ID: 1108441905

View in Genome Browser
Species Human (GRCh38)
Location 13:50462739-50462761
Sequence GTGGCTATAAAAGGGCACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108441893_1108441905 18 Left 1108441893 13:50462698-50462720 CCAGGGATTACTCAGGGAGTGGG 0: 1
1: 0
2: 0
3: 21
4: 155
Right 1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG 0: 1
1: 1
2: 6
3: 32
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108441905 Original CRISPR GTGGCTATAAAAGGGCACCA CGG Intronic
901348955 1:8574777-8574799 GTGGCTAGGAGAGGGCACGAGGG + Intronic
904206802 1:28860862-28860884 CAGGCTATAAAAGGGCACCAGGG - Intronic
905747914 1:40435186-40435208 TAGGCTATAAAAGGGCAGTATGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907852243 1:58266683-58266705 ATGGATACAAAAGGGAACCAAGG + Intronic
908072667 1:60480275-60480297 GTGACTAGAAGAGGGCACAAGGG + Intergenic
908318816 1:62961339-62961361 TTGGCTATAAAAATGCACCTTGG + Intergenic
913221479 1:116664223-116664245 GTGGCTTTAAAGGGGCACAGTGG - Intronic
915309078 1:154998349-154998371 GTGACCATTAGAGGGCACCAGGG - Intergenic
915864561 1:159485284-159485306 GTGATTATAAAAAGGGACCATGG + Intergenic
916799689 1:168204785-168204807 GTGGGTAAAAAAGGGCAAAATGG + Intergenic
917123971 1:171669820-171669842 TTGGCTACAAAAAGGCACAAAGG - Intergenic
919855241 1:201701472-201701494 GTGGCTCTAAGAGTGCTCCAAGG + Intronic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
920938956 1:210462789-210462811 GTGGCTATAAATGGTAACCCTGG - Intronic
924133294 1:240935196-240935218 ATGGGTCTAAAAGGGCACCGAGG - Intronic
1063433784 10:6014332-6014354 GTTGCCACAAGAGGGCACCATGG + Intronic
1064692273 10:17930474-17930496 GTGGCTATAATGGTGCAGCATGG + Intergenic
1065144767 10:22757560-22757582 GTGGCTATAAAAGTGTTGCATGG - Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1070933020 10:80274048-80274070 GGGGCTATAAAACGAGACCAGGG - Intronic
1071571142 10:86698046-86698068 ATGGCTATAAAAAGGCGGCATGG - Intronic
1071749060 10:88454286-88454308 ATGGCTGGAAAATGGCACCAAGG - Intronic
1072888361 10:99299927-99299949 GAAGCTATAAAAGGGAACAATGG + Intergenic
1074566753 10:114586351-114586373 GTGGCTAGTTAAGTGCACCATGG + Intronic
1074971393 10:118542352-118542374 GTGGCTCTTAAGGGACACCAAGG - Intergenic
1075077796 10:119362734-119362756 GGGGCTATAATAAGGCTCCAAGG - Intronic
1075796421 10:125123206-125123228 ATGACTATAAAAGGGCAACGGGG + Intronic
1076723138 10:132401453-132401475 ATGGCTCTAAAAGGGCAGCCTGG + Intronic
1078568486 11:12437658-12437680 GTGGGAATAAAAGAGCATCAAGG + Intronic
1078793043 11:14564160-14564182 ATGATTATAAAAGGGCAGCATGG - Intronic
1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG + Intergenic
1079150027 11:17890117-17890139 GTGGCTAAGAAGGGGCAGCAGGG + Intronic
1080858424 11:36132005-36132027 ATAGCTTTAAAAGAGCACCAAGG + Intronic
1082101145 11:48174115-48174137 GTGGCTGAAAGGGGGCACCAAGG - Intergenic
1084028108 11:66465632-66465654 GTGGATATAGTAGGGCCCCAGGG + Intronic
1084197713 11:67533788-67533810 GTGGCCAAAAAAGGGGACAAGGG - Intergenic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1085770175 11:79318230-79318252 GGGGGGATAAAAAGGCACCAAGG + Intronic
