ID: 1108442297

View in Genome Browser
Species Human (GRCh38)
Location 13:50467153-50467175
Sequence TGTGGTTCACAGGATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108442297 Original CRISPR TGTGGTTCACAGGATGATGA GGG (reversed) Intronic
902141926 1:14364117-14364139 TGTTGTTGACAGGATCATGGAGG + Intergenic
902464449 1:16607425-16607447 TGTGTTTCAGAGGAGGAGGAAGG - Intronic
907987905 1:59551076-59551098 GGGGGTTCAGATGATGATGATGG + Intronic
910906166 1:92181497-92181519 GGAGGGTCTCAGGATGATGATGG + Exonic
912681706 1:111733309-111733331 GGTGGTGCTCAGGATGATGGAGG - Intronic
913993196 1:143634422-143634444 TGTGTTTCAGAGGAGGAGGAAGG - Intergenic
914086039 1:144455448-144455470 TGTGTTTCAGAGGAGGAAGAAGG - Intronic
914191932 1:145419399-145419421 TGTGTTTCAGAGGAGGAAGAAGG - Intergenic
914489470 1:148142328-148142350 TGTGTTTCAGAGGAGGAAGAAGG - Intronic
914589837 1:149097349-149097371 TGTGTTTCAGAGGAGGAAGAAGG - Intronic
916055447 1:161066209-161066231 TGTGGTGTGCAGGAGGATGAAGG - Intronic
916314079 1:163428087-163428109 TGAGGTTCAGAGAATGAAGAGGG + Intergenic
917468971 1:175309652-175309674 TGTGATAAACAGGATCATGACGG + Intergenic
917971333 1:180210031-180210053 TGGGGTCTACAGGATGATGGTGG - Intergenic
918328194 1:183430602-183430624 TGTGTTTCACAAGTTGAGGAAGG + Intergenic
918781525 1:188705698-188705720 TGTGGAGCACAGGATGTTCAAGG - Intergenic
920542141 1:206786828-206786850 TGTTGTTCTCAGAATGTTGATGG - Intergenic
922124298 1:222707960-222707982 TGTGGTCCACAGATTGGTGATGG - Intronic
922532606 1:226355955-226355977 AGTGGTTCAGAGGATGATCCAGG + Intergenic
923384492 1:233453071-233453093 TTTCGTTCACAGGAGGATGCTGG - Intergenic
1063966785 10:11352262-11352284 TGTGGTTGCCAGGATGATGCAGG + Intergenic
1064119440 10:12606158-12606180 CGCGGCTCACAGGAGGATGACGG - Intronic
1068385602 10:56322946-56322968 TGAGGATAACAGGATGAAGAAGG - Intergenic
1069585487 10:69598206-69598228 TATGGCTCACTGGATGATGGAGG - Intergenic
1069902612 10:71714772-71714794 TGTGGGTCACAGCAGGATGGGGG + Exonic
1070341562 10:75502953-75502975 TGTGGGTCACAGGGTGGTGTGGG - Intronic
1070396596 10:76016658-76016680 TGTGTTTCAGAGAATGAAGATGG + Intronic
1070726926 10:78798540-78798562 TCTGATTCACAGGCTGATTACGG + Intergenic
1073331163 10:102670676-102670698 TGTCATTCACAGTATGAGGATGG - Intergenic
1074532495 10:114306642-114306664 TGTGGTCCAGAGGATTGTGACGG - Intronic
1075867517 10:125738657-125738679 TGTGGGTAACAGGAAGATGCAGG - Intronic
1076580587 10:131507052-131507074 TTTGGTTATCAGGATGATGCTGG + Intergenic
1076665731 10:132090196-132090218 TTTGGTTATCAGGATGATGCTGG + Intergenic
1076938594 10:133584200-133584222 TTTGGTTATCAGGATGATGCTGG - Intergenic
1077417757 11:2432778-2432800 TGTGGTTCAGAGGGAGATGCTGG - Intergenic
1078734568 11:14008267-14008289 TGATATTCACAGGATGATGCTGG + Intronic
1079472717 11:20794916-20794938 TGTGGTGCTCATGATGATTAGGG - Intronic
1080451730 11:32383627-32383649 TGTGCTTCAGAGACTGATGAGGG - Intergenic
1081153345 11:39659231-39659253 TGTCGTTCACAAGGTCATGATGG + Intergenic
1081242112 11:40719748-40719770 TGTGGTTTAAAGGGTGATAATGG - Intronic
1081260506 11:40954476-40954498 TGTTGTTCACTGGATACTGAGGG - Intronic
1086367520 11:86122704-86122726 ATTGGTTCACATGATTATGAAGG - Intergenic
1088057656 11:105604657-105604679 TGTGGATCACAGTATCATGAGGG - Intergenic
1088695947 11:112366090-112366112 TGCTGTTCAGAGGATGGTGAGGG + Intergenic
1088825127 11:113487636-113487658 TATGGGTCACACGATGTTGAGGG - Intergenic
