTCTGAGCAGTCCCATGG - Intronic
927207178 2:20618085-20618107 GGGAGCCCTGCCCAGGCCCCAGG + Exonic
928834324 2:35524489-35524511 GAAATCTCTGTCCAGTCCCATGG + Intergenic
929127286 2:38533386-38533408 GACAGCTCAGACCAAGCCAAAGG - Intergenic
930604038 2:53473942-53473964 GAGAGCCCTGACTAGGGCCCTGG + Intergenic
932390835 2:71389440-71389462 GCTAGCACTGACCAGTCCCATGG - Intronic
933741149 2:85535012-85535034 TAGAGGTCAGACCAGGCTCAAGG + Intergenic
934754151 2:96813949-96813971 CAGAGCTGTGACTAGGCCAATGG - Intergenic
937064974 2:119011071-119011093 GTGAACTCCTACCAGGCCCAGGG + Intergenic
937313637 2:120917375-120917397 GACAACTCAGACCTGGCCCAGGG + Intronic
937320867 2:120959965-120959987 GTGAGCTCTGTGCAGGCGCAGGG + Intronic
937451961 2:122009553-122009575 GAGAGGGCAGACCAGGCACAAGG + Intergenic
937949262 2:127371168-127371190 GCTAGCACTGACCAGTCCCATGG - Intronic
938115019 2:128596844-128596866 GGGAGCCCTGAGCAGCCCCAAGG + Intergenic
946117661 2:217477742-217477764 TTGAGCACTGCCCAGGCCCAAGG - Intronic
947737925 2:232467317-232467339 GAAACCTCTGCCCAGACCCATGG + Intergenic
948017462 2:234702028-234702050 GGGAGCTCAGAACAGGCCCTGGG + Intergenic
948080149 2:235199055-235199077 GAGAGATCTGGCCAAGCCAAGGG + Intergenic
948349547 2:237327385-237327407 GAGAGGTCTGCCCAGAGCCACGG + Intronic
948763619 2:240208366-240208388 GAGAGGTCCCAGCAGGCCCATGG + Intergenic
1168778830 20:471518-471540 GCTAGCACTGACCAGTCCCATGG + Intergenic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1172449946 20:35014918-35014940 GAGAGCTCTGAACAGGACATTGG - Intronic
1172931327 20:38588324-38588346 GGGAGCAGTGAGCAGGCCCATGG + Exonic
1173338103 20:42129715-42129737 GAGAGCTCTGGACATCCCCAAGG + Intronic
1174334749 20:49851582-49851604 GAAAGCTCTGACTGGCCCCATGG - Intronic
1175363332 20:58432331-58432353 GAGAGCTCTGAGGAGGAACAAGG - Intronic
1176177745 20:63736702-63736724 GAGGGCACTTACCAAGCCCACGG - Exonic
1176203397 20:63874761-63874783 GAGAGCACTGATCAGGTCCTTGG + Intronic
1176866185 21:14056340-14056362 CAGAGTTCAGACCAGGGCCAGGG + Intergenic
1178349998 21:31866110-31866132 AAGAGCCCTGCCCAGGGCCACGG + Intergenic
1179799721 21:43805349-43805371 GGGAACACTGACCAGGCCCAGGG - Intergenic
1180723358 22:17926079-17926101 GAGAGCTTTGACCAGCATCAAGG - Intronic
1180857526 22:19057864-19057886 GTGGGCTCTGGCCATGCCCAGGG + Intronic
1181305847 22:21916836-21916858 AAGAGCTGGGACCAGGCCCTGGG - Intergenic
1181359141 22:22321886-22321908 GAGAGCACTGACCAGCCCCATGG - Intergenic
1181369247 22:22403639-22403661 GAGAGCAGTGACCAGCCCCATGG - Intergenic
1181427770 22:22855453-22855475 AAGAGCTGTGACCAGCCTCATGG - Intronic
1181508784 22:23379612-23379634 CAGAGCTCTGCCCAGGGCCCAGG - Intergenic
1182250604 22:28997120-28997142 AACAGCTGTGACCAGGTCCATGG - Intronic
1183727535 22:39597875-39597897 GAGAGCTCCCCTCAGGCCCAGGG - Intronic
1184954572 22:47877159-47877181 GAGGCCTCTGAGCAGGCCAAGGG - Intergenic
950018502 3:9770091-9770113 GAGATCTCTGACCAGAAGCAGGG - Intronic
951072692 3:18351186-18351208 GTGAGCTCTGCCCAAGACCATGG + Intronic
953223926 3:40999274-40999296 GAGAGTTCTGAGAAAGCCCATGG - Intergenic
953236375 3:41111108-41111130 CAGAGCTCTGCCCAGACCCCAGG + Intergenic
955987740 3:64592373-64592395 GAGAACTGTGTGCAGGCCCAAGG + Intronic
960969656 3:123130438-123130460 CAGAGCTCAGAGCAGGCCCTGGG - Intronic
961635347 3:128329605-128329627 GCCAGCTCTGCCCAGGCACAGGG + Intronic
961805060 3:129483425-129483447 GTGAGCGCTGACCAAGCCCAGGG + Intronic
962709142 3:138071053-138071075 GGCAGCTATGACCTGGCCCAAGG + Intronic
962917228 3:139915408-139915430 GAGATCTCTGTCCAGGCCACAGG + Intergenic
964335351 3:155648911-155648933 GAGTGCTGTGACAATGCCCAGGG + Intronic
964630434 3:158803708-158803730 GAGAGATCTGACCATGCACTCGG - Intronic
965562909 3:170078627-170078649 GTTAGCACTGACCAGTCCCATGG - Intronic
967299641 3:188000451-188000473 GAGAGCCCTGATCAGGCACGGGG + Intergenic
969250367 4:5964216-5964238 GAGAGCTCTGAGCAGCCTCTTGG + Intronic
970170961 4:13290343-13290365 GAGAACTTGGACCAGGCCCATGG + Intergenic
970260882 4:14223375-14223397 GAGAGACCTGGCCATGCCCATGG - Intergenic
970394668 4:15654744-15654766 GAGAGCCCCGAACAGGCCCGGGG + Intronic
971219425 4:24691523-24691545 AAGAGCTCTGACATGGACCAAGG + Intergenic
975220064 4:71804583-71804605 GCTAGCACTGACCAGTCCCATGG + Intergenic
975220633 4:71809094-71809116 GCTAGCACTGACCAGTCCCATGG + Intergenic
979728450 4:123992512-123992534 AAGAACTCTGTGCAGGCCCATGG - Intergenic
982133182 4:152248140-152248162 GAGAGCTGTGACCAGGCATCAGG + Intergenic
985472569 5:54656-54678 CACAGCTCTGGCCAGGACCAGGG + Intergenic
985619988 5:949098-949120 GGGAGCTCTGAGCAGGGCTAAGG + Intergenic
985647412 5:1091435-1091457 GAGCACTCGGACCAGGCCCGTGG + Intronic
985856027 5:2428056-2428078 GAGGGCACTGACCAGGACCAGGG + Intergenic
986556475 5:9014932-9014954 TAGGGCTCTCAGCAGGCCCAAGG + Intergenic
987293076 5:16526141-16526163 GAGAGCTCTCCCGATGCCCATGG + Intronic
995082908 5:108074987-108075009 GATTGCTCTGTCCAGTCCCATGG + Intronic
997102810 5:130987519-130987541 CAGAGATGTGAGCAGGCCCACGG + Intergenic
998526822 5:142850107-142850129 CAGAGCTCTGAAGAGGCCTAGGG - Intronic
999359681 5:150972609-150972631 GATAACTCTGTCCATGCCCAAGG + Intergenic
1000295442 5:159909337-159909359 GAGAGGACAGACCAGGCCCCAGG - Intergenic
1001642210 5:173252476-173252498 GAGAGCCGAGACCAGCCCCAAGG - Intergenic
1001673761 5:173495550-173495572 GTGAGATGTGACCAGACCCAAGG + Intergenic
1005185803 6:23162209-23162231 GCTAGCACTGACCAGTCCCATGG - Intergenic
1005481370 6:26258407-26258429 GCTAGCACTGACCAGTCCCATGG - Intergenic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1007466872 6:42058669-42058691 GAGAGATCTGACCAAGGGCAAGG - Intronic
1007477327 6:42127581-42127603 GAGAGCTCAGACCAGGGCAAGGG + Intronic
1007958008 6:45934574-45934596 GAGAGGTCTGAAAAGCCCCAGGG - Intronic
1009943133 6:70312644-70312666 GAGAGCCCTGGCGAGGCCCTTGG - Intergenic
1011248342 6:85343550-85343572 GAGAGCTGTGGCAATGCCCATGG + Intergenic
1012587913 6:100946130-100946152 GCTAGCACTGACCAGTCCCATGG - Intergenic
1014089512 6:117387803-117387825 GAGGGCTCTGACCAGGGGCCTGG + Exonic
1014841371 6:126224456-126224478 GGGGGCTGGGACCAGGCCCATGG + Intergenic
1016154012 6:140781050-140781072 GTGAGCTCTGCTCTGGCCCAAGG - Intergenic
1018286157 6:162239993-162240015 GAGATCTATGGCCAGGTCCAAGG + Intronic
1019642915 7:2114301-2114323 GAGAGCCCTGAGCCAGCCCACGG + Intronic
1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG + Intronic
1019962506 7:4472756-4472778 GTGTGCTCTGATGAGGCCCACGG - Intergenic
1020531655 7:9345797-9345819 GATATCTCTGACCAGAACCATGG - Intergenic
1021992707 7:26152853-26152875 GGGAGCGCGGACGAGGCCCACGG + Exonic
1022497768 7:30863918-30863940 GGGAGCTCTCACAAGCCCCAAGG + Intronic
1024867230 7:53917942-53917964 GAGAGCTCTAAGGAGGCCAATGG - Intergenic
1029618225 7:101673442-101673464 GAGTGATCTGGCCAGGCCCTGGG - Intergenic
