ID: 1108441024

View in Genome Browser
Species Human (GRCh38)
Location 13:50452932-50452954
Sequence CAGCACTAACAGATGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108441024_1108441027 -10 Left 1108441024 13:50452932-50452954 CCTTGCAACATCTGTTAGTGCTG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1108441027 13:50452945-50452967 GTTAGTGCTGAGGCAAGCTTGGG 0: 1
1: 1
2: 0
3: 5
4: 125
1108441024_1108441028 16 Left 1108441024 13:50452932-50452954 CCTTGCAACATCTGTTAGTGCTG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1108441028 13:50452971-50452993 CTGCTTTATTCCACAAAACAAGG 0: 1
1: 0
2: 1
3: 27
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108441024 Original CRISPR CAGCACTAACAGATGTTGCA AGG (reversed) Intronic
900085986 1:897337-897359 CAACACTACCAGCTGTGGCAGGG + Intergenic
902391056 1:16106762-16106784 CAGCACTACCAGCTGTGGCAGGG + Intergenic
903557080 1:24201926-24201948 CAGCAGTAATAGTTGTTGGATGG + Intergenic
905780153 1:40701826-40701848 CTGCACTAAAACATCTTGCAAGG - Intronic
906336348 1:44934955-44934977 CTGCACTAACAGATGTTGGCAGG - Intronic
907465441 1:54632294-54632316 CAGCACTACCGGCTGTGGCAGGG - Intronic
908845815 1:68323205-68323227 CTGGACTTCCAGATGTTGCAAGG - Intergenic
911136511 1:94446258-94446280 CGGCACTACCAGCTGTGGCAGGG - Intronic
913220408 1:116655520-116655542 CAGCAATAACTGTTGCTGCAGGG + Intronic
915626482 1:157117265-157117287 CAGCACAAACAGATGATGGCAGG - Intergenic
922849501 1:228720869-228720891 CACCCCTACCAGATGTTCCAGGG + Intergenic
1063273785 10:4541386-4541408 CAGCAATATCAGATGTTCCCTGG + Intergenic
1068734426 10:60396055-60396077 CAGCACTAACAGTAGTAGCCAGG - Intronic
1068938458 10:62658096-62658118 CAGGACTAACAGCTGTGGGAAGG + Intronic
1073815170 10:107198348-107198370 CAGCACTTACAAATATTTCAAGG - Intergenic
1074050179 10:109874647-109874669 CAGCACTAAAAGGTCTTGCTCGG + Intronic
1074980229 10:118613690-118613712 CGGCACTACCAGCTGTGGCAGGG + Intergenic
1085242124 11:75066301-75066323 CAGCACTCACAGAACTTGCAGGG - Intergenic
1086589685 11:88498068-88498090 CAGCAATAACTAATTTTGCATGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090008202 11:123021365-123021387 CATCACTATCTTATGTTGCATGG - Intergenic
1090101005 11:123796803-123796825 AAGCATTAAAATATGTTGCAAGG + Intergenic
1090747745 11:129720835-129720857 CAGAATTCACAGATGTTGTAAGG - Intergenic
1094553282 12:31472611-31472633 TAGCACTACCAAAGGTTGCATGG + Intronic
1095185791 12:39199160-39199182 CAGCTCTACCAGCTGTGGCAGGG + Intergenic
1101564194 12:105890176-105890198 CATCACTAACAGATAGTTCATGG - Intergenic
1101945162 12:109130944-109130966 CAGCATCGACAGATGTTCCAAGG - Intronic
1102799316 12:115717700-115717722 TAACAGTAACAGATGTTGCCTGG + Intergenic
1104527750 12:129540086-129540108 CAGCACAGACAGATGTTCAATGG + Intronic
1105710853 13:23007591-23007613 CAGCACTACCAGCTGTGGCGGGG - Intergenic
1106897693 13:34322561-34322583 CAGAAATAGCAGATGATGCAAGG + Intergenic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1109253914 13:60054124-60054146 CAGCAGTTGAAGATGTTGCATGG - Intronic
1121089584 14:91171791-91171813 CTGCCTTAACAGATGTTGCCCGG - Intronic
1121669987 14:95701675-95701697 CAACAGTAGCAGGTGTTGCAGGG + Intergenic
1128908276 15:71488833-71488855 CAGAACTAAAAGCTTTTGCAGGG - Intronic
1129467204 15:75730878-75730900 CACCACGAGCAGATGTTGGAGGG + Intergenic
1130604935 15:85307374-85307396 CAGCTCTAACAGGAGTGGCAGGG - Intergenic
1131606324 15:93906926-93906948 GAGCACTAACATATCTTGTATGG + Intergenic
1131894621 15:97012814-97012836 AAGCACTAACAGTAGTAGCAAGG - Intergenic