1089112725 11:116069738-116069760 TATGGTTCACAGGGTCATAATGG + Intergenic
1089672337 11:120065108-120065130 TGTGATGTACAGGATGATGCTGG - Intergenic
1089791779 11:120950725-120950747 TCTGGCTCTTAGGATGATGAAGG + Intronic
1090227157 11:125078616-125078638 TGAGGATAGCAGGATGATGAAGG + Intronic
1091980668 12:4861372-4861394 TGAGGCTCTCAGGAAGATGACGG - Intergenic
1092104212 12:5909678-5909700 TGTGGGGCACGGGATGATGCTGG - Intronic
1094709609 12:32948402-32948424 TGTAGTTTACATGGTGATGAGGG - Intergenic
1095880236 12:47128192-47128214 TGTGGTTCAAGGGCTGATTATGG + Intronic
1097556379 12:61143947-61143969 AGGGGCTCACATGATGATGAAGG - Intergenic
1098039182 12:66336895-66336917 TGAGGTTTAGTGGATGATGATGG + Intronic
1098213304 12:68188525-68188547 TGTGGTTAGCAGGAGGTTGAGGG + Intergenic
1100521212 12:95377808-95377830 TGGGTTTCACAGGAAGATTAAGG - Intronic
1102303894 12:111790674-111790696 TCTGGTTCACATGGTGATGGGGG - Intronic
1102649504 12:114428976-114428998 AGTGGTTCATAGGCTCATGAAGG - Intergenic
1105987827 13:25586488-25586510 CCTGGTTCTCTGGATGATGAGGG + Intronic
1106617580 13:31344068-31344090 TTTGGTTATCAGGATGATGCTGG - Intergenic
1106858031 13:33874096-33874118 TGTGGTCCAGAAGAGGATGATGG - Intronic
1107802019 13:44117167-44117189 TGTGGTTTACAGGCTGCTGTTGG - Intergenic
1107997750 13:45877671-45877693 TGAGGTTCACATGATCATGGAGG + Intergenic
1108442297 13:50467153-50467175 TGTGGTTCACAGGATGATGAGGG - Intronic
1109067444 13:57716522-57716544 TGTGATTCAAAGGCTGATCAGGG - Intronic
1110059275 13:71021010-71021032 ATTGGTTCACATGATTATGAAGG - Intergenic
1111681125 13:91443001-91443023 TCAGCTTTACAGGATGATGAGGG - Intronic
1111911981 13:94323064-94323086 TGTGGTCCAAATGAGGATGACGG + Intronic
1111960278 13:94802509-94802531 TGTGGTTAATATGATGATGATGG - Intergenic
1114159174 14:20143963-20143985 TGTGGTTCCCAGGATGTTGGTGG + Exonic
1117080655 14:52148962-52148984 TTTGGTTATCAGGATGATGCTGG + Intergenic
1117956911 14:61130236-61130258 TGTGATTCTGAGGGTGATGAAGG + Intergenic
1117990569 14:61428990-61429012 TGTGGAACACAGGATAATGATGG - Intronic
1121811600 14:96896085-96896107 AGAGGTTCACAGGCTGCTGAGGG - Intronic
1122382745 14:101321280-101321302 TGTGGTCCTCAGGCTGATGCTGG - Intergenic
1123574367 15:21652162-21652184 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1123577208 15:21683265-21683287 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1123610982 15:22094749-22094771 TGTGGCTCCCAGGATGTTGGTGG + Exonic
1124147218 15:27139092-27139114 ACTGGTTCACAGGATTATGGAGG + Intronic
1126569751 15:50138063-50138085 TGTGGTTTACAGATTGCTGAAGG - Intronic
1126695474 15:51321904-51321926 TTTAGTTAACAGGATGTTGATGG - Intronic
1127270528 15:57397310-57397332 TGTGGGTCACAGGCTGATGAAGG - Intronic
1128646194 15:69380498-69380520 CGTGGTTCCCAGAATGATTACGG - Intronic
1202983231 15_KI270727v1_random:386505-386527 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1202986076 15_KI270727v1_random:417510-417532 TGTGGCTCCCAGGATGTTGGTGG + Intergenic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1135059364 16:19257885-19257907 TTTGGTTCACAAGGTAATGAAGG - Intronic
1136057247 16:27699459-27699481 TGCTGTTCACAGAAAGATGAGGG - Intronic
1141651283 16:85394420-85394442 TGATGTTCACAGGAAGAGGACGG + Intergenic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1144891832 17:18498827-18498849 TGAGGTTCACACGAGGCTGACGG + Intergenic
1145114029 17:20191592-20191614 TGTAGATGACAGGTTGATGATGG - Intronic
1145140390 17:20445490-20445512 TGAGGTTCACACGAGGCTGACGG - Intergenic
