ID: 1108440514

View in Genome Browser
Species Human (GRCh38)
Location 13:50448461-50448483
Sequence CTGAATATACAAATGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 2, 1: 1, 2: 23, 3: 88, 4: 388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108440510_1108440514 10 Left 1108440510 13:50448428-50448450 CCAGGACAGAAGTGAACCCTAGA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG 0: 2
1: 1
2: 23
3: 88
4: 388
1108440511_1108440514 -6 Left 1108440511 13:50448444-50448466 CCCTAGACTTGTGAGAGCTGAAT 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG 0: 2
1: 1
2: 23
3: 88
4: 388
1108440507_1108440514 28 Left 1108440507 13:50448410-50448432 CCAAATGGAGTCCTGGGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 226
Right 1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG 0: 2
1: 1
2: 23
3: 88
4: 388
1108440509_1108440514 17 Left 1108440509 13:50448421-50448443 CCTGGGGCCAGGACAGAAGTGAA 0: 1
1: 0
2: 3
3: 28
4: 246
Right 1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG 0: 2
1: 1
2: 23
3: 88
4: 388
1108440512_1108440514 -7 Left 1108440512 13:50448445-50448467 CCTAGACTTGTGAGAGCTGAATA 0: 1
1: 0
2: 2
3: 14
4: 135
Right 1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG 0: 2
1: 1
2: 23
3: 88
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108440514 Original CRISPR CTGAATATACAAATGGATGA CGG Intronic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903718558 1:25387463-25387485 ATGAATATATGAATGAATGAGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
908335228 1:63115929-63115951 CTGAGGATAGAAATGGTTGATGG + Intergenic
908393778 1:63706656-63706678 CCGACCATACAAGTGGATGAGGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
910039607 1:82833996-82834018 CTGAAGAGAGAAAAGGATGAAGG - Intergenic
910651073 1:89568096-89568118 CTGATTTTACAAATGTAAGACGG - Intronic
910893775 1:92045638-92045660 CTGTAAATACATTTGGATGAGGG - Exonic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915544050 1:156585965-156585987 CTGGACCTACAAATGGAAGATGG - Exonic
915582847 1:156825589-156825611 CTGAATATACAAGGTAATGATGG - Intronic
915949569 1:160179654-160179676 CTGAATGAACAAATGAGTGAGGG - Intronic
916887944 1:169088274-169088296 CTGATTTTACAAATGGGAGAAGG - Intergenic
916963756 1:169914313-169914335 CTGAATATACAATTGTAAGTTGG + Intergenic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918624707 1:186644110-186644132 CTGAACAGATAAATGAATGAGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
920700576 1:208215445-208215467 CTAGGTAGACAAATGGATGATGG + Intronic
921678219 1:218001170-218001192 TTGAATATATATAGGGATGAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923989208 1:239415973-239415995 CTGAATATACACATGGTAGCAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063922647 10:10947641-10947663 CAGAATAAAGAAATGTATGAGGG + Intergenic
1066474524 10:35732141-35732163 CTGCATATCCAACTGGATCAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068217060 10:53995711-53995733 ACGAATATACAAAGGGATGGTGG - Exonic
1068440307 10:57046152-57046174 CTGAATATAGAAATGGGAGTTGG - Intergenic
1068487969 10:57683712-57683734 ATGAATAAATAAATGTATGAGGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070678485 10:78432591-78432613 CTGAATAAATAAATAAATGAAGG - Intergenic
1073782391 10:106852731-106852753 CATAATATACCAATAGATGAGGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1074564111 10:114561341-114561363 CTTAATACACACATGGCTGAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1076330372 10:129660068-129660090 CTGAAAAGACAAATGGCTGTTGG - Intronic
1076341352 10:129748209-129748231 CTGAATACAGAAATAGGTGAGGG - Intronic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1078161840 11:8846811-8846833 ATCAAAATACAAATGGATCATGG - Intronic
1078663910 11:13308858-13308880 ATGAACACACAAATGAATGAAGG - Intronic
1079704971 11:23604036-23604058 ATGAATAGATAAATGAATGAAGG - Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1082082537 11:48023358-48023380 GTGATCATACAAATGAATGAAGG - Intronic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1086268996 11:85037019-85037041 CTTAATATATTAATGGCTGAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1091153146 11:133348024-133348046 ATGCATATACAACTGGCTGAAGG - Intronic
1091576280 12:1739178-1739200 CTGAACATAAAAAATGATGAAGG + Intronic
1093118568 12:15240925-15240947 GTGAATATATAAATGAATTAAGG - Intronic