1131928170 15:97409271-97409293 CAGCACTAATAAATGTTTTAGGG + Intergenic
1143353737 17:6308877-6308899 CAGCACTCACCAATGCTGCATGG - Intergenic
1143418423 17:6768675-6768697 CAGCAATAACAGAAGTGGGATGG - Intronic
1145206831 17:20988986-20989008 CAGCACTTACAGGTGCTGCTAGG + Intergenic
1147325162 17:39666506-39666528 CGGCACTAACAGAGGGTGCTGGG - Exonic
1157900701 18:51513986-51514008 CAGCGCAAACTGATGTTGGAGGG - Intergenic
1159046262 18:63371079-63371101 CAGCACTCTCAGAAGTTGGATGG - Intergenic
1159090041 18:63837736-63837758 CAGCAATAACAGCTGTTTCAGGG - Intergenic
1159332051 18:67008423-67008445 GAGCAGTAATAGATGTTGAAAGG + Intergenic
1162283127 19:9716488-9716510 CAGCACTACCAGCTGTGGCAGGG + Intergenic
1164898880 19:31901240-31901262 CAAACCTAACAGATGTTGCAGGG - Intergenic
1165090744 19:33387285-33387307 CATCACGAAAAGAGGTTGCAAGG + Exonic
928072802 2:28234278-28234300 AAGAACTAACACATGTTGCTAGG - Intronic
928225974 2:29448484-29448506 CAGCTGTAAAAAATGTTGCATGG - Intronic
929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG + Intergenic
933676416 2:85061600-85061622 CAGCCATAACAGATGTTGGCTGG + Intergenic
934919303 2:98330064-98330086 CAGCAGTCCCAGATGTTGTAGGG - Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
940122419 2:150281596-150281618 CAGTTCTAACACCTGTTGCATGG + Intergenic
945498682 2:210541503-210541525 CAGAACAAACACATTTTGCAAGG + Intronic
947303882 2:228721870-228721892 CAGGACTAAAAGCAGTTGCAGGG - Intergenic
948339053 2:237234345-237234367 AATCACTAAGAGATGTTCCAGGG + Intergenic
1169394383 20:5216727-5216749 CACCACTAAGAGATGAGGCAGGG + Intergenic
1169403688 20:5305269-5305291 CAGCACTACCAGCTGTGTCAGGG - Intronic
1169919639 20:10721073-10721095 CAGCAAGAACAGATTTTACAAGG - Intergenic
1170027485 20:11905838-11905860 CACCACTAGCAGATGTTGCTGGG + Intronic
1171332719 20:24355865-24355887 CAGCACTACGAAATGTTGAACGG + Intergenic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG + Intronic
1180821937 22:18835775-18835797 CAGCAATAACTGTTGCTGCAGGG + Intergenic
1181191038 22:21140272-21140294 CAGCAATAACTGTTGCTGCAGGG - Intergenic
1181208162 22:21270226-21270248 CAGCAATAACTGTTGCTGCAGGG + Intergenic
1182865360 22:33599680-33599702 CAGCACTAACAGATATCATAAGG + Intronic
1185133740 22:49056589-49056611 CAGGGCTCACAGAGGTTGCAGGG + Intergenic
1203218763 22_KI270731v1_random:25176-25198 CAGCAATAACTGTTGCTGCAGGG - Intergenic
1203272064 22_KI270734v1_random:61650-61672 CAGCAATAACTGTTGCTGCAGGG + Intergenic
950547009 3:13644223-13644245 CAGCACTCACAGAAGCTGGATGG - Intergenic
955037892 3:55286534-55286556 CAGCACTAACAGATACTTCATGG + Intergenic
962268163 3:133958201-133958223 CAAGGCTAACAGATGTTGGAAGG + Intronic
962640668 3:137382691-137382713 TAGTACTATCAGATGTTCCAGGG - Intergenic
964379170 3:156080191-156080213 CAACACTCACAGATGTTTTACGG - Intronic
966413571 3:179667024-179667046 CAGCAATAAGATATGTTGAATGG - Intronic
966838386 3:184067675-184067697 CAGCTAAAACAGATGTTCCAGGG + Intergenic
969148428 4:5144560-5144582 CAGCAGTGACAGATGTCACATGG - Intronic
969556751 4:7916764-7916786 CAGCAGAAAGGGATGTTGCAAGG + Intronic
970446646 4:16128558-16128580 CACGAATAACAGATGTTTCAAGG - Intergenic
972958476 4:44421775-44421797 CATCAGAAACAGATGTTGCATGG - Intronic
974154278 4:58050895-58050917 CAGAAATTACAAATGTTGCAGGG - Intergenic
974592770 4:63975186-63975208 CAGCACTATCAGATATTTTATGG - Intergenic
975222098 4:71824304-71824326 CAGCACTAAGAGATGGTTTATGG + Intergenic
975768485 4:77694996-77695018 CAGCACTACAAGATGGTGCCTGG + Intergenic