1029708887 7:102288990-102289012 CAGGGCTCTGACCAGTCCCCTGG - Intronic
1031156236 7:118115365-118115387 GCTAGCACTGACCAGTCCCATGG - Intergenic
1032859376 7:135862910-135862932 CAGAGCTCTGTCCTGGCCCCTGG + Intergenic
1034051555 7:147989445-147989467 GAGAGCTCTGACTATGTGCAAGG - Intronic
1035992830 8:4511068-4511090 GAGAGTGCTGACCAGGCTGAAGG - Intronic
1036107457 8:5856273-5856295 GCTAGCACTGACCAGTCCCATGG + Intergenic
1036203809 8:6791047-6791069 GAGAGCTCTGAACATGACAAAGG + Intergenic
1038101859 8:24387015-24387037 GCTAGCACTGACCAGTCCCATGG + Intronic
1038450267 8:27634773-27634795 GAGAGGTCAGTCCTGGCCCATGG - Intronic
1039063691 8:33591979-33592001 GAGAGGTCAGGCCAGGCCCGTGG - Exonic
1039404675 8:37302304-37302326 GACAGGGCTGAGCAGGCCCAGGG - Intergenic
1041739850 8:61146468-61146490 GAAATCTGTGCCCAGGCCCATGG + Intronic
1042178827 8:66064414-66064436 GAGAGCTTTGACTAGAACCAGGG + Intronic
1042795864 8:72662606-72662628 AAGAGCACTGACCAGGATCAGGG - Intronic
1045971112 8:108081478-108081500 GACAGCTCTCACCAGGTCCCTGG + Intronic
1049216708 8:141411634-141411656 AAGAGCTCTGACCTGGCCTCGGG - Intronic
1049384252 8:142333135-142333157 CACAGCTCTGTCCAGGCACAGGG - Intronic
1049913234 9:290597-290619 GAGAGTGCTGTCCAGGTCCATGG - Intronic
1050572582 9:6956717-6956739 ATGAGGTCTGACCAGGCCCAGGG + Intronic
1051152318 9:14096364-14096386 GAGTGCTCTGAACAGGCCACCGG + Intronic
1052763668 9:32618524-32618546 GAGAGCTGTTCCCAGGCACAGGG + Intergenic
1057227981 9:93302459-93302481 GAAAGCTCTCCCCAGGCCCTAGG - Intronic
1058047044 9:100367959-100367981 GCTAGCACTGACCAGTCCCATGG + Intergenic
1058735342 9:107888957-107888979 AATAGCCCTGACCAGGCCCTGGG - Intergenic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1060308444 9:122437765-122437787 GACATATCTGACCAGGCCAAGGG + Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060638720 9:125220718-125220740 GATGGCCCTGACCAGCCCCAAGG - Intronic
1061398100 9:130354399-130354421 CAGAGCTCTGTCCCGGCCCTGGG + Intronic
1061449730 9:130661509-130661531 GAGAGCTCCGGCCCGGCCGAGGG + Intergenic
1061486324 9:130922274-130922296 GAGACCCCAGACCAGGCCCGGGG - Intronic
1061841242 9:133359650-133359672 GAGGGCACTGACCAGGCCCAAGG - Intronic
1061956921 9:133968572-133968594 GGCAGCTCTGTCCAGGCCCCCGG - Intronic
1062019834 9:134313969-134313991 GAGAGCCTTGCCCAGGCTCATGG + Intergenic
1062344392 9:136108236-136108258 GAGAGCTGGGGGCAGGCCCAAGG + Intergenic
1062623586 9:137433392-137433414 GACGGCCCTGACCAGGCCCTGGG + Intronic
1185575076 X:1164894-1164916 GAGAGGGCTGACCAGGAGCAAGG - Intergenic
1185633652 X:1535895-1535917 GACAGATCTGACAAGACCCAAGG + Intronic
1187458966 X:19468052-19468074 CAGAGCTCTGACCAGGAGAAAGG + Intronic
1188085122 X:25894372-25894394 GCTAGCACTGACCAGTCCCATGG - Intergenic
1188889731 X:35595328-35595350 GAGAGCTCTCACCATGCACCTGG + Intergenic
1190024196 X:46907771-46907793 GAGGGCTCTCACCATTCCCAGGG - Intergenic
1191773261 X:64785249-64785271 GCTAGCACTGACCAGTCCCATGG + Intergenic
1193196624 X:78639665-78639687 GAGAGCTGTGACCAGCCAAAGGG + Intergenic
1194872783 X:99153516-99153538 GAGGGCTGGGACAAGGCCCAAGG - Intergenic
1195162015 X:102180359-102180381 GCTAGCACTGACCAGTCCCATGG + Intergenic
1199623659 X:149721181-149721203 GCTAGCACTGACCAGTCCCATGG - Intergenic
1200145262 X:153923085-153923107 GGGAGCTCTGCCCAGACCCCGGG - Intronic
1200401513 X:156022874-156022896 AAGAGCTCTGGCAAGGCCCTGGG - Intergenic
1201401476 Y:13608589-13608611 GCTAGCACTGACCAGTCCCATGG - Intergenic