1093259342 12:16916388-16916410 ATGAATATTCAAATATATGAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094784668 12:33833555-33833577 ATGAAGATACAAATATATGATGG - Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1097502612 12:60424559-60424581 ATAAATCTACTAATGGATGAGGG + Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099589337 12:84567547-84567569 CTGCATAATCAAATAGATGAGGG - Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102489404 12:113280366-113280388 GTGAAGATACAGATGGGTGATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105786535 13:23755323-23755345 CTGAATAAATGAATGGCTGAAGG + Intronic
1105786537 13:23755363-23755385 CTGAATAAATGAATGGCTGAAGG + Intronic
1106778961 13:33037047-33037069 CTGAATATACTAATGTTTGAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110589052 13:77232650-77232672 ATGAATATACAAATATTTGATGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1112595728 13:100805258-100805280 TTGAAAATAGAAATGCATGAGGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113340193 13:109415444-109415466 CTGAAGATAAAAATGTATCAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114939132 14:27584554-27584576 ATGAATTTAATAATGGATGATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116257831 14:42580115-42580137 CAGAATATATAAATTTATGAGGG + Intergenic
1117937195 14:60919691-60919713 CTGAACTTACACATGGGTGATGG - Intronic
1118503444 14:66385895-66385917 CTGCCTATACAAAGGGATGCGGG - Intergenic
1118707779 14:68495807-68495829 CTTAATATCCAAATGCTTGATGG - Intronic
1119117830 14:72043503-72043525 CTGAATATAGAAATCTATGTTGG + Intronic
1120419555 14:84266341-84266363 ATGAACATACAAATGCATGCAGG + Intergenic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120595939 14:86435981-86436003 CTGAATTTAGAATTGGAGGATGG - Intergenic
1120807768 14:88771877-88771899 CTGAATATTAAAGTGTATGAGGG + Intronic
1121627191 14:95394520-95394542 TTGAATATATGGATGGATGATGG + Intergenic
1121748729 14:96326956-96326978 CTATATATGCAATTGGATGATGG - Intronic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1127897039 15:63310385-63310407 CTTAATTTAGAAGTGGATGAAGG + Intergenic
1128785291 15:70391970-70391992 CTTAATAGATAAATGGGTGATGG + Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129541777 15:76355923-76355945 CAGAAGATGCAAATGGATGTAGG + Intronic
1130379815 15:83361821-83361843 TTGAATAAACGAATGAATGAAGG + Intergenic
1130753326 15:86736675-86736697 ATGAATATTAAAAGGGATGATGG - Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133435861 16:5778959-5778981 ATGAATAGATCAATGGATGAGGG - Intergenic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133630405 16:7615031-7615053 CAGAATATAATAATGAATGAAGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137569442 16:49555752-49555774 GTGAATAAATAAATGGATGGAGG + Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140787390 16:78355916-78355938 CTTAATATCCAAATGTATGCGGG - Intronic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142686772 17:1581645-1581667 CTAAATTTACAAATGGTGGAGGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1153698783 18:7671268-7671290 CTGAATTTAAAAATGCTTGACGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158832573 18:61296430-61296452 CTGAAAATGCAAATGCATGTAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1159849581 18:73511608-73511630 CTGAATATAGTACTTGATGAGGG - Intergenic
1159862052 18:73661042-73661064 CTGTACATACAAACAGATGATGG + Intergenic
1160544498 18:79643625-79643647 CTGATCACACAAATGGATCAAGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161424829 19:4197729-4197751 GCGAATAAACAAATGGGTGAAGG + Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1163238393 19:16043273-16043295 ATGAATAAACGAATGGATGGAGG + Intergenic
1163238428 19:16043404-16043426 ATGAATAAACGAATGGATGGAGG + Intergenic
1164522034 19:28986844-28986866 CTGAATACATAAATAAATGAGGG + Intergenic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
925630002 2:5882225-5882247 CTGACAATACAAGTGGATTATGG + Intergenic
925955294 2:8957968-8957990 CTGACTTTTCAAATGGATGTTGG - Intronic
926449826 2:12989121-12989143 CTAAAAATTCAAATTGATGAAGG + Intergenic
927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927260334 2:21081903-21081925 CTCAATATATAAATGGCAGAGGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929077889 2:38093442-38093464 CTTTATATACAAAGGGATTAAGG + Intronic
930463447 2:51713287-51713309 CTGAATCTATAAATTGATTAGGG - Intergenic
930568291 2:53051160-53051182 TTGAATATATAAATGTATGGAGG + Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933816316 2:86071821-86071843 CTTAAAAGACAAATGTATGAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935539558 2:104333650-104333672 CTGAATATACCTATGGCTGCAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936756046 2:115713876-115713898 CTGGCTTTATAAATGGATGATGG - Intronic
936971896 2:118184305-118184327 CTGAATATACAAGTGCAGGCAGG + Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938999507 2:136717777-136717799 CTGAATATTCCAATAGATGATGG - Intergenic
939117498 2:138077173-138077195 TTGAATATACAGATGCATGGGGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939248513 2:139656546-139656568 CTGAATATAAAAATGTATTCTGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941543810 2:166820136-166820158 ATGAATATAAAAAGAGATGAAGG - Intergenic
941646999 2:168051259-168051281 TGGAATATAAAAAAGGATGAGGG + Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941988176 2:171528649-171528671 CTGAATATACAAATTTGAGAGGG - Intronic
942155628 2:173124444-173124466 CTGCAGCTGCAAATGGATGATGG + Intronic
943904251 2:193477365-193477387 CTGACTATACCAAGGGTTGAAGG + Intergenic
944650916 2:201829456-201829478 CTGAGTATTAAAATGGATGATGG + Intronic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946643840 2:221812943-221812965 CTGAACACATAAATGCATGATGG - Intergenic
946832172 2:223738072-223738094 ATGAGCAGACAAATGGATGAAGG + Intergenic
947454993 2:230245874-230245896 CTTGCTATACAAATAGATGAAGG + Exonic
947682753 2:232050694-232050716 TCGAATAAACAAATGGATGGTGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170452978 20:16505044-16505066 GTGACTATACAAATGCATGTGGG + Intronic
1170757744 20:19219373-19219395 TTGAATGAACAAATGGGTGAAGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173017787 20:39242035-39242057 CAAAATAGACAAATAGATGAAGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177121573 21:17143326-17143348 GTGAATATCCAAATGGCTGCTGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178007892 21:28243353-28243375 CTTAATATATGCATGGATGAGGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178408725 21:32346993-32347015 CTGGAGGTACACATGGATGAGGG + Exonic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179072556 21:38085320-38085342 CTGAATAAATAAATAGATGGGGG - Intronic
1179196718 21:39171058-39171080 CAGAAACTACAGATGGATGATGG + Intergenic
1179483471 21:41693595-41693617 CTGAGTATACAAACAGATGTGGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180515341 22:16136004-16136026 CGGTATATACAACAGGATGATGG - Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
1183471224 22:38007722-38007744 CTGAATTAACAAATGCCTGAGGG + Intronic
949650498 3:6153320-6153342 CTGAATGAAGTAATGGATGAAGG + Intergenic
949792479 3:7808425-7808447 GTGAATTTACAAATAGATGCAGG + Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952439960 3:33316697-33316719 CTCAAAATACAGGTGGATGAGGG - Intronic
952847511 3:37700728-37700750 TTGAATAAACTAATGGATGGTGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954850939 3:53599896-53599918 CTGAACATATAAATGTCTGAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960707744 3:120496535-120496557 CTTGAGTTACAAATGGATGATGG + Intergenic
960925007 3:122785957-122785979 CAGTATATAGAAAAGGATGAGGG - Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962737828 3:138341440-138341462 CTGAAGATGGTAATGGATGACGG - Intergenic
963034580 3:141014493-141014515 CAGAATAGTCAAATGGTTGATGG + Intergenic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
963460663 3:145610745-145610767 CTAAATATAGAAGTAGATGAAGG - Intergenic
963613117 3:147497444-147497466 CTGAAAATGCAAAAGAATGAGGG + Intronic
963953439 3:151227579-151227601 GTGATTATGCAAATGGATCATGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964898346 3:161625623-161625645 CTGAATATATAAGTTGAAGAAGG + Intergenic
965222652 3:165946996-165947018 TAGAATGTACAAATGAATGATGG - Intergenic
966037291 3:175435264-175435286 CTGTATTTTCAAGTGGATGATGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967532009 3:190559234-190559256 CTAAAAATAGAAATGAATGATGG - Intronic
968217058 3:196901528-196901550 CTGAGTACACAAATGCCTGATGG + Intronic
968315275 3:197718771-197718793 CACAATATACAAAAAGATGAAGG + Intronic