976517067 4:85981157-85981179 CAGCACTAACTGATTTTTCTTGG + Intronic
977876610 4:102157376-102157398 CAGCACTATCAGATATAGCCTGG - Intergenic
978885626 4:113762626-113762648 CAGAACTTACTGAGGTTGCAGGG - Intergenic
980212299 4:129805015-129805037 CAGCAATACCAGTTGTTGGATGG + Intergenic
980622215 4:135322574-135322596 CAGAACCAACAGATGTTGGCAGG + Intergenic
982364671 4:154563059-154563081 TAGCAATAATAGATGTTTCATGG - Exonic
984169795 4:176345773-176345795 CAGCACTACCGGCTGTGGCAGGG - Intergenic
985004619 4:185521715-185521737 CATCACTCTCAGCTGTTGCATGG - Intronic
985469307 5:28448-28470 AAAGACTAACAGATGTTGCAAGG - Intergenic
985850260 5:2383440-2383462 CCGCTCTTCCAGATGTTGCAGGG + Intergenic
986208008 5:5644341-5644363 CAGCCCTAACAGATGAGCCATGG - Intergenic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1013596339 6:111664152-111664174 CAGTACTAAAAGATGCGGCAAGG - Intronic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1018049440 6:159996514-159996536 CAGCCCTAACAGGGGTAGCAGGG + Intronic
1019234266 6:170596680-170596702 CAGCAGTACCAGCTGTGGCAGGG + Intergenic
1020218323 7:6213329-6213351 CAGCACTATCCGTTGTTGCATGG + Intronic
1021695567 7:23272803-23272825 GAGCAGTGACAGATGTTACATGG + Intronic
1024563380 7:50662703-50662725 CAGCACTTCCACATGCTGCAAGG - Intronic
1024778727 7:52821568-52821590 CAGCACCCACAGCTGTTTCATGG + Intergenic
1026054225 7:66970731-66970753 CAGCCCTGCCAGAGGTTGCAGGG + Intergenic
1027355834 7:77354173-77354195 CAGCACTGACAGATATTATAAGG + Intronic
1030562457 7:111106719-111106741 CTGCCCTTACAGATCTTGCAGGG + Intronic
1031574429 7:123398233-123398255 CAGAGGTGACAGATGTTGCAAGG - Intergenic
1032640971 7:133767725-133767747 CAGAACTATCTGATTTTGCAGGG - Intronic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1034834307 7:154337557-154337579 CAGAAATGACAGATGGTGCAAGG - Intronic
1037506490 8:19534983-19535005 CACCACCAAAAGATGTTGCCAGG + Intronic
1038706513 8:29898962-29898984 CAGCAGTAACCAATGGTGCAGGG + Intergenic
1039806144 8:41001359-41001381 CAGCAATAACAGATGTAGGTGGG + Intergenic
1040542191 8:48370311-48370333 CAGCACCAACAGAGATTGAAAGG - Intergenic
1042446471 8:68890676-68890698 CAGCACTACCAGCTGTGGCAGGG - Intergenic
1045407135 8:101878058-101878080 CAGAAATAACAAATGTTCCACGG + Intronic
1046651079 8:116837267-116837289 CAGGACCTACAGAAGTTGCATGG + Intronic
1046695664 8:117336517-117336539 TAGCATTAATAGATGTTGCTTGG - Intergenic
1047768095 8:128005801-128005823 CAGCTCTAAAAGACGTTTCAAGG + Intergenic
1048584396 8:135759376-135759398 CAGGACACCCAGATGTTGCAGGG + Intergenic
1050133849 9:2441230-2441252 CTGCACTGACAGAGGTAGCAGGG + Intergenic
1051294433 9:15580722-15580744 AAAAAATAACAGATGTTGCATGG + Intronic
1051948314 9:22599248-22599270 CAGAACAGACAGATGTTGGATGG + Intergenic
1052924885 9:34007053-34007075 CAGTTCTAACAGATGTTTGATGG + Intronic
1055095143 9:72405657-72405679 CAGAACTAACTGATCTTTCAAGG - Intergenic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1055175098 9:73308825-73308847 CAGCACTCAGAGATGTGACATGG - Intergenic
1058607236 9:106735943-106735965 CAGCAGGGACAGATGTTGTATGG + Intergenic
1186682267 X:11887535-11887557 AAGTACAAACATATGTTGCAAGG - Intergenic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1190746704 X:53327798-53327820 AAGCACGAATAGATGTTGCCAGG - Intergenic
1196988164 X:121297520-121297542 CAGATCTAACAGATGTTTCTGGG - Intergenic
1197309925 X:124892193-124892215 CAGCATCAACAGATGATGAAGGG + Intronic
1199692465 X:150319096-150319118 GAGCACTAACAGAAGATGCTAGG + Intergenic
1200310792 X:155075256-155075278 TAGCATTATCAGATGTTGAAGGG - Intronic