ID: 1108437985

View in Genome Browser
Species Human (GRCh38)
Location 13:50420233-50420255
Sequence TGTTGCCTTGAGGGGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108437979_1108437985 -8 Left 1108437979 13:50420218-50420240 CCTCTAAGTAGAAGCTGTTGCCT 0: 1
1: 0
2: 1
3: 11
4: 106
Right 1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG 0: 1
1: 0
2: 1
3: 17
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108437985 Original CRISPR TGTTGCCTTGAGGGGGGATC TGG Intronic
902197872 1:14811072-14811094 TGTTGCTTTGAGGGGGGAAATGG - Intronic
902705051 1:18198915-18198937 TCTTGCTTTGGGGGGGCATCTGG - Intronic
904944269 1:34187828-34187850 TGTTCCCTGGAGGGAGAATCAGG + Intronic
906222195 1:44089581-44089603 TTCTTCCTTGAAGGGGGATCTGG + Intergenic
907858565 1:58327907-58327929 TCTTTCCTTGAAGGGGGATCTGG - Intronic
914879927 1:151539406-151539428 TGTTGCCTTGAAGAGGGAGCTGG + Intergenic
915736978 1:158091268-158091290 GGGTGCCTTGAGGGTGGATCAGG + Intronic
916474411 1:165154957-165154979 AGTTGGCTTGAAGGGAGATCAGG - Intergenic
917792885 1:178510912-178510934 TTTTGCCCTGAAGGGGGATTAGG + Intergenic
917918658 1:179730317-179730339 TGCTTCCTTGGGTGGGGATCGGG - Intergenic
1064120070 10:12610921-12610943 TGTTCCCTTAAGGGGTTATCGGG - Intronic
1067541031 10:47153313-47153335 GGTTGCCTTGATGAGGAATCTGG - Intergenic
1067824875 10:49563646-49563668 TGTTGCATTGAGATGGGCTCTGG - Intergenic
1076354523 10:129842206-129842228 TGTTGCCCAGGGTGGGGATCTGG + Exonic
1079344976 11:19644116-19644138 TGTTGCCCTGGAGGGGGATGGGG + Intronic
1085493828 11:76948326-76948348 TGTTCCCTTGAGGGTAGATGGGG + Intronic
1086102306 11:83113934-83113956 GGTTGCCGTGAGGTGAGATCAGG - Intergenic
1086401139 11:86461725-86461747 TCTTTCCTTGAAGGAGGATCTGG + Intronic
1089208349 11:116783524-116783546 TGTTACCTTGAGGAGGTCTCTGG + Exonic
1089677869 11:120102323-120102345 TGGTCCCTGGAGAGGGGATCTGG - Intergenic
1089718732 11:120391352-120391374 TGTTTCCTTAATGGGGAATCTGG + Intronic
1094059667 12:26300418-26300440 TCATTCCTTGAAGGGGGATCTGG - Intergenic
1095096233 12:38150860-38150882 TGTTGCCTTGGGGGTGGACAGGG + Intergenic
1101560703 12:105855143-105855165 GCTTGCCTTGACGTGGGATCCGG + Intergenic
1103300842 12:119925395-119925417 TGCATCCTTGAAGGGGGATCTGG + Intergenic
1104132773 12:125910322-125910344 TGTTGTGTTGAAGGAGGATCTGG + Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1109883868 13:68517162-68517184 TTCTTCCTTGAAGGGGGATCTGG - Intergenic
1112127225 13:96481379-96481401 TGTTCCTTTTAGTGGGGATCTGG + Intronic
1115350597 14:32390774-32390796 TGTTGCCTTCAGGGGGTATGTGG + Intronic
1116967558 14:51030278-51030300 TGTTTCCTAGAGGGGGAATCAGG - Intronic