1088208386 11:107422457-107422479 GAGATTATAAAAGGGCACAAAGG + Intronic
1091055582 11:132415597-132415619 GTGCCTTAAAGAGGGCACCATGG + Exonic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1097501498 12:60409681-60409703 GTGGCTCTACAAGGTCACCATGG + Intergenic
1100071244 12:90721172-90721194 TTGACTATAAAGGGGCACAAAGG - Intergenic
1100216092 12:92450219-92450241 GTGGATACAAATGAGCACCATGG + Intergenic
1100503265 12:95194622-95194644 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100503379 12:95195788-95195810 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100915487 12:99415981-99416003 GTAGCTATAAAAGGGCAATGGGG - Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1108080234 13:46727644-46727666 GTGTCAATAAAAGGTCAACATGG + Intronic
1108091164 13:46851585-46851607 GTGGCTTTACAAGGGCAGGATGG + Intronic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1113259957 13:108550983-108551005 GTTTCTATAAAAAGGCACAAGGG - Intergenic
1116146157 14:41071840-41071862 GCGGCTATAAAAGTGCTCCCAGG - Intergenic
1117684334 14:58238027-58238049 GTGGATAGAGAAGGGGACCAAGG + Intronic
1117768254 14:59106086-59106108 ATGGCTATGAAAGGCCAGCATGG + Intergenic
1117896343 14:60491345-60491367 GTGCCTATAAAAGGGCTTGAGGG - Intronic
1119387441 14:74266442-74266464 GTGGCTATAACAGAATACCATGG + Intergenic
1119528681 14:75343739-75343761 GTGGCTATCAACGAGCTCCATGG + Intergenic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1121276184 14:92669503-92669525 GTGGCTCTAAATGGGAATCATGG + Intronic
1124646745 15:31442323-31442345 GTGACTGCAAAAGGGCATCAAGG - Intergenic
1124711077 15:32012452-32012474 GTGGCTGTAAAAGGACAGTATGG - Intergenic
1126063863 15:44810248-44810270 GCAGCTATAAAATGGCACAAAGG - Intergenic
1127104303 15:55596734-55596756 GTGGCTATAAAGGGCTAACAAGG - Intergenic
1127607495 15:60602917-60602939 TTGGCTATAAAGGGGCACAGAGG - Intronic
1127787983 15:62372978-62373000 TAGGTTATAAAAAGGCACCATGG + Intergenic
1128534123 15:68477900-68477922 GTGGCTCTAAAAGAGCATCATGG + Intergenic
1136281412 16:29213600-29213622 GTGGCTATCAAGGGACACCTGGG - Intergenic
1138965147 16:62075224-62075246 GTAACTCTAATAGGGCACCATGG + Intergenic
1141889737 16:86918645-86918667 GTGGCAATTAAATGACACCAGGG + Intergenic
1142085782 16:88179528-88179550 GTGGCTATCAAGGGACACCTGGG - Intergenic
1146317053 17:31815530-31815552 TTGGCTATAAAGAGGCCCCAGGG - Intergenic
1146768232 17:35543522-35543544 GTGACTCTAAAAGGGCTGCAAGG - Intergenic
1147347594 17:39812615-39812637 CTAGCTATCAAATGGCACCAAGG + Intronic
1148513647 17:48195385-48195407 GTGGATATCAAATGGAACCACGG - Intronic
1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG + Intergenic
1151937501 17:77271755-77271777 GTGGCTTTAACAGGCAACCAGGG - Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1155226967 18:23737410-23737432 GGGGCTATGAAAGGTCACCACGG - Intronic
1156233419 18:35177763-35177785 GCAATTATAAAAGGGCACCAAGG + Intergenic
1162914412 19:13866204-13866226 GTAGCTTTAAAAGGGCTCCCCGG - Intronic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
925211969 2:2057213-2057235 GGGGCTATAAAAGGACACAGAGG - Intronic
925235040 2:2270673-2270695 GTGGCCATAAAAGGACATTAAGG + Intronic
926905969 2:17805973-17805995 GTGGCTATAAGAAGGTACTATGG + Intergenic
934987339 2:98897099-98897121 GTGGCTATAAAGGAGCAGCATGG - Intronic
935126315 2:100226597-100226619 GTGGCTATAAAACATCAACAGGG - Intergenic
935734024 2:106091891-106091913 GTGCCTACAAAAGGGGCCCAAGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
937275555 2:120681759-120681781 GTGGCTTTCAGAGGGCTCCAGGG + Intergenic
938273781 2:129998228-129998250 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938278134 2:130045760-130045782 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938329104 2:130436561-130436583 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938360841 2:130684932-130684954 GTGGTTCTAAAATGGCACCCAGG + Intergenic
938437245 2:131291625-131291647 GTGGTTCTAAAATGGCACCCAGG + Intronic
938442427 2:131347887-131347909 GTGGTTCTAAAATGGCACCCAGG + Intronic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
943705775 2:191032697-191032719 GTGGCTATGAGAGGCCCCCATGG + Intronic
944349292 2:198708173-198708195 GTGGCAATCAATGGGAACCATGG + Intergenic
947438728 2:230097632-230097654 TTGGGTACAAAAGGGCACAAGGG - Intergenic
1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG + Intergenic
1175567692 20:59993909-59993931 GTGACTAAAGAAGGGCACCATGG - Intronic
1176624050 21:9076002-9076024 GAGGCTACCAAAGGGCACCTTGG + Intergenic
1177641326 21:23847711-23847733 ATGGCTATAAAAGGATAGCATGG - Intergenic
1181167541 22:20991699-20991721 GTGGCGGTCAAAGGCCACCATGG - Exonic
1181377563 22:22472145-22472167 GAAGCTATAAAAGGGCACAATGG + Intergenic
1181736697 22:24887221-24887243 CTGGCTATAAAAGGACAACGTGG - Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
951273258 3:20653804-20653826 GTGGCTATATAATGTCATCAAGG + Intergenic
953199304 3:40764239-40764261 GTGGCTCTACAAAGTCACCAGGG - Intergenic
953956761 3:47237443-47237465 GTAGCTATCAAAGGGCTCCAGGG + Intronic
959607013 3:108251976-108251998 GTGGCTACAAAAGGTCAGCATGG - Intergenic
959825976 3:110796331-110796353 GTGACTATAAAAGGGTCACAAGG + Intergenic
964626176 3:158762192-158762214 GTGCCTATAAAAGGCACCCAGGG + Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
967889348 3:194354074-194354096 GTGGCTAGGGAAGGGCAACAAGG + Intergenic
968169137 3:196494725-196494747 GTGGCTATAAATGGCAATCAGGG + Intronic
970368784 4:15387381-15387403 GTGGCTAGACAAGATCACCAAGG + Intronic
970857696 4:20667651-20667673 GTGTCTATCAAAAGGCTCCAGGG + Intergenic
971480825 4:27113581-27113603 GTGTCAATAAAAGGGCATCATGG - Intergenic
972425480 4:38928779-38928801 GTGGACATAAAAGGGCACCTGGG + Intronic
976261310 4:83147601-83147623 GTGTCTGTGAAAGGGTACCAAGG + Intergenic
978197170 4:105984972-105984994 TTGGCTAGGAAAGGGCACCGTGG + Intronic
980344102 4:131590224-131590246 GTGGCTTTAATAGGAGACCATGG + Intergenic
985362800 4:189193205-189193227 CTGTTTTTAAAAGGGCACCAGGG - Intergenic
986817059 5:11424341-11424363 GTGGCTAAAAAGGGGTAGCACGG + Intronic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
988798369 5:34673699-34673721 GTGGCTATAGCAGGGCCTCAGGG + Intronic