968406452 4:343759-343781 CTGAAAATACAAATATATCAAGG - Intronic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
970994171 4:22246906-22246928 TTGATTAAACAAATGGGTGATGG - Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973645694 4:52949423-52949445 CTGAAGCTACAAATGGCTGTGGG - Intronic
974205613 4:58699404-58699426 ATGTATATCCAAATGGAAGAAGG - Intergenic
976142371 4:82005765-82005787 CTGAATATACACATGCCAGAGGG + Intronic
977114194 4:93001647-93001669 TTTAATATCCAAATGAATGATGG + Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977829343 4:101571866-101571888 CTGAATGAATAAATGAATGAAGG + Intronic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
980244095 4:130215434-130215456 CTGAATAAAAGAATGAATGACGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
983869201 4:172805209-172805231 CTGACTATGCAAATTGCTGAAGG + Intronic
984281117 4:177672013-177672035 GTGACTATAAAAATGGTTGAAGG - Intergenic
984514246 4:180719027-180719049 ATGAATATTAAAAGGGATGAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
987539244 5:19232400-19232422 CAGAAAATACTAATGGTTGAAGG + Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988065029 5:26221697-26221719 ATCAATATACAAATGCAAGAAGG + Intergenic
988828049 5:34960091-34960113 CAGAATATACACTTGAATGAAGG + Intergenic
990276942 5:54207216-54207238 TTCAATATACAAATGTATGTGGG + Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
994664590 5:102692479-102692501 CTGAGTAGACATATAGATGAAGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995264351 5:110140110-110140132 CAAAATATAGAAATGAATGACGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997078854 5:130714821-130714843 CTCAATAAATTAATGGATGATGG + Intergenic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999663526 5:153890111-153890133 GTGAATAACCAAATGAATGAAGG - Intergenic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000125994 5:158244784-158244806 CTGATTATACACAAGGATGCAGG + Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1002587650 5:180261566-180261588 TTGAAAATCCAAATAGATGATGG - Intronic
1002622494 5:180498235-180498257 AAGAAAATATAAATGGATGAAGG - Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004781470 6:18913278-18913300 GTGAATTGACAAATTGATGAAGG + Intergenic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005627597 6:27678150-27678172 CTTAATATACTATTGGATGTGGG - Intergenic
1005755085 6:28918985-28919007 ATAAAAATAAAAATGGATGATGG - Intronic
1005939744 6:30552164-30552186 CTGAGTAAAAGAATGGATGACGG - Intronic
1006420943 6:33933675-33933697 CTTAATATACAATTGGTTTAAGG - Intergenic
1006695854 6:35930092-35930114 CTCTCTATATAAATGGATGATGG - Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008076916 6:47154973-47154995 CAGAATATAAAACTGAATGATGG - Intergenic
1008425994 6:51357347-51357369 CTGAATAGTCAAAATGATGATGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010688931 6:78886167-78886189 CTGAAGATAGAAACGGGTGATGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012568319 6:100689023-100689045 GGAAATATACAAATGCATGAAGG - Intronic
1012960193 6:105614342-105614364 CAGAATCCACAAATGGTTGATGG + Intergenic
1012960452 6:105616368-105616390 CAGAATCCACAAATGGTTGATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013668259 6:112370149-112370171 CTGAAGATCCAAATAGATTAAGG + Intergenic
1014030802 6:116701400-116701422 CTGAATATACATATACATTATGG - Intronic
1014397720 6:120946589-120946611 CACAATATTCTAATGGATGATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015665985 6:135629321-135629343 CTTAAGAAACAAGTGGATGATGG + Intergenic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1020174668 7:5872616-5872638 CCGAAGATAAAAATGGATGATGG + Intergenic
1020686796 7:11306543-11306565 CTGAATATAGAACTAGAAGAAGG + Intergenic
1022344812 7:29504037-29504059 CTGATTATACAAACAGATGCAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025499671 7:61270259-61270281 CAGAATCTGCAAATGGATGTTGG + Intergenic
1025514522 7:61616468-61616490 CAGAATCTGCAAATGGATGTTGG + Intergenic
1025538868 7:62045308-62045330 CAGAATCTGCAAATGGATGTTGG + Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027980048 7:85206358-85206380 CTGAACATATTAAAGGATGAAGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1029996191 7:105010768-105010790 CAGAATATATGAATGTATGAAGG + Intergenic
1030862193 7:114647529-114647551 CAGAAAATACAAAATGATGAAGG + Intronic
