ID: 1108441327

View in Genome Browser
Species Human (GRCh38)
Location 13:50456267-50456289
Sequence GCCAAGAGCCACAGTGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108441327_1108441329 -10 Left 1108441327 13:50456267-50456289 CCTTGTCCACTGTGGCTCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1108441329 13:50456280-50456302 GGCTCTTGGCTTTATGCCCTTGG 0: 1
1: 0
2: 1
3: 15
4: 185
1108441327_1108441330 3 Left 1108441327 13:50456267-50456289 CCTTGTCCACTGTGGCTCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1108441330 13:50456293-50456315 ATGCCCTTGGCTAGATCTTGCGG 0: 1
1: 0
2: 2
3: 40
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108441327 Original CRISPR GCCAAGAGCCACAGTGGACA AGG (reversed) Intronic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900684409 1:3938955-3938977 GCCAAGAGCCCCACTGACCAGGG - Intergenic
900857736 1:5199510-5199532 GCCAAGAGACACAGAGCACCTGG + Intergenic
901120678 1:6890538-6890560 TCCAAGAGCCTAAGTGGGCAAGG - Intronic
903322561 1:22551777-22551799 GGCTGGAGCCACAGTGGTCACGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903687890 1:25145955-25145977 GCTAATAGCCACAGTGGCCGAGG + Intergenic
903885331 1:26537604-26537626 GCCAAGGCCCAGAGTGTACAAGG - Intronic
904264946 1:29312856-29312878 GCCAAAGGCCAAAGGGGACAGGG - Intronic
908053085 1:60254269-60254291 GCCAAGCCCCAAAGTTGACATGG - Intergenic
912722845 1:112034643-112034665 CCCAGCAGTCACAGTGGACATGG + Intergenic
918098644 1:181354784-181354806 GCCAAGTTCCACTGTGGAAAGGG + Intergenic
919661720 1:200254231-200254253 GCCCAGAGCCACAGAGGGAAGGG + Intergenic
920330518 1:205204017-205204039 GCAAAGAGCCACTGTGGTTAGGG + Intronic
920387387 1:205578623-205578645 GCCAAGAGCCAAGGGGGTCAGGG + Intronic
920842180 1:209564199-209564221 GCCAAGGCACACAGTGGACAGGG - Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
921193033 1:212726554-212726576 GCCCAGAGACAAGGTGGACAGGG - Intronic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
1062805779 10:418314-418336 CCCGACAGGCACAGTGGACAGGG - Intronic
1063165208 10:3455434-3455456 GCCAAGGGGCACGGTGAACAGGG - Intergenic
1063566776 10:7178062-7178084 GCAAAGAGCCACAGGCCACATGG - Intronic
1064702885 10:18039864-18039886 TTCAAAATCCACAGTGGACATGG - Intronic
1066207375 10:33202911-33202933 GCCAACTGCCACAGTGGAACAGG - Exonic
1069858810 10:71457532-71457554 GGAAAGAGCCTCAGTGGCCAAGG + Intronic
1071694840 10:87860977-87860999 GGCAAGGACCACAGTGGAAAAGG - Exonic
1071775886 10:88787391-88787413 TCCAGGAGGCAGAGTGGACATGG - Intergenic
1074224691 10:111473153-111473175 GCCAAGGACCACAAAGGACAAGG + Intergenic
1074568181 10:114600557-114600579 CCCAAGAGCCCCCGTGGCCATGG + Intronic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1075493800 10:122900514-122900536 GCCAAGAGCCCAAGGAGACATGG - Intergenic
1076175673 10:128366159-128366181 ACCAAGGGCCACAGTGGAGGTGG + Intergenic
1076496599 10:130901519-130901541 GCCATCAGCCACAGTGGGGAGGG - Intergenic
1076573197 10:131445920-131445942 GCCAAGAGCCAGAGTTGAAGTGG - Intergenic
1077079804 11:720229-720251 GCCCAGCGCCACGGGGGACAGGG + Intronic
1077323278 11:1952007-1952029 ACCAAGACCCACAGGGGGCAGGG - Intronic
1078738378 11:14042972-14042994 GCCAAGAGCCAAACTGCTCAAGG - Intronic
1079116258 11:17642257-17642279 GCCTACAGCCTCAGTGGAGAAGG - Intronic
1081630151 11:44683994-44684016 GCCAAGAGCCAGAGAGGGGAAGG - Intergenic
1081661228 11:44889581-44889603 GCCAAGAGCCAAAGCCCACATGG + Intronic
1083222110 11:61259193-61259215 GACAGGAGCTACAGTTGACAGGG + Exonic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083442888 11:62688474-62688496 GCCAGGAGCCACAGAAGGCAGGG + Exonic
1084108520 11:66997373-66997395 GCCATGAGCCACACTGGAGCTGG - Intergenic
1084318435 11:68359412-68359434 CCCAAGAACCACAGTCTACAGGG - Intronic
1085498233 11:76992545-76992567 GACACAAGCCACAGTGGGCATGG - Intronic
1085706128 11:78787976-78787998 GCAGAGAGCTTCAGTGGACATGG - Intronic
1087511032 11:99093890-99093912 GCCATGAGGCACAGGGGAAAGGG - Intronic
1087663097 11:101010538-101010560 GCAGAGAGCAACAGTGGACTGGG - Intergenic
1088909943 11:114183213-114183235 GCCCAGAGTCACTGAGGACAGGG + Intronic
1088952355 11:114584655-114584677 GCCAGGAGCCAAAGAGGTCAAGG + Intronic
1089667370 11:120029138-120029160 GCCAGGAGTCACAGTGCACAAGG + Intergenic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091071092 11:132564173-132564195 ACCAAGGGCCACAATGGCCAGGG - Intronic
1202806266 11_KI270721v1_random:7202-7224 ACCAAGACCCACAGGGGGCAGGG - Intergenic
1091920964 12:4304126-4304148 TCCATGGGCCACAGGGGACAGGG + Exonic
1092304430 12:7284233-7284255 GCCAGGAGGCACAGGGGTCAGGG - Intergenic
1093402360 12:18761600-18761622 GTCAAGAGGCACAGGGGTCAGGG - Intergenic
1095714527 12:45328135-45328157 GCAAAGAAGCACAGTGGAAAAGG - Intronic
1095991063 12:48034911-48034933 ACCAAGAGCCACCCTGCACATGG + Intergenic
1096615772 12:52832756-52832778 GCCAAGAACCACAGAGTCCAGGG + Intronic
1099236039 12:80083733-80083755 GCCAGGAGGCACAGGGGTCAGGG + Intergenic
1101574906 12:105988289-105988311 GACAAGAGACATAGGGGACAGGG - Intergenic
1102030140 12:109735569-109735591 GGTAAGACCCACAGTGGAGATGG - Intronic
1102760345 12:115379771-115379793 TCCAAGGGCCACAGTGAATAGGG + Intergenic
1106481404 13:30139924-30139946 CCCAAGGGCCACAGTTGAGAGGG - Intergenic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1109458737 13:62626793-62626815 GCCAACAGGCACAGTGTAAATGG - Intergenic
1113711065 13:112465964-112465986 GGCCAGAGCCACAGTGGAGCTGG - Intergenic
1114678231 14:24459958-24459980 GGCCACAGCCACAGTGGAGATGG - Intergenic
1115523181 14:34253264-34253286 CCCATGAGCCACTGTAGACATGG + Intronic
1115974341 14:38980652-38980674 GTCAGGAGCCACAGGGGTCAGGG + Intergenic
1118725283 14:68624557-68624579 TCCAAGAGCCACAGAGGATTTGG - Intronic
1120128941 14:80782156-80782178 GCCAAAAACCACAGTGAAGAGGG - Intronic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1122350789 14:101088769-101088791 GCCCAGGGCCACAGAGGAAATGG + Intergenic
1122599658 14:102914964-102914986 CCCAAGTGCCACAGGGGCCAGGG - Intergenic
1123937007 15:25198900-25198922 GCCATGCGCCACTGTGGAGATGG - Intergenic
1123939782 15:25211241-25211263 GCCATGTGCCACCGTGGACATGG - Intergenic
1126671364 15:51118365-51118387 GCAAAGAGCCAGATTGGACATGG - Intergenic
1128250301 15:66159358-66159380 CCCAGGAGCCACAGAGGTCAGGG + Intronic
1130265878 15:82402687-82402709 GCCCAGAGCAACTTTGGACATGG + Intergenic
1130506142 15:84544199-84544221 GCCCAGAGCAACTTTGGACATGG - Intergenic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1130934685 15:88458939-88458961 GCCAAGAGCCCCAGAGGTGAGGG + Intergenic
1132091877 15:98953936-98953958 GCCAGGAGCGGCTGTGGACATGG - Intronic
1132384538 15:101390690-101390712 GCCAACAGCCCGAGTGGGCAAGG + Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1132882802 16:2169927-2169949 TCCAAGAGCCACACTGCCCAAGG - Intronic
1133055334 16:3142963-3142985 GACAAGAGTCCCAGGGGACACGG - Intergenic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1135323064 16:21509694-21509716 GCCAGGAGCCCAAGTGGACTTGG - Intergenic
1135482505 16:22832758-22832780 GCCATGAGCCACAGTGGAAGGGG + Intronic
1136334546 16:29602880-29602902 GCCAGGAGCCCAAGTGGACTTGG - Intergenic
1136497973 16:30655375-30655397 GCCAAGAGCCTCAAAGGACCAGG + Exonic
1137850612 16:51738375-51738397 GGCAAGATCCTCAGTGGACAGGG - Intergenic
1139381848 16:66537403-66537425 GCCAGGAGGGACACTGGACAGGG + Intronic
1140651326 16:77091584-77091606 GCCAAGAACAGCAGAGGACACGG + Intergenic
1140865740 16:79060339-79060361 GCCAAAAGCCTCACTGGAGAGGG - Intronic
1141107458 16:81245197-81245219 CCCAAGATCCACTGTGGTCAAGG - Intronic
1141994117 16:87626125-87626147 GCCAAGAGCAACAGCGGCCGGGG + Intronic
1142035260 16:87858716-87858738 GCCAGGAGCCCAAGTGGACTTGG - Intronic
1142471201 17:164274-164296 GCCAGGAGACCCAGGGGACAAGG - Intronic
1143027145 17:3947621-3947643 GCCAGGAGCCACCGTGGGCCGGG + Exonic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144810856 17:17998055-17998077 AGCTAGAGCCACACTGGACATGG + Intronic
1146380535 17:32323985-32324007 GGAAAGAGGCACAGAGGACACGG - Exonic
1146953033 17:36919881-36919903 GACAATAGCCAGAGAGGACAAGG - Intergenic
1147689861 17:42308443-42308465 GCCAAAACCCACAGGGGACATGG - Intronic
1148776270 17:50097173-50097195 GCCTTTAACCACAGTGGACAGGG - Intronic
1149374986 17:56034804-56034826 GCCAACAGCCCCAGTGAGCAAGG - Intergenic
1149850425 17:60030565-60030587 GCCAGGAGACCCAGGGGACAAGG + Intergenic
1149859741 17:60115959-60115981 GCCAGGAGACCCAGGGGACAAGG - Intergenic