991210561 5:64099645-64099667 GTGGCTGGAAAAGGAGACCAGGG + Intergenic
991430759 5:66542378-66542400 TTGACTATAAAAGGGTACAAGGG - Intergenic
991662726 5:68967027-68967049 GTGGCTGTAAAAGGATATCAAGG + Intergenic
996851331 5:127956627-127956649 ATGTTTATAAAAGGGCAACATGG + Intergenic
1000323305 5:160152218-160152240 GTGGTTATGAAAGAGCAACATGG - Intergenic
1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG + Intergenic
1000981301 5:167819838-167819860 GTGGCTTCAATGGGGCACCAAGG + Intronic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1005762381 6:28979317-28979339 GTGGCTGTAAAAGGGCCAAAAGG + Intergenic
1009470164 6:64023006-64023028 GTGGCTAGAGAAGGGCAGAATGG - Intronic
1010138780 6:72587872-72587894 GTAGTTATAAAAGGGCAAAATGG - Intergenic
1010650635 6:78451073-78451095 GGGACTATATAAGGGAACCAGGG + Intergenic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1017543746 6:155428979-155429001 GTGGCTTTAAAATGGCGCCAGGG - Exonic
1017753972 6:157514186-157514208 GTGGGTATAAATGGGTTCCAGGG + Intronic
1018717995 6:166549666-166549688 GTGTCCATAAAAGGGTACCATGG + Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1023112685 7:36829968-36829990 GGGGCTGGAAAAGGACACCAGGG + Intergenic
1024243956 7:47455505-47455527 GTGGATATGAAAGGGAAGCAGGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1027592440 7:80134328-80134350 GGGACTAGAAAAGGGCACCAAGG - Intronic
1027824551 7:83094026-83094048 ATGGCTATAAAACAGCACGAGGG - Intronic
1028861137 7:95651899-95651921 GTGGCTATAAAAGAATAACATGG - Intergenic
1033181584 7:139184569-139184591 GTGACTGTAAAAGGGTAACAAGG + Intronic
1035774308 8:2175749-2175771 GGGGCTATAAGAGGGCACATTGG - Intergenic
1037898891 8:22676087-22676109 GAGGCTGGAAAAGGGGACCACGG - Intergenic
1038026978 8:23599794-23599816 GTGACTAAAAAAGAGCAGCATGG - Intergenic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1047041098 8:120996625-120996647 TTGGCTGTGAAAGGGCACAAAGG - Intergenic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1055633366 9:78247677-78247699 GGGGCTATAAAAGGGAAAGAGGG + Intronic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1058119318 9:101120908-101120930 GTGGCTATTACAGGGAAACAAGG + Intronic
1061612639 9:131757754-131757776 GTGGCTAGAAAAGGAAACCAGGG + Intergenic
1062193690 9:135260801-135260823 GTGGGTATGGAAGGGCAGCAGGG + Intergenic
1062535969 9:137021247-137021269 GTGGGTATCCAATGGCACCATGG - Intronic
1203747233 Un_GL000218v1:46430-46452 GAGGCTACCAAAGGGCACCTTGG + Intergenic
1187570951 X:20501087-20501109 TTGACTATAAAAGGGCACAAGGG - Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1194054003 X:89107803-89107825 GTGGCTAAAAAAGATCAACAAGG + Intergenic
1194100283 X:89694687-89694709 CTGTGTATAAAAGGGCACGATGG - Intergenic
1194947706 X:100089319-100089341 GTGACTAGAAAGGGGCAACAGGG + Intergenic
1196262334 X:113597813-113597835 GAGGCTAACAAAGGGGACCAAGG - Intergenic
1198869586 X:141161696-141161718 TTGGCTAGATAAGGCCACCATGG + Intergenic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic
1200453286 Y:3356046-3356068 CTGCATATAAAAGGGCACGATGG - Intergenic