1117162927 14:53006862-53006884 TCATGCCTTGAGTGGGAATCGGG + Intergenic
1118768843 14:68928384-68928406 TACTGCCTTGAAGGGGGCTCTGG + Intronic
1119427464 14:74545125-74545147 TGTTTCCTTCAGGGAGGCTCAGG + Intronic
1119896726 14:78226064-78226086 TGTTGCAGTGAGCGGAGATCAGG - Intergenic
1120380851 14:83777512-83777534 TTTTGCCTTGAGGAAGGAACTGG + Intergenic
1121224535 14:92311549-92311571 TGATGCCTTTAGTGGGGGTCTGG - Intergenic
1122208739 14:100161211-100161233 TGTTGTCCTGAGGGTGGAGCTGG - Intergenic
1122320596 14:100852949-100852971 GGAGGCCATGAGGGGGGATCAGG + Intergenic
1122903110 14:104790092-104790114 TGGTGCCTTCAGGGGTGATGTGG - Intronic
1126453974 15:48841433-48841455 TGCTTCCTTGAAGGGAGATCTGG - Intronic
1126765103 15:52003545-52003567 TCTTTCCTTGGAGGGGGATCTGG + Intronic
1127130986 15:55863379-55863401 TGTTGTTTTGAGATGGGATCTGG - Intronic
1127892531 15:63268059-63268081 GGTTGCCGTGAGCTGGGATCGGG + Intergenic
1130676650 15:85958695-85958717 CATTGCCTGGAGGTGGGATCTGG + Intergenic
1135102858 16:19622205-19622227 AGTTGCCATGAGTGGAGATCGGG - Intronic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1137555346 16:49466985-49467007 TGTTGCCTGAAGTGGGGATGGGG - Intergenic
1138951457 16:61918283-61918305 TGTAGCCTGGAGAGGTGATCAGG + Intronic
1141153324 16:81579617-81579639 TGTTGCCTTCAGGGGGGAGCAGG - Intronic
1141237823 16:82235581-82235603 TCTTTCCTTGATGGGAGATCTGG + Intergenic
1144099344 17:11930238-11930260 GGTTGCCCTGAGTGGGCATCAGG - Intronic
1145245720 17:21268178-21268200 TCTTGCATTGAGGGAGGATTGGG - Intergenic
1147946596 17:44083805-44083827 TGCTGCCTTGTGGGGGCATCGGG - Exonic
1148086823 17:44998632-44998654 TGTCGCCTTTAGGAGGGGTCAGG + Intergenic
1148619407 17:49022939-49022961 TGTTCCCTTGAGGGAGGTCCTGG + Intronic
1149739680 17:59033493-59033515 GGTTGCCGTGAGTGGAGATCGGG - Intronic
1157281155 18:46347155-46347177 TGCTGCCTTGGGGAGTGATCGGG + Intronic
1158321575 18:56269752-56269774 TCTTTCTTTGAAGGGGGATCTGG + Intergenic
1160143785 18:76348106-76348128 GGGTGCCTTGAGGGCGGAGCAGG - Intergenic
1161268891 19:3378584-3378606 TGAGGCCTTGAGGGGGAACCCGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161773041 19:6241698-6241720 TGTTTCCTAGAGGGCGGGTCTGG - Intronic
1163659570 19:18568642-18568664 CGGTGCCTTGAGGGGGTCTCAGG + Exonic
1164563139 19:29307941-29307963 AGGTGCCTTGAGGGGGCAGCGGG - Intergenic
1165737056 19:38183502-38183524 ACTTGCCTTGAGTGGGGAGCAGG + Intronic
1167488252 19:49776065-49776087 TGTTGCCGTGAGGGGTGTTCGGG - Intronic
927429107 2:23011896-23011918 TGTGGCCTTGAGGAGGGAGATGG + Intergenic
929179707 2:39023922-39023944 TGTTTACTTGAGGAGGGAACTGG + Intronic
935357897 2:102221559-102221581 TGTTGGCATGAGGGAGGATAAGG - Intronic