1149888662 17:60366434-60366456 GGCATGAGCCACAGTAGAGACGG + Intronic
1151275577 17:73031610-73031632 GCCAACAGCCACAGGGAAGAAGG + Exonic
1152199995 17:78939727-78939749 CCCAGGAGACACAGTGGACAAGG - Intergenic
1152854168 17:82654433-82654455 GCCCTGAGCCACTGTGGAGAGGG - Intergenic
1159053729 18:63445150-63445172 GCCAAGATTCACAGAAGACAAGG + Intergenic
1159884201 18:73888703-73888725 TTCTAGAGCCACAGTGGACGAGG + Intergenic
1161089268 19:2352060-2352082 GCCAAGGGGGACAGGGGACAGGG - Intronic
1161220536 19:3116102-3116124 GCCCCCAGCCACAGTGGACCTGG - Intronic
1161389415 19:4013463-4013485 GCGGGGAGCCACAGTGGCCAGGG + Intronic
1161687016 19:5707914-5707936 GCCCATAGCTACAGGGGACAGGG - Intronic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1166302703 19:41921413-41921435 GGAAAGAGACACAGAGGACAAGG + Intronic
1167529324 19:50005131-50005153 GCCAACAGCCCCAGGAGACAGGG + Intronic
1168214143 19:54912878-54912900 ACCATGAGACACAGTGGCCATGG + Exonic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
926889410 2:17626424-17626446 GCCCAGAGCCTCGGTGCACAGGG + Intronic
927843656 2:26460602-26460624 TCCAAGAGCCAGAGTGGGGAGGG + Intronic
928045280 2:27924996-27925018 GCCAAGAGCCAAAGTGCTCAAGG - Intronic
934646601 2:96062734-96062756 GCCCAGATCCACAGTGGCCTGGG - Intergenic
934840002 2:97618816-97618838 GCCCAGATCCACAGTGGCCTGGG - Intergenic
935961556 2:108430124-108430146 GTCAAGAGGCACAGGGGTCAGGG - Intergenic
936252380 2:110876565-110876587 GCCACGAGCCACAGAAGACAGGG - Intronic
937513579 2:122627562-122627584 GCCCAGAGCCTCCGTGGAGAGGG - Intergenic
937693733 2:124784762-124784784 GCCTGGAGTCACACTGGACATGG - Intronic
938952254 2:136266209-136266231 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
940367309 2:152862386-152862408 GCTAAGAGCCAAAGAGGAGAGGG + Intergenic
940584820 2:155633571-155633593 GCCAAACGCCACAGATGACAAGG + Intergenic
941478105 2:165972455-165972477 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
945157725 2:206857157-206857179 GCCAAGAGACACCGGGGACCAGG - Intergenic
945482144 2:210357153-210357175 GTCAAGAGGCACAGGGGTCAGGG + Intergenic
946326768 2:218988680-218988702 GCCAATAGCCCCAGTTTACAAGG + Intergenic
946714145 2:222535570-222535592 GCAGAGAGCCACAGTCGAAAGGG + Intronic
947238697 2:227971032-227971054 GCCAAGGGCCACATGGGTCATGG - Intergenic
948763070 2:240204561-240204583 GCCCAGAGGCACAGAGCACAGGG - Intergenic
948947817 2:241230068-241230090 GCCAGGAGCTTCAGGGGACAAGG - Intronic
1169455670 20:5750272-5750294 GCCAAAAGCCTCAGTCAACATGG + Intergenic
1169722372 20:8692755-8692777 ACCAAGATCCACAAAGGACATGG + Intronic
1170131615 20:13026725-13026747 GCCAAGAGCAGAAGTGGACATGG - Intronic
1170794223 20:19532410-19532432 TCCATGAACCACAGTGGACTTGG - Intronic
1171250280 20:23641002-23641024 GACTAGAGCCCCAGTGGCCAGGG - Intergenic