1031053882 7:116972979-116973001 GTGAATAAACAAATGGGTGAGGG - Intronic
1031708579 7:125014359-125014381 CTGAATTTACAACTAGATGTAGG + Intergenic
1031794543 7:126155538-126155560 GTGAATATACAAATGAGTTAAGG + Intergenic
1032288129 7:130559173-130559195 CTGAATATACAAAAAAATTAAGG + Intronic
1032405949 7:131655566-131655588 CCAAATGTACAAATGAATGAAGG - Intergenic
1034152932 7:148930882-148930904 CTTATTTGACAAATGGATGAGGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034883616 7:154780886-154780908 ATGAATAGATAAATGCATGATGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040040215 8:42908978-42909000 CTGAATTTAAAAAAGCATGAAGG + Intronic
1040788734 8:51199064-51199086 CTGAAAATACAAATGGCTGGGGG - Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041027868 8:53705021-53705043 ATGAACATATAAATAGATGAAGG - Intergenic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041372657 8:57179173-57179195 CTGAATTACCAACTGGATGATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041527641 8:58824853-58824875 ATGAATATACAAATGGGGGGTGG + Intronic
1042062781 8:64839359-64839381 ATGACTAGACAAATGGGTGATGG - Intergenic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1043288324 8:78563403-78563425 TGGAATATACAACTGTATGAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044089001 8:87975822-87975844 CTGAATGAACAAGTGAATGAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046484123 8:114862773-114862795 ATGAATATCCAGTTGGATGATGG - Intergenic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047675364 8:127195707-127195729 CTAAATATCCAAATGCCTGATGG - Intergenic
1047881439 8:129198539-129198561 ATAAATAAATAAATGGATGAAGG - Intergenic
1047906174 8:129475615-129475637 ATAAAAATATAAATGGATGAAGG + Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048993931 8:139777509-139777531 CTGAATGAGCAAATGAATGAAGG + Intronic
1050224419 9:3435364-3435386 CTAAATATACAAAAAGATTACGG - Intronic
1050298419 9:4230842-4230864 CTGAATTTATAATTGGATGGGGG - Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051121511 9:13757090-13757112 ATGAACGAACAAATGGATGATGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054727348 9:68665733-68665755 TTGAAGAAACAAATGAATGATGG - Intergenic
1054801247 9:69351304-69351326 CTAAATACTCAAAAGGATGAAGG - Intronic
1054973622 9:71117449-71117471 TTGAATATTAAAATGGAAGAAGG - Intronic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056973974 9:91233606-91233628 CTGAATATACACATTGTTTATGG - Intronic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057339636 9:94188356-94188378 GTCACTAAACAAATGGATGATGG - Intergenic
1058237645 9:102512399-102512421 CTGAATATGTAAATAAATGAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059827538 9:118048386-118048408 TTGAATATATAAATATATGAGGG - Intergenic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060010335 9:120038186-120038208 CTATATAAACAAATGGATGGTGG - Intergenic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061889729 9:133612038-133612060 CAGAAAATAAAAATGGGTGAGGG + Intergenic
1203420634 Un_KI270371v1:1063-1085 CAGAATCTGCAAATGGATGTTGG + Intergenic
1185842285 X:3403058-3403080 ATAAATAAATAAATGGATGAAGG - Intergenic
1185884702 X:3772067-3772089 CTGAATTTACAAATGACTCAAGG + Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187872516 X:23776260-23776282 CACAATTTAAAAATGGATGAAGG + Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1189114913 X:38332269-38332291 CTAAATATACAAATTTATGTTGG - Intronic
1189728937 X:43998387-43998409 ATAAATAAACATATGGATGAAGG - Intergenic
1191612134 X:63128404-63128426 CTGAATTTAGAAATGAAAGAGGG - Intergenic
1191624168 X:63250732-63250754 CTGAATTTAGAAATGAAAGAGGG + Intergenic
1192823307 X:74666991-74667013 CTTAAGAAATAAATGGATGAGGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1195373500 X:104202810-104202832 CTCAAAATTCAAAAGGATGAGGG - Intergenic
1196090873 X:111740909-111740931 CTGAATAGCCAAATAGATGAGGG + Intronic
1196159734 X:112469687-112469709 CTTAATAAACAAATGTAAGATGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1197355342 X:125432396-125432418 CTTACTATACATATGGCTGAGGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic
1200930701 Y:8694414-8694436 GTGAAGATACAAACTGATGAAGG - Intergenic
1201066834 Y:10105096-10105118 ATGCATATACAAGTGGATGTGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201510690 Y:14758247-14758269 CTGTATTTGCAAATGGATTAAGG + Intronic