938298978 2:130197029-130197051 TGTAGCCTTGAGAGGGATTCAGG - Intronic
938457745 2:131477485-131477507 TGTGGCCTTGAGAGGGATTCAGG + Intronic
939575404 2:143889057-143889079 TCTTGCCTTGAAGAGGGATGGGG - Intergenic
941763020 2:169265285-169265307 TGTTGCCTTGGGGAGCAATCTGG + Intronic
942077865 2:172373506-172373528 TGCTGCCTGGAGGGGGGTCCAGG - Intergenic
945991620 2:216400131-216400153 TGTGGCCTTGGGGGGTGATCAGG + Intergenic
946586796 2:221198264-221198286 AGTTGCCTTGCGGGGTGCTCTGG + Intergenic
948708506 2:239810682-239810704 TGTTGACTTGAGGGTGGCCCTGG + Intergenic
1169899484 20:10538334-10538356 TGATGCCTTGCGGTGGGAGCTGG + Intronic
1172747866 20:37226954-37226976 TGTTGCCTTGAGGCAGCTTCAGG + Intronic
1175529385 20:59663738-59663760 TGTGGCCTTGAGGAGGGTTCTGG + Intronic
1176389883 21:6158016-6158038 AGTTGCCTTGAGGGGCGATGAGG - Intergenic
1176869744 21:14075219-14075241 TGTTGCCTTGGGGGTGGACCCGG - Intergenic
1178111945 21:29377483-29377505 TGTGGCCTTGAAGGGTGACCTGG + Intronic
1179733584 21:43380224-43380246 AGTTGCCTTGAGGGGCGATGAGG + Intergenic
1181480743 22:23197802-23197824 TGTTGTCTTGAGGGGCGGTGGGG + Intronic
1182109866 22:27715489-27715511 AGTGGCTTTGAGGGAGGATCTGG - Intergenic
1182143642 22:27983516-27983538 TGTTGCCTGCAGGGCGGGTCTGG + Exonic
1183211443 22:36453919-36453941 GGATGCCTGGAGTGGGGATCTGG + Intergenic
1183708639 22:39489772-39489794 TGTGGCCTTGAGGGGGAAGTGGG + Exonic
1184771086 22:46596963-46596985 TGCTGCCTCCAGGTGGGATCGGG + Intronic
949979261 3:9490432-9490454 GGTTGCCGTGAGGTGAGATCAGG + Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
957432776 3:80134033-80134055 GGTTGCCTTGAGCCGAGATCAGG + Intergenic
959860361 3:111208723-111208745 TCTTCCCTTGAAGGGGGATGTGG + Intronic
961003015 3:123386615-123386637 GGTAGCCTTGAGGGAGGGTCGGG - Intronic
961468389 3:127095902-127095924 TGTTGCCATGGCAGGGGATCTGG + Intergenic
962065019 3:131970509-131970531 TGTTTCCTTGATGGGGCATTTGG + Intronic
962197355 3:133375893-133375915 TGTTACAGTGAGAGGGGATCTGG - Intronic
968552595 4:1231360-1231382 TGTTGGCTTGAGGTGGTTTCTGG - Intronic
969162395 4:5272583-5272605 TGTAGCCTTGAAGGAGGAACTGG - Intronic
971638782 4:29101077-29101099 TTTTTCCTTGAAGGGTGATCTGG + Intergenic
972629763 4:40833037-40833059 TGTTGCCTTGATGGTGGTTGAGG - Intronic
973165468 4:47071532-47071554 TGCTGGCTTGAGAGGGGAGCAGG - Intronic
977460461 4:97319213-97319235 GGTTGCCATGAGGGTGGAACTGG + Intronic
978546961 4:109880367-109880389 TGGTGCCTTGATGTGGGCTCTGG - Intergenic
980295001 4:130901583-130901605 TGTTGCAATGAGGTGAGATCAGG + Intergenic
982051664 4:151508422-151508444 TCTTGCCTTGAGCTGGGATCTGG + Intronic
984657051 4:182329346-182329368 TGTTGCCTTGTGGGAGCAGCTGG + Intronic
985580113 5:691895-691917 TGTTGTCTTGATGGGGGTTTGGG - Intronic
985580270 5:692474-692496 TGTTGTCTTGATGGGGGTTTGGG - Intronic
985879179 5:2625563-2625585 TGGTCCCATGAGGAGGGATCTGG - Intergenic
987652563 5:20761910-20761932 GGTTGCCTTGAGCAGGGCTCTGG - Intergenic
988742997 5:34099572-34099594 GGTTGCCTTGAGCAGGGCTCTGG + Intronic
997530647 5:134579347-134579369 TGAGGCCTTGTGGGGGGACCAGG - Exonic
999449743 5:151668965-151668987 TGTTGCCTTGGAGGGGGAGCAGG + Intronic
1001935081 5:175697901-175697923 TGTTGCCATGAGGGGTGTTTGGG - Intergenic
1003011134 6:2428559-2428581 TCTTGCCTTGAGAGTAGATCTGG + Intergenic
1007275607 6:40671334-40671356 TGTTGCCTTGAAGGCGGGGCAGG - Intergenic
1007816838 6:44530863-44530885 TCTTTCCTTGAAGGGGGATCTGG + Intergenic
1015231548 6:130920854-130920876 TGTTGGCTAGATTGGGGATCAGG - Intronic
1016775144 6:147896997-147897019 GGTTGTCTGGAGGTGGGATCGGG + Intergenic
1017734792 6:157351988-157352010 TGGTTCCTTGAGGTGGAATCTGG + Intergenic
1018320095 6:162599331-162599353 TGTGGCCTTGATGGTGGACCAGG + Intronic
1019345475 7:527816-527838 TGTTTCCTTGAGGTCCGATCAGG - Intergenic
1023387765 7:39677196-39677218 TGGTTCCTTGAGGGGGCTTCAGG - Intronic
1024913353 7:54470816-54470838 TGTTGCCTAGAGGGAGGGTGTGG - Intergenic
1027434815 7:78153518-78153540 TATTGCCTTGAAAGGGGAGCTGG + Intronic
1029166430 7:98594752-98594774 TGGTGCCAGGAGGGGAGATCAGG + Intergenic
1030583628 7:111390069-111390091 TGCTTCTTTGAAGGGGGATCTGG - Intronic
1031863438 7:127010209-127010231 TGTTGCCTTGAGGGAGATTGAGG - Intronic
1032162888 7:129524160-129524182 TTTTGCCTGGAGGGGACATCTGG - Intergenic
1032460388 7:132105909-132105931 TGTTGTCTTGGGGTGGGATTGGG + Intergenic
1033313896 7:140282202-140282224 TGGGGCCTTGAGGTGGGGTCTGG + Intergenic
1034242699 7:149622528-149622550 TTTTGCCTTGGGTGGGGAGCTGG + Intergenic
1039870190 8:41539552-41539574 TGTGGCCTGGAGGTGGGATAGGG - Intronic
1039922043 8:41900053-41900075 TGTTGATTTGAGGGGGACTCAGG - Intergenic
1045677716 8:104626673-104626695 TGTTACCTTGTGGGGGGAAAAGG - Intronic
1048968134 8:139628724-139628746 TGATGCCTTAAGGGGGGAAATGG + Intronic
1050044642 9:1530034-1530056 TCCTTCCTTGAGGGGAGATCTGG + Intergenic
1050137279 9:2479627-2479649 TGTAGAATTGAGGGGGGGTCAGG - Intergenic
1050456918 9:5843485-5843507 TATTTCCCTGAGTGGGGATCAGG + Intergenic
1057083119 9:92187635-92187657 TGTAGTCTTGAGGGAGGATGAGG - Intergenic
1057515177 9:95714465-95714487 TCTTTCCTTGATGGGGGATCTGG + Intergenic
1059679069 9:116568735-116568757 TACTACCTTGATGGGGGATCAGG + Intronic
1061962115 9:133993491-133993513 TGTGGCCTAGAAGGGAGATCAGG - Intergenic
1190324330 X:49197602-49197624 TGTAGCCTCGAGGTGGGAGCTGG + Intronic
1192369438 X:70501000-70501022 TGCTGCCCTGCGGGGGGTTCTGG + Intronic