1172026826 20:31954176-31954198 GCCATGAGCAAAACTGGACATGG + Intergenic
1173642120 20:44610685-44610707 ACAAAGAACCACAGTTGACAGGG + Intronic
1173661770 20:44739271-44739293 GCCAAGAGCCAAAGGCGACCAGG - Intergenic
1175776788 20:61658782-61658804 AGCAACACCCACAGTGGACATGG + Intronic
1177890444 21:26798150-26798172 GGCCAGAGAAACAGTGGACATGG - Intergenic
1177941422 21:27416720-27416742 GCCTAGTGCCTCAGTGCACAGGG + Intergenic
1180594073 22:16962343-16962365 CCCACAGGCCACAGTGGACATGG - Exonic
1180912763 22:19464375-19464397 GTCAACAGTCACAGTGAACAGGG + Intronic
1181461946 22:23090776-23090798 GCCCAGTGCTACAGTGGAAATGG - Intronic
1181806799 22:25379775-25379797 CCCAAGAACCACAGTCTACAGGG + Intronic
1182422049 22:30253454-30253476 GCCAAGAGTCAGGGTGGCCAGGG - Intergenic
1183311048 22:37109641-37109663 GCCACAGGCCACAGGGGACAAGG - Intergenic
1183818675 22:40325783-40325805 ACCAAGAGCGGCAGTGGACAGGG - Exonic
1184186898 22:42871099-42871121 GCCAACAGGCACAGTGGGCGGGG + Exonic
949126467 3:450897-450919 GACAAGAACCACAGAAGACATGG - Intergenic
950021615 3:9791940-9791962 GCCAAGAGTCCCAGAGAACATGG - Intronic
950620779 3:14203515-14203537 GCCAAAAGTCACAGAGCACACGG - Intergenic
953409655 3:42683477-42683499 GCCAAGTCACACAGCGGACATGG - Intergenic
954896551 3:53979842-53979864 GGCATGAGCCACTGTGGACTTGG + Intergenic
956996643 3:74833220-74833242 GCCAAGAGTCACATTGGATTTGG + Intergenic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
959479423 3:106853566-106853588 GCCAAGAGGCACAGGGGTCAGGG - Intergenic
959704295 3:109325406-109325428 GTGAAGAGCCACAGGGGCCAGGG - Intergenic
962965163 3:140346697-140346719 GCCAAGAGTCACTATGGAAAGGG - Intronic
964058897 3:152496482-152496504 GCGGAGACCCTCAGTGGACAAGG - Intergenic
964996809 3:162891989-162892011 GCCAAGAGCCACAGAGACGACGG + Intergenic
965683760 3:171279541-171279563 GCCAATAGCCAGAGTTGGCAAGG - Intronic
968254942 3:197261196-197261218 GCTAACAGACACAGGGGACATGG + Intronic
968435562 4:586426-586448 GGCACGAGCCACACTGCACATGG - Intergenic
968488842 4:878996-879018 GCCAACAGCCCGAGTGGCCAAGG + Intronic
968558308 4:1261610-1261632 GCTAAGAGCAACAGTGGGTAAGG + Intergenic
969560333 4:7942597-7942619 GCCAATAACCTCAGTGGACCTGG + Intergenic
970353504 4:15229584-15229606 GCCTAGAGGCATTGTGGACAAGG - Intergenic
970567144 4:17342620-17342642 GACACAAGCCACAGTGCACAAGG + Intergenic
971673543 4:29595159-29595181 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
972672515 4:41227171-41227193 ACCTAGAGCCACTGTGGAAAGGG - Intergenic
975479388 4:74860495-74860517 GTCAAGAGGCACAGGGGTCAGGG - Intergenic
979536697 4:121829680-121829702 GCCATGAACCACTGTGGTCAGGG - Intronic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
980247926 4:130271317-130271339 GAGAAGAGGCACTGTGGACATGG + Intergenic
982353637 4:154443605-154443627 GCCCAGAGCCCTAGTGGAGAGGG - Intronic
983168887 4:164513284-164513306 GCCAAGAGCCTGAGTGCAAAAGG + Intergenic
986948356 5:13051339-13051361 GTCAAGAGCCACAGAGAACTAGG - Intergenic
987181527 5:15372937-15372959 GCCGAGAGCCTCTGTGGCCAGGG - Intergenic
988229145 5:28451343-28451365 GGCAAGAGACACAGAGAACATGG - Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
997593995 5:135094336-135094358 GCAAAGAGCAACAGTGGCCTGGG - Intronic
999536873 5:152527341-152527363 GCCAAGAGCTACAGTTCTCAAGG + Intergenic
1002174301 5:177392892-177392914 GCCATGAGCCACACTGCACCTGG + Intronic
1002430168 5:179198864-179198886 GCAGAGAGCCTCTGTGGACAAGG + Intronic
1002441999 5:179269227-179269249 GCCAAGATCAAGGGTGGACAGGG - Intronic
1003501874 6:6709952-6709974 TCCAGGAGCCACAGTGGGAATGG + Intergenic
1003557978 6:7157804-7157826 GCAAAGAGGAACAGTGGAGAGGG - Intronic
1007832016 6:44646103-44646125 GCCAGGGGCTACAGGGGACATGG - Intergenic
1007915001 6:45553076-45553098 GCCAAGAGCCACTGCAGAAATGG + Intronic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1011101544 6:83728041-83728063 GCCCAGAGACACAGAGGTCAGGG - Intergenic
1015031290 6:128598871-128598893 GGCAAGTGCCACAAGGGACAAGG - Intergenic
1015897687 6:138033186-138033208 GACCAATGCCACAGTGGACAAGG - Intergenic
1017132403 6:151118925-151118947 GCCAAGAGTCCAAGAGGACACGG + Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019188256 6:170233881-170233903 GCCAAGTGCCGCTGTGGACTCGG + Intergenic
1022544462 7:31173262-31173284 GCCAGGACCCACAGAGGGCAGGG + Intergenic
1022626617 7:32043318-32043340 GCTAAGAGGCACAATTGACAGGG - Intronic
1023890855 7:44391018-44391040 GACAAGGGCCAGGGTGGACAGGG + Intronic
1023904955 7:44515549-44515571 GTGAAGATCCACAGTGTACAGGG + Intronic
1024221707 7:47293906-47293928 GCCAGGAGCTACAGTTGAAAAGG + Intronic
1025081242 7:55985455-55985477 GGCATGAGCCACAGTGCACCTGG - Intronic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1026942537 7:74295590-74295612 GCCAGGGGCCACAGAGGAGAGGG + Intronic
1029185535 7:98735803-98735825 CCCAAAAACCACAGTGGGCAGGG + Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1032342932 7:131092818-131092840 CCCAAAAAGCACAGTGGACAGGG + Intergenic
1033195330 7:139322510-139322532 GCCAAGAGGGCCAGGGGACATGG - Intergenic
1034023046 7:147666631-147666653 GTCAAGAGACACAGTAAACATGG - Intronic
1034319682 7:150168722-150168744 GCCAAGGGCCTCAGTGGAAGAGG + Intergenic
1034426594 7:151017262-151017284 GCCGAGAGCCACTGTGAGCAAGG + Exonic
1034578063 7:152018782-152018804 GCAAAGACCTACAGTGGTCACGG + Intronic
1034773070 7:153798497-153798519 GCCAAGGGCCTCAGTGGAAGGGG - Intergenic
1035627002 8:1077975-1077997 GGCAACAGCCACAGAGGACATGG - Intergenic
1036647763 8:10622852-10622874 CCCAAGACCCCCAGTGGACCAGG - Exonic
1036759587 8:11498013-11498035 CACAAGCCCCACAGTGGACAAGG - Intronic
1036767526 8:11558215-11558237 GGCAGGAGGCACAGTGGCCAGGG - Intronic
1037300676 8:17448456-17448478 GCCAAGTGCCACAGTAGAGATGG - Intergenic
1039401077 8:37269715-37269737 GCCAAGAGCTAGACTGGCCAGGG + Intergenic
1040462626 8:47663350-47663372 GCCAAGAAACACAGAGGGCAGGG + Intronic
1040558947 8:48506539-48506561 CACATGAGCCGCAGTGGACAAGG + Intergenic
1040563846 8:48548432-48548454 GCCAGGAGGCACAGTGAAGAGGG + Intergenic
1041520769 8:58753667-58753689 CAGAAGAACCACAGTGGACACGG - Intergenic
1042114455 8:65415452-65415474 GCCAAGAGCCAAACAGGAAAAGG + Intergenic
1042837300 8:73090464-73090486 CCCAGGAGCCACAGTCGGCATGG + Intronic
1045198146 8:99950869-99950891 GCCAAGGGCCTCAGAGGACTAGG - Intergenic
1045344166 8:101279761-101279783 GCCCAGAGCAACAGGTGACATGG + Intergenic
1046175072 8:110564967-110564989 TCCAAGAGCCTCATTGGAAAAGG + Intergenic
1047121373 8:121908609-121908631 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
1047122042 8:121915514-121915536 GCCAAGAACCAAAATGGAGAGGG + Intergenic
1047553422 8:125901860-125901882 GGCAAGATCCACAGAGAACATGG - Intergenic
1048173135 8:132127545-132127567 GTCAAGAGCCACAGTAGCTATGG - Exonic
1049072017 8:140363444-140363466 GTCCAGAGCCACAGTGGAGATGG + Intronic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1052917069 9:33931533-33931555 CCCATGAGCCACAGAGGGCAGGG + Intronic
1052999329 9:34568896-34568918 GCCCAGAGACACAGTCCACAGGG - Exonic
1053159096 9:35801082-35801104 GCCCAGAGCCACAATTGCCAGGG - Exonic
1054691110 9:68322314-68322336 CCCAAGAGCCACAGGGGAAGAGG + Intergenic
1055918408 9:81432100-81432122 GCCCAGAGTCACAGTGGAAGAGG + Intergenic
1057802324 9:98198020-98198042 GCCAGGAGCCCACGTGGACAGGG + Intergenic
1058642461 9:107100656-107100678 CCTAAGAGCCACTGGGGACAGGG + Intergenic
1059726802 9:117016322-117016344 TCCAAGAGCCACAGGTGTCAGGG + Intronic
1060768037 9:126309573-126309595 GCCAGGAGCCACAGAGGAAGAGG - Intergenic
1060822556 9:126669896-126669918 GACAGGAACCACAGTGGCCATGG + Intronic
1061372730 9:130206884-130206906 GCAGCGGGCCACAGTGGACATGG + Intronic
1062347648 9:136122775-136122797 GCCAAAACCCACGGTGGCCACGG - Intergenic
1191057732 X:56260110-56260132 GCACAGAGCCACAGAGGAGAAGG - Intronic
1191974562 X:66858119-66858141 GCCAGGAGGCACAGGGGTCAGGG - Intergenic
1192218612 X:69181280-69181302 GCAAAGAGCCACAGATGAGATGG + Intergenic
1192425584 X:71073151-71073173 GCCAAGAATCACTGTGGTCAAGG - Intronic
1193645774 X:84066803-84066825 GTCAAGAGGCACAGGGGTCAGGG - Intronic
1196825763 X:119739112-119739134 GCCAAGTGAAACAGTGGCCAGGG + Intergenic
1198093039 X:133350793-133350815 GACATGAGCCACAGTTGACCAGG + Intronic
1198758081 X:140001577-140001599 GTCAGGAGGCACAGTGGTCATGG - Intergenic
1200075134 X:153547031-153547053 GCCAAGAGCCCCAGTGGATCGGG + Intronic
1202363828 Y:24140422-24140444 GCCCAGAGCAACTTTGGACATGG + Intergenic
1202506952 Y:25529700-25529722 GCCCAGAGCAACTTTGGACATGG - Intergenic