1145809919 17:27758512-27758534 TGAGGTTCACACGAGGCTGACGG + Intronic
1146106137 17:30039133-30039155 TGTGGTTCTCAGGATGGTGTTGG - Intronic
1146145174 17:30409344-30409366 TTTGGTTATCAGGATGATGCTGG + Intronic
1146669026 17:34724145-34724167 TGCGTTTTCCAGGATGATGATGG + Intergenic
1149856598 17:60088251-60088273 TGAGGATCACAGGAGGAGGAAGG + Intergenic
1151470586 17:74315276-74315298 TGCCATCCACAGGATGATGATGG - Intergenic
1153150697 18:2089490-2089512 TGTATTCCACAGGATGATGGTGG - Intergenic
1153691536 18:7599612-7599634 TGGGGTTCACAGGATCATCTGGG + Intronic
1156552263 18:38030050-38030072 AGTGGTTCACATGATTATGGAGG - Intergenic
1159302307 18:66590240-66590262 TATGGTTGACAAGATGATGATGG - Intronic
1159861006 18:73649048-73649070 TATGTTTAACAGGATGTTGAGGG - Intergenic
1162177558 19:8842452-8842474 GGGGGTTTGCAGGATGATGAAGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162439971 19:10686857-10686879 TGGTCTTCTCAGGATGATGACGG + Intronic
1166381949 19:42359255-42359277 TGTGGCTCCCAGGAGGCTGAGGG + Intronic
1167570908 19:50288490-50288512 TGTGGGAAACAGGATGTTGATGG + Intronic
924973521 2:153282-153304 TGTGGTTCACAGGTAGCTGTAGG + Intergenic
925808483 2:7675349-7675371 TGTGGTTCCCAGGACCATGCTGG - Intergenic
930328614 2:49953703-49953725 TGTGTCTCACAGGATGTTAAGGG + Intronic
932824976 2:74930715-74930737 TGTGGTACAGAGACTGATGAGGG - Intergenic
933293513 2:80463997-80464019 AGAGGTTCACAGAATCATGAAGG - Intronic
934216988 2:90040359-90040381 TGTGGGTGACAGTATGGTGATGG + Intergenic
935379349 2:102435221-102435243 TGTGGTTCTCATGATGGTTATGG + Intronic
935807162 2:106760438-106760460 TGCTGTTCTCAGGATAATGATGG + Intergenic
937763576 2:125633628-125633650 TGTGGTTCAGAGGATGGGCAGGG - Intergenic
937871539 2:126789575-126789597 TGTGAGTCACAGCATGATGCTGG + Intergenic
937978181 2:127593993-127594015 TGTGGCTCCCAGCATGATGGAGG - Intronic
938383958 2:130851641-130851663 TGTGGGTCACATGAAGAAGAAGG + Intronic
938930877 2:136086071-136086093 TGGGGATCACAGGATAATGCAGG + Intergenic
938978315 2:136501001-136501023 TGTGGAACACAGCATGATTAAGG - Intergenic
939135081 2:138284076-138284098 GTTGGTTCACATGATTATGAAGG - Intergenic
940474928 2:154150415-154150437 TTTGGTTATCAGGATGATGCTGG + Intronic
943292351 2:186090259-186090281 TGTGGGTCACAGAGTGAGGAGGG - Intergenic
943306003 2:186263749-186263771 TGTGGTGAACAGGATAATGGTGG - Intergenic
944858617 2:203792497-203792519 TTTGGTTCCCAGGAGGCTGAAGG + Intergenic
945483464 2:210368101-210368123 TGTGGTCCCCAGGCTGATGTTGG + Intergenic
945943103 2:215969338-215969360 TGTGGTTCAGATGTTGATCATGG - Intronic
945985524 2:216350466-216350488 TGTGGCTCACATGATGGTGTGGG - Intronic
946051871 2:216869509-216869531 TGTAGTCCAAAGGCTGATGAAGG - Intergenic
947655347 2:231821898-231821920 TGTGGTTGCCAGGATAATGGAGG - Intergenic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
1171164535 20:22958292-22958314 TGTGGGACCCAGGTTGATGATGG + Intergenic
1172190888 20:33061223-33061245 AGTGGTTCCCAGGATGGTGTTGG + Intronic
1172374303 20:34424479-34424501 GGTGCTTCTCAGAATGATGATGG + Exonic
1172947906 20:38702876-38702898 TGTGGCTCAGTGGGTGATGAAGG - Intergenic
1173196320 20:40915959-40915981 TTTGGTACAAAGGATGAGGAAGG - Intergenic
1174424137 20:50420124-50420146 TGTAGCACACGGGATGATGATGG - Intergenic
1175154940 20:56964427-56964449 TGTGGTTCAAAGGTTGATCTTGG - Intergenic
1176150399 20:63587951-63587973 TGTGGTTCCCATGAGGATGAGGG + Exonic
1176427849 21:6559796-6559818 TGTGGATAACAGGATCATGTGGG + Intergