ID: 1108438557

View in Genome Browser
Species Human (GRCh38)
Location 13:50425631-50425653
Sequence AAAAACAACCTCACATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108438557_1108438560 3 Left 1108438557 13:50425631-50425653 CCCAGAGATGTGAGGTTGTTTTT 0: 1
1: 0
2: 0
3: 25
4: 342
Right 1108438560 13:50425657-50425679 ATCCTAGAATTGGAGATAGAAGG 0: 1
1: 0
2: 3
3: 12
4: 191
1108438557_1108438559 -7 Left 1108438557 13:50425631-50425653 CCCAGAGATGTGAGGTTGTTTTT 0: 1
1: 0
2: 0
3: 25
4: 342
Right 1108438559 13:50425647-50425669 TGTTTTTCAGATCCTAGAATTGG 0: 1
1: 0
2: 0
3: 22
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108438557 Original CRISPR AAAAACAACCTCACATCTCT GGG (reversed) Intronic
900774559 1:4572411-4572433 TGAAACAACACCACATCTCTAGG - Intergenic
901161470 1:7179627-7179649 AAAAACAACCTATTAACTCTTGG + Intronic
901625518 1:10622468-10622490 AAAATCAACAACACATTTCTGGG - Intronic
902578682 1:17394690-17394712 AAATCCAACCACATATCTCTTGG - Intronic
902592697 1:17486340-17486362 ATAAATAACCTCCCCTCTCTGGG - Intergenic
902953254 1:19904845-19904867 AAAAACCACTTCAAAACTCTGGG - Intronic
903005565 1:20295845-20295867 ACCTACAACCTCACATCTATGGG - Intronic
903289556 1:22299715-22299737 AAAAAAAGACTCAAATCTCTGGG + Intergenic
903419363 1:23207430-23207452 AAAAACAACAACAGATATCTAGG + Intergenic
904446285 1:30575439-30575461 AAAAACTACCTCATATCTCCAGG + Intergenic
906625964 1:47325940-47325962 AAAAACAACCTCCCAAGACTGGG - Intergenic
907043186 1:51281760-51281782 AAAAAAAACCTCAGATTTCAGGG + Intergenic
907637658 1:56152463-56152485 AAAAAAAACCTCAGATGTCAAGG + Intergenic
908610369 1:65852035-65852057 GAAATCAGCCTTACATCTCTAGG + Intronic
908738706 1:67305377-67305399 AAAAACAACCAAACATATGTTGG - Intergenic
908949487 1:69542679-69542701 AAAGACAGCCTGACATCTCAAGG + Intergenic
909015721 1:70377462-70377484 AGAAACAACAGCACATATCTAGG - Intronic
910013411 1:82492843-82492865 AAAAACAACAAAACATTTCTTGG - Intergenic
911903419 1:103533414-103533436 AAAAACTACCACAAATCTCAGGG - Intronic
912426942 1:109602143-109602165 TAAAACAAGCTCACCTGTCTTGG + Exonic
912623621 1:111190179-111190201 AAAAACTACCTCACAGCTTTGGG + Intronic
914427657 1:147592893-147592915 AAAAATTACCTAACCTCTCTAGG - Intronic
915296210 1:154923597-154923619 AAAGACAACTTCAGTTCTCTGGG - Intergenic
918540496 1:185626786-185626808 AAAAACAACCCCAAAACTCTTGG + Intergenic
919196124 1:194288447-194288469 ATAAACAAGCTCATTTCTCTAGG - Intergenic
920023677 1:202976065-202976087 AAAAACAGCCCCACCTCCCTTGG - Intergenic
920507220 1:206525163-206525185 CAACACAACCACACATCCCTAGG - Intronic
920566814 1:206980704-206980726 AAAAATAATCTTTCATCTCTTGG + Intergenic
921627357 1:217391663-217391685 AGAAACAACTTCATATATCTTGG - Intergenic
921634006 1:217470304-217470326 ATGAACAGCCTCTCATCTCTAGG - Intronic
921771522 1:219046425-219046447 AAATATAACCTCAAATCTCATGG + Intergenic
923234057 1:232015325-232015347 GAAAACAACCTCAGGGCTCTTGG + Intronic
1064841342 10:19595961-19595983 AAATTCAAACCCACATCTCTAGG - Intronic
1065112353 10:22452651-22452673 ACAAACCCCCTCACCTCTCTGGG - Intronic
1066682171 10:37944914-37944936 AAAAAAAACTTCATATTTCTTGG - Intergenic
1067423950 10:46187362-46187384 AAAAACAATCTTGCATTTCTGGG - Intergenic
1067900907 10:50240563-50240585 AAAAACAAGCTGGCATCTCAAGG + Intronic
1068177069 10:53474823-53474845 AAAAATAAATTCACCTCTCTGGG - Intergenic
1068613259 10:59084202-59084224 TAAAACAACCTCATAAGTCTGGG - Intergenic
1069167793 10:65185480-65185502 TAAATCAACCTTACATTTCTAGG + Intergenic
1069764782 10:70847121-70847143 AAAAAAAACCTCAAATGGCTTGG - Intronic
1071767480 10:88684124-88684146 ACAAAAATCCTCACAACTCTGGG - Intergenic
1071855075 10:89616007-89616029 AAAACCAACATCACTCCTCTTGG - Intronic
1072209404 10:93232686-93232708 AAAAACAATATCACATCCCTGGG - Intergenic
1073224940 10:101910423-101910445 AAAAAGAACCTAAAATCTCAAGG + Intronic
1073557213 10:104464905-104464927 AAAAACAATATCGCATCCCTTGG + Intergenic
1075489632 10:122855564-122855586 CAAATCAACCTCTCATTTCTTGG + Intronic
1076013561 10:127009803-127009825 GAAGTCAACCTCACATCTCCGGG - Intronic
1079571052 11:21943564-21943586 AAAAGCAAACTCCCAGCTCTTGG + Intergenic
1080165268 11:29228042-29228064 AAAAACAGCCTCGAGTCTCTGGG - Intergenic
1080244098 11:30159913-30159935 AAAATCAACATCTCCTCTCTTGG + Intergenic
1080270508 11:30446508-30446530 AGAAACAGCCTTCCATCTCTGGG + Intronic
1080501168 11:32872727-32872749 AAAAAAAACCTCTTATCTATTGG - Intergenic
1080620399 11:33982334-33982356 AGAAATAATCTCACATCCCTTGG - Intergenic
1081485847 11:43527973-43527995 AAAACCAATGTCACATTTCTAGG + Intergenic
1081673303 11:44953822-44953844 AAAAAAAAACTCACCTCACTGGG + Intergenic
1083402125 11:62430811-62430833 CAAAACAACCTCCCCTCTCACGG + Intergenic
1086540954 11:87912029-87912051 AAAACCCACCTCACATTTCTGGG + Intergenic
1086674185 11:89584960-89584982 AAAAACAACTTAACACCCCTAGG - Intergenic
1087115704 11:94522233-94522255 AAAACAAAACTCACACCTCTGGG + Intergenic
1087368696 11:97253341-97253363 AAAAAAAACTTCACAACTATTGG + Intergenic
1088419775 11:109632650-109632672 ATAAACAACATTACATCTCAAGG - Intergenic
1088544562 11:110946523-110946545 AAAAACTACTTAACCTCTCTGGG - Intergenic
1089609629 11:119662295-119662317 ACAGAAAACCTCACATCCCTAGG + Exonic
1089710925 11:120314028-120314050 AACAACAACAACACATGTCTTGG + Intronic
1091960173 12:4687444-4687466 AAAAACAATCACATATCACTTGG - Exonic
1092100241 12:5877404-5877426 AACAACTACCTCAAATTTCTTGG - Intronic
1092819663 12:12341555-12341577 AAAGACATGCTCCCATCTCTTGG + Intronic
1093280406 12:17188412-17188434 CAAAACAACCTTACATTTCTGGG + Intergenic
1093347500 12:18056992-18057014 AGAAACAACAGCACCTCTCTTGG - Intergenic
1094470101 12:30795504-30795526 AGAATCATCCTCACATCTCAGGG + Intergenic
1095851450 12:46811944-46811966 AAAATCAACTTCAAATATCTAGG - Intronic
1100083189 12:90877213-90877235 AAAACCAATATCACATCCCTGGG + Intergenic
1100445519 12:94656400-94656422 AAAAGCCACCTCACCTCCCTTGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101469194 12:104979641-104979663 TAAAACAACCTTCCATTTCTTGG + Intergenic
1102959092 12:117080533-117080555 GAAGACAACCTCCCACCTCTGGG + Intronic
1103425776 12:120832278-120832300 AAAACCAATCTCACAATTCTTGG - Intronic
1104268104 12:127256506-127256528 AAAAACAAAATCTCATTTCTAGG + Intergenic
1105524763 13:21166891-21166913 GAAAAAAACCCCACAACTCTGGG - Intronic
1108196787 13:48002855-48002877 AAAAAAAACCTGAGATCTCCAGG + Intergenic
1108333025 13:49409459-49409481 AAAAAAAACCTTTCAACTCTTGG + Intronic
1108438557 13:50425631-50425653 AAAAACAACCTCACATCTCTGGG - Intronic
1110053377 13:70934164-70934186 AACAACAAAATCACATCCCTGGG - Intergenic
1110848894 13:80222046-80222068 AAAAAAAAAGTCACATCTGTGGG - Intergenic
1111972797 13:94934435-94934457 AAAAACAACCTCCCATCCTCTGG + Intergenic
1112890123 13:104219307-104219329 ATAAACATCCCCACATGTCTAGG - Intergenic
1115253262 14:31372090-31372112 AAAAACAACAACAACTCTCTAGG + Intronic
1116536326 14:46035754-46035776 CACACCAACCTCCCATCTCTAGG - Intergenic
1118866061 14:69704606-69704628 AAAGACACCCACACATCACTTGG + Exonic
1119371623 14:74150253-74150275 AGAAACAACCTCAAATCAATTGG + Intronic
1119542136 14:75446683-75446705 AAAAGAAACCTCATATCCCTTGG - Intronic
1120248169 14:82030121-82030143 AAAAATCACTTCACCTCTCTGGG - Intergenic
1120880959 14:89414993-89415015 AAAAACAAGCTAGCATCTTTTGG + Intronic
1122048358 14:99039135-99039157 ACAGACAACCTCAAATCTCAGGG + Intergenic
1123633338 15:22277349-22277371 AGAAACAACCTTCCATCTTTCGG - Intergenic
1123706708 15:22955836-22955858 AAAATCACCCTCCCATCTCCTGG - Intronic
1124383180 15:29184828-29184850 AAAAATAACCTCTGATCTCCAGG - Intronic
1124383320 15:29185952-29185974 AAAAATAACCTCTGATCTCCAGG + Intronic
1125487568 15:40122994-40123016 AAAAATAACCTCAGGCCTCTTGG + Intergenic
1125489381 15:40135800-40135822 AAAAATAACCTCAGGCCTCTTGG + Intergenic
1125812285 15:42551645-42551667 AAAAACAACCCCCCAACTTTTGG + Intronic
1126590651 15:50336396-50336418 AAAAAAAACCTCACAAGCCTAGG + Intronic
1128260621 15:66230291-66230313 AAAAACAGCCTCACAGTTCCTGG - Intronic
1128824094 15:70694185-70694207 ATAAACATTCTCACTTCTCTGGG - Intronic
1129049584 15:72769189-72769211 TAAACCAACCTTGCATCTCTAGG - Intronic
1130765640 15:86868020-86868042 ATACACAATCTGACATCTCTTGG - Intronic
1131920789 15:97326223-97326245 AAAAACAATCTTACATCTTTGGG - Intergenic
1132079089 15:98849918-98849940 GAAAACAACCCCACATGGCTGGG + Intronic
1133066115 16:3208468-3208490 AAAAAAAAAATCACATTTCTGGG - Intergenic
1133605279 16:7381177-7381199 TAAAACAGCCTCTCATCTCAGGG + Intronic
1135389632 16:22079736-22079758 AGAAATAACCTCAGATCTCTGGG - Intronic
1136926061 16:34375405-34375427 AAAGACTACCACACATCTCAGGG + Intergenic
1136978513 16:35036401-35036423 AAAGACTACCACACATCTCAGGG - Intergenic
1137803424 16:51282526-51282548 AAAAACACCCTCATTTCTCCTGG + Intergenic
1138088324 16:54154149-54154171 AAAAAAAACCAAACCTCTCTCGG + Intergenic
1138222862 16:55267716-55267738 ACAAACTACTTAACATCTCTGGG - Intergenic
1139354043 16:66356676-66356698 AAACACATACTCACATCTCATGG - Intergenic
1139425400 16:66876678-66876700 AAAAACAAAATCAGATCTCGTGG + Intergenic
1140928757 16:79607858-79607880 AAAAACAAGCACACAAATCTAGG - Intergenic
1141250382 16:82351051-82351073 AAACACAACCACAAATCACTAGG + Intergenic
1141934298 16:87227146-87227168 GAAAATAACCTCACAGTTCTGGG - Intronic
1146599046 17:34196980-34197002 CAAAACATCCTTACATTTCTAGG - Intergenic
1147116367 17:38303040-38303062 TAAACCAACCTCACATCCCTGGG + Intronic
1148413315 17:47486568-47486590 TAAACCAACCTCACATCCCTGGG - Intergenic
1149552980 17:57553727-57553749 AAAAACAACCGGTTATCTCTTGG - Intronic
1149709682 17:58729188-58729210 AAAATCATCCTCAAATTTCTAGG - Intronic
1151790589 17:76303248-76303270 AAAAACAACCTGGGATCTCCAGG - Intronic
1153165941 18:2262522-2262544 AAAAAGAACCACACATTCCTTGG + Intergenic
1153265357 18:3263399-3263421 ACAAATTACCTCACCTCTCTGGG - Intronic
1155055774 18:22182111-22182133 AAAAATAACCTTGCATCTGTAGG + Intronic
1155155721 18:23155981-23156003 AAAAACAGACTCAGCTCTCTGGG - Intronic
1155786332 18:29905999-29906021 AAACACACCCTCTCAGCTCTGGG - Intergenic
1155863020 18:30927832-30927854 AAAGACAACCTCAGAGCTCTTGG - Intergenic
1156771899 18:40738047-40738069 AAGAACAATCTCAAATCCCTTGG + Intergenic
1156935490 18:42700905-42700927 AAAAACAACCTGAAATATTTAGG - Intergenic
1157078607 18:44496285-44496307 AAAAACACGCTCACCTCTCCCGG + Intergenic
1159401235 18:67938029-67938051 AAAAATGAGCTCACATCTGTTGG + Intergenic
1159977670 18:74735267-74735289 AAAAACAACATAACAGGTCTTGG - Intronic
1160060988 18:75528674-75528696 AAAAACAACTTCACATAAATGGG - Intergenic
1160269292 18:77369678-77369700 AAAAATATCCTCAAATGTCTAGG - Intergenic
1160613077 18:80104231-80104253 AAAAACAAGCGCCCACCTCTGGG + Intergenic
1161209758 19:3060284-3060306 AATAACATCATAACATCTCTGGG + Intronic
1162446406 19:10725584-10725606 AAAAGTGACCTCACTTCTCTGGG + Intronic
1162448969 19:10742886-10742908 AAAAACAAGCTAGCATCTCCAGG - Intronic
1162825253 19:13247360-13247382 AACAACAACATCCCATCTGTTGG - Intronic
1164059453 19:21657175-21657197 AAAAAGAATCTCTCATATCTTGG - Intergenic
1166065754 19:40357892-40357914 AATACCAACCTCACATTTGTTGG - Intronic
1167664452 19:50815767-50815789 AACAGCAGCCTGACATCTCTTGG - Intergenic
1167820559 19:51923775-51923797 AAAAGTAAATTCACATCTCTAGG + Intronic
1167887378 19:52512991-52513013 GAAAACTGGCTCACATCTCTTGG - Intergenic
926572655 2:14546522-14546544 TGATACAACCTCCCATCTCTTGG + Intergenic
927310879 2:21629911-21629933 AATAAAAACCCCACATCTCTGGG - Intergenic
928192542 2:29186151-29186173 AGCAACAAACTCACATATCTGGG - Intronic
929242664 2:39667458-39667480 AAAATCAACATCTCTTCTCTTGG + Intronic
929654648 2:43718157-43718179 AAAGGCAACCTCAAATCTCAAGG - Intronic
929994261 2:46815513-46815535 AATACCAACTTCACATGTCTGGG + Intergenic
929999981 2:46854775-46854797 AAAAGCAACCTCATTCCTCTAGG + Intronic
930607759 2:53509976-53509998 AACAAAAACCTCTGATCTCTTGG - Intergenic
930698171 2:54432468-54432490 AAAACAAATCTTACATCTCTGGG + Intergenic
930976506 2:57468649-57468671 AAAAATAACAACACATATCTTGG + Intergenic
931034066 2:58216799-58216821 GAGAACTACCCCACATCTCTAGG - Intronic
932482178 2:72050659-72050681 AACACCAACCTTACATTTCTGGG - Intergenic
932970550 2:76535671-76535693 AGAGACAACATCCCATCTCTAGG - Intergenic
933597846 2:84300707-84300729 AAAAACAAACTCACATAATTTGG - Intergenic
934689279 2:96345981-96346003 AAAAACAAAATCAAAACTCTTGG - Intronic
934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG + Intronic
935004183 2:99054804-99054826 AAAAACCACCTCACACCTGTTGG + Intronic
935118965 2:100163721-100163743 AAAAAAAACCCCACATACCTAGG + Intergenic
935254091 2:101292958-101292980 AAAAAAAAGATCACATCTCATGG - Intronic
935599124 2:104904406-104904428 AAATACAAACTCACATTTCCAGG - Intergenic
936400498 2:112161127-112161149 AAAACCAGCCGCCCATCTCTGGG - Intronic
937262478 2:120595416-120595438 AAAAACAACCTGACTTGGCTGGG + Intergenic
937873149 2:126800735-126800757 AAAAATGGCATCACATCTCTAGG + Intergenic
937904916 2:127048458-127048480 AAAAAGAACCACACATTTTTCGG + Exonic
937964739 2:127495556-127495578 AAAAACAAGTTCAGATCTTTTGG - Intronic
938168253 2:129051515-129051537 AGATACCACCTCACACCTCTTGG + Intergenic
939582798 2:143970325-143970347 ATATACAACCTCTCACCTCTGGG - Intronic
941077755 2:161025297-161025319 AAAACCAACCTTACATCCCAGGG - Intergenic
943106367 2:183548805-183548827 TAAAACAGCCTCACATCCCAGGG - Intergenic
944288656 2:197979266-197979288 AAAAACAACCTCATATCAATTGG - Intronic
946041465 2:216786419-216786441 AAAAAGAAACTGACACCTCTTGG + Intergenic
946143000 2:217707274-217707296 CAAAACAGCCTCACAGCTCCAGG + Intronic
948495887 2:238349616-238349638 AAATACATCTTCACATCTATGGG + Intronic
949001759 2:241618832-241618854 AAAAAACACCTCATGTCTCTGGG + Intronic
1168801037 20:643229-643251 AAAAAAAACCCCACCTATCTGGG - Intergenic
1169646255 20:7813083-7813105 GAAAACAAACACAAATCTCTAGG + Intergenic
1171021404 20:21587318-21587340 CAGAACAACCCCACATCTCCAGG - Intergenic
1171379405 20:24722764-24722786 AAACACAACCTCTGGTCTCTAGG + Intergenic
1172787225 20:37476649-37476671 AAAAACAACTTCATATCTGGAGG - Intergenic
1173275139 20:41573913-41573935 ACAAACAAACTCCCAGCTCTGGG + Intronic
1173787075 20:45801847-45801869 AAAAACTGCCTCTCATGTCTAGG - Intronic
1176694328 21:9956766-9956788 AAAAAAAACCTAAAATTTCTAGG - Intergenic
1177831814 21:26147812-26147834 AAAAAAAACCTGAAGTCTCTTGG + Intronic
1178046926 21:28705467-28705489 AAAACCAACATAATATCTCTTGG + Intergenic
1178470321 21:32886618-32886640 AACAACAACCTCACAAATGTGGG + Intergenic
1178491325 21:33054085-33054107 TAAAACAACTTCCCATTTCTGGG - Intergenic
1178661012 21:34507635-34507657 AAAAACAGTCTCTCTTCTCTAGG - Intergenic
1179260562 21:39754924-39754946 AAAAACACCCTCAGAGCTCCAGG - Intronic
1180049187 21:45323683-45323705 AAAAACCAGCTCACATCCCTGGG - Intergenic
1180617412 22:17137558-17137580 AAAAAAAGCCCCACATCTCCGGG + Exonic
1181336780 22:22141113-22141135 CAAAGCATCCTCACTTCTCTTGG + Intergenic
1184260208 22:43310664-43310686 AAAAACTACCTCACATTTAGTGG - Intronic
1184881972 22:47312214-47312236 TAAAACAACCTTGCATTTCTGGG + Intergenic
949095588 3:81651-81673 AGAAACCACATCACATCTCCTGG + Intergenic
951046673 3:18047175-18047197 AGAAACTTTCTCACATCTCTAGG + Intronic
952678296 3:36060138-36060160 AAAAACAACCACACATATCAGGG - Intergenic
953801341 3:46025995-46026017 TAAAACAATCTCATATTTCTGGG - Intronic
953821786 3:46213146-46213168 AAATACAACCTCAGAACTCAGGG + Intronic
954596062 3:51825950-51825972 AAAAACCAAAACACATCTCTAGG + Intronic
954720295 3:52555926-52555948 AAAAACAACTTGACTTTTCTGGG + Intronic
954831750 3:53426902-53426924 AACAACAACCTGATATCACTTGG - Intergenic
955147398 3:56333807-56333829 TAAAAAATTCTCACATCTCTGGG - Intronic
955620791 3:60862005-60862027 AAAAACAAACCCAAATATCTGGG + Intronic
956730663 3:72193841-72193863 CAAAACAACCCCTCATCTCAGGG - Intergenic
957799509 3:85057870-85057892 AAAAACAACCCCACATGTTAAGG - Intronic
958545526 3:95544046-95544068 ACAAAAAACCTCACATCTAGTGG - Intergenic
960073039 3:113453019-113453041 AAAAACCACCTCATTTCTATAGG + Intronic
960968403 3:123121588-123121610 AAATCAAACCTCACGTCTCTGGG - Intronic
961036101 3:123642744-123642766 AAAAACAGCCTCACCTCACAGGG + Intronic
961763206 3:129187052-129187074 AAAAACAACTTCCCAGCACTTGG + Intergenic
962256001 3:133870767-133870789 AAAAATAAGCTTACATCTTTAGG - Intronic
963985349 3:151587102-151587124 AAAAAAAACCTCACAACTTATGG + Intergenic
964549253 3:157868710-157868732 AAAAACAACATAGCATCTATTGG + Intergenic
964784458 3:160379867-160379889 AAAAACTACCACAAGTCTCTCGG + Intronic
964871487 3:161318162-161318184 AAACACAACCTCAGACCTCAGGG - Intergenic
964874846 3:161355295-161355317 AAAAACAACCTGGCAGCCCTTGG - Intronic
965259150 3:166457793-166457815 ATAAACAACCTTAGATTTCTGGG - Intergenic
965842357 3:172921402-172921424 ACAAGCAGCCTCACATGTCTTGG - Intronic
966513880 3:180795450-180795472 TAAAGCATCCTCACATCCCTGGG + Intronic
967074392 3:185989143-185989165 AAAGACAACCTCACATATTTGGG - Intergenic
967930897 3:194689316-194689338 ATAAATAACCTCACAGGTCTGGG - Intergenic
969234753 4:5858031-5858053 AATATGACCCTCACATCTCTAGG + Intronic
970033881 4:11709727-11709749 TAAAACAAACTTACATTTCTTGG + Intergenic
971062543 4:22988884-22988906 AACAGCAACCTTACATCACTAGG - Intergenic
972613423 4:40675990-40676012 AAAAAAAACTTCACTTTTCTAGG - Intergenic
972657415 4:41077925-41077947 AAACACAATGGCACATCTCTTGG - Intronic
973130317 4:46640702-46640724 AAAAACAATATCGCATCTCTGGG - Intergenic
974363230 4:60910860-60910882 AGAAACAACCTTACATGTCTGGG - Intergenic
975645689 4:76543520-76543542 ACAAACAACCCCAAATCTCGTGG + Intronic
976425538 4:84898804-84898826 AACAACAACCTTCCATCTGTAGG + Intronic
977496914 4:97787447-97787469 TTAAACAACCTCACATTTCAGGG + Intronic
979006903 4:115310660-115310682 TAAGCCAACCTCACATCTCAGGG + Intergenic
979305263 4:119135116-119135138 AAAAACGTGCTCTCATCTCTGGG - Intergenic
981733029 4:147920119-147920141 AAAAACAACATAACCTCGCTGGG + Intronic
981834867 4:149042923-149042945 AAAAACAATATCGCATCCCTGGG + Intergenic
983750651 4:171265389-171265411 AATAACTACCTCACAGGTCTGGG + Intergenic
983999849 4:174226610-174226632 CAAAACAAGCAGACATCTCTGGG - Intergenic
984286774 4:177740307-177740329 AAAAACAATCACACAGCTCTAGG - Intronic
984464392 4:180078930-180078952 AAAAAGAACATAACATCTATGGG - Intergenic
984553816 4:181190970-181190992 AAAAAAAACCTCTCATTCCTTGG + Intergenic
986436349 5:7735645-7735667 TAAAGCAACCTTACATTTCTTGG + Intronic
986612087 5:9579047-9579069 AGAAACATCTTGACATCTCTGGG - Intergenic
987911978 5:24159095-24159117 TAAACCATCCTCACATCCCTGGG - Intronic
989331979 5:40270364-40270386 AAAAACAACTTTAGATATCTTGG + Intergenic
990762106 5:59141372-59141394 AAAAACTATTTCACTTCTCTTGG - Intronic
991964112 5:72074134-72074156 AAGAATAACCCCACACCTCTTGG + Intergenic
992372273 5:76155564-76155586 AGAAAGAACCCCACACCTCTGGG - Intronic
993127902 5:83858046-83858068 AAAAAAAAACACACACCTCTAGG + Intergenic
993240985 5:85384936-85384958 AAAAAAAACCTCAGAAATCTTGG - Intergenic
993419877 5:87687667-87687689 ACATATAACCTCACATCTGTTGG - Intergenic
993536372 5:89091832-89091854 AAAAACAACCACAAATATTTTGG + Intergenic
993619008 5:90146293-90146315 AAAAACAACAACAAATCTATAGG - Intergenic
994052490 5:95378722-95378744 AAAATCAATCACACATTTCTAGG + Intergenic
995224092 5:109684713-109684735 AGATAACACCTCACATCTCTTGG + Intergenic
995303836 5:110620194-110620216 AAAAGCATCCTCTCATGTCTGGG + Intronic
995694058 5:114859992-114860014 ACAAACCACCTCAAGTCTCTGGG + Intergenic
996512139 5:124328565-124328587 AGAAATAACCTGAGATCTCTGGG - Intergenic
996663505 5:126031104-126031126 TGAAACAACCTCACATCCCAGGG - Intergenic
997758538 5:136422888-136422910 AAAAACCACCTCATTTTTCTTGG + Intergenic
998900646 5:146849941-146849963 AAAACCAATCTCACACTTCTAGG + Intronic
999039237 5:148388647-148388669 TAAAACTTCCTCACCTCTCTCGG + Intronic
999579281 5:153017532-153017554 ATAAACAACTTTACATCTCATGG + Intergenic
1000577835 5:162997024-162997046 AAAAAGCACCTTATATCTCTAGG + Intergenic
1001539613 5:172528225-172528247 GCAAACAACCTCACATCAGTTGG - Intergenic
1001610939 5:173001449-173001471 AAACTCCACCTCACATGTCTCGG + Intronic
1003472188 6:6447405-6447427 ACAAACATACCCACATCTCTGGG - Intergenic
1004983587 6:21055180-21055202 CAAATCAACCTCACATTTCTTGG + Intronic
1006093169 6:31640190-31640212 AAAACCAACCTTGCGTCTCTTGG + Exonic
1007769089 6:44179200-44179222 ACAAATCACCTCACATCTTTGGG + Intronic
1008065453 6:47042811-47042833 TAAAACAACCTCAGACTTCTGGG + Intergenic
1008372460 6:50748967-50748989 AGAAACAATCTTACATCTCAAGG - Intronic
1008638610 6:53437598-53437620 AAAACCAACCTCAGACCTTTTGG - Intergenic
1008946261 6:57100322-57100344 AAAAACAAGCTCAGATCACGTGG - Intronic
1009897175 6:69766470-69766492 TAAAGCAACCTTACATTTCTGGG + Intronic
1012260010 6:97077450-97077472 AAAAAGAAGCTTACTTCTCTTGG - Intronic
1012661156 6:101894766-101894788 AAAAAAAACCTAACATATATGGG - Intronic
1013398735 6:109770484-109770506 AAAAACAACCTAACACACCTTGG - Intronic
1013825787 6:114209713-114209735 GAATACAACCTCAAATATCTTGG + Intronic
1015137077 6:129884862-129884884 AAAAAAAACCTGACAACTCTTGG + Intergenic
1015380885 6:132567146-132567168 TAAAACAACCATAAATCTCTAGG - Intergenic
1016357721 6:143236101-143236123 AAATAAAACCTCACATTTTTGGG - Intronic
1016394367 6:143606966-143606988 TAAAAGAACCTCATATCTATAGG + Intronic
1016639116 6:146328444-146328466 AAAAGCAAATTAACATCTCTGGG + Intronic
1017040664 6:150306126-150306148 AAAAAAAAGTTCACACCTCTTGG - Intergenic
1018156285 6:160988347-160988369 AATAAAAACCTCACATCCATTGG - Intergenic
1018394000 6:163363153-163363175 AAAGATAACCTCAGCTCTCTGGG + Intergenic
1020548765 7:9570896-9570918 TAAGAAAACCTCACATCTCATGG + Intergenic
1020556038 7:9671292-9671314 AAAATCAACCTCAGTTGTCTAGG - Intergenic
1020618322 7:10487921-10487943 AAAAAGAACTTCACCTCACTGGG - Intergenic
1020866996 7:13577784-13577806 AAAAAAACCCTGACATCTATTGG - Intergenic
1021372011 7:19860870-19860892 AACAACTACCTTACCTCTCTTGG + Intergenic
1021551831 7:21879151-21879173 AAAAAAAATCTCACAGGTCTAGG + Intronic
1022095513 7:27138895-27138917 AAAAACAACCTAATGGCTCTGGG + Intronic
1022856942 7:34324061-34324083 CAAACAAGCCTCACATCTCTGGG - Intergenic
1023173698 7:37414784-37414806 AAAATCTACCACACATCCCTGGG + Intronic
1023622576 7:42088051-42088073 AAAATCCACTTCACATTTCTTGG + Intronic
1023640248 7:42250306-42250328 ACAAGAAACCTCACATCTTTAGG + Intergenic
1024179579 7:46877577-46877599 CAAAATAACCCCACATCTATTGG + Intergenic
1025094418 7:56086461-56086483 AAAAAAAACCCCAAAACTCTTGG - Intronic
1027717403 7:81690251-81690273 AAAAATAAAATCACCTCTCTAGG + Intergenic
1028043733 7:86090445-86090467 CAAAACAATATCACATCCCTGGG + Intergenic
1028531309 7:91841708-91841730 AAAAACTTCCTCAGATCCCTTGG + Intronic
1028848876 7:95513964-95513986 AAAATCACCCTCACAACTCCTGG + Intronic
1029521435 7:101065251-101065273 ACAAACAAACTCATCTCTCTTGG + Intergenic
1029659134 7:101947409-101947431 AAAAACCACCTCACTATTCTAGG + Intronic
1030084051 7:105802305-105802327 ACAATCAATCTCTCATCTCTGGG + Intronic
1030167500 7:106569949-106569971 AAGTACAACATCACATTTCTTGG + Intergenic
1032165007 7:129538586-129538608 AAAAAAAAAGTCACTTCTCTTGG + Intergenic
1032688738 7:134261273-134261295 AAAATCAACTTCACATATATGGG - Intronic
1034994609 7:155570166-155570188 AAAAACACTCTCAGATCTCCTGG - Intergenic
1036092697 8:5685518-5685540 AAAATCAACCTTACAATTCTTGG + Intergenic
1037159888 8:15756771-15756793 AAGAACAACCTGACAACTCCAGG - Intronic
1038068034 8:23983840-23983862 AAATAAAACCCCTCATCTCTGGG - Intergenic
1038742517 8:30227842-30227864 AAAAAGAACCTCACATTTTTAGG - Intergenic
1041791679 8:61702779-61702801 AAAACCATCCTTACATTTCTGGG - Intronic
1042880421 8:73481984-73482006 AAAAAGAACCCCACCTCTGTGGG - Intronic
1044095406 8:88057672-88057694 AACAAAAACCACACATCTTTAGG + Intronic
1044339323 8:91028689-91028711 AAAAGCAACACCACATCCCTGGG + Intronic
1044563975 8:93643346-93643368 AACAAAAATCTCACATTTCTAGG - Intergenic
1045715730 8:105042273-105042295 AGAAATAACCTTACATTTCTAGG - Intronic
1045731748 8:105249896-105249918 TAAACCAACCTCACATTCCTGGG + Intronic
1046332883 8:112744705-112744727 AAATAAAACCTCACAGATCTGGG + Intronic
1046957511 8:120076866-120076888 ATAAACAACCACAAATCTCAGGG + Intronic
1047032144 8:120893860-120893882 AAAAATAAACTCATAGCTCTAGG - Intergenic
1048125167 8:131626460-131626482 AAAAAAAAATTCACATTTCTTGG + Intergenic
1048335863 8:133501770-133501792 AACAACAACCAAAAATCTCTAGG + Intronic
1050931410 9:11331557-11331579 AAGAGCAATATCACATCTCTAGG - Intergenic
1051409313 9:16772575-16772597 AAAAAAAACCTCACACCTCATGG + Intronic
1052021854 9:23534021-23534043 GAAAACAGCATCCCATCTCTGGG + Intergenic
1052397553 9:27958267-27958289 TAAACCAACCTCACACTTCTGGG + Intronic
1053656193 9:40220309-40220331 AAAAAGAATCTCACACTTCTGGG - Intergenic
1054368298 9:64366523-64366545 AAAAAGAATCTCACACTTCTGGG - Intergenic
1054528423 9:66155985-66156007 AAAAAGAATCTCACACTTCTGGG + Intergenic
1054675919 9:67856277-67856299 AAAAAGAATCTCACACTTCTGGG - Intergenic
1055070967 9:72165461-72165483 TCAAACAACCTCACATTTATAGG - Intronic
1055608873 9:78000434-78000456 AAAAACCATCCCTCATCTCTGGG - Intronic
1055814357 9:80186998-80187020 TAAACCACCCTCACATTTCTTGG - Intergenic
1057467327 9:95327030-95327052 AAAAAAAAATTAACATCTCTAGG + Intergenic
1057521093 9:95761078-95761100 AAAAACCAACTCAGAGCTCTTGG - Intergenic
1058838915 9:108886496-108886518 TAAACCAACCTTGCATCTCTGGG - Intronic
1058897048 9:109409524-109409546 AAAAAAAACCTCTCAATTCTAGG + Intronic
1059079100 9:111228835-111228857 TAAAGTAACCTCACATTTCTGGG + Intergenic
1059110197 9:111550422-111550444 AGACACAACCCCACATTTCTGGG - Intronic
1059828445 9:118061815-118061837 ATAAACAACCTCACATATGTGGG - Intergenic
1060009210 9:120028618-120028640 AAAAGCAACCTCTGATATCTGGG - Intergenic
1185921125 X:4094041-4094063 AAAAAAAAGCGCACATTTCTTGG + Intergenic
1186456996 X:9717505-9717527 AAGAAGAACCTCGCATCTTTTGG + Exonic
1187235950 X:17467338-17467360 AAACACAGCATCTCATCTCTTGG + Intronic
1188508944 X:30912754-30912776 AAAAACAATATCACATCCTTGGG + Intronic
1190120514 X:47655636-47655658 GAAACCAAGCTCACCTCTCTTGG + Intronic
1198867785 X:141143810-141143832 AAACACAACATGACATCACTGGG + Intergenic
1200854302 Y:7920695-7920717 AAAAAAAAAATCACATCTCCTGG + Intergenic
1200871307 Y:8101819-8101841 GAAGACAACCTCACATGGCTGGG - Intergenic
1202277476 Y:23138711-23138733 AAAAAAAACATAACATCTGTAGG - Intronic
1202288552 Y:23281977-23281999 AAAAAAAACATAACATCTGTAGG + Intronic
1202430468 Y:24772434-24772456 AAAAAAAACATAACATCTGTAGG - Intronic
1202440324 Y:24897653-24897675 AAAAAAAACATAACATCTGTAGG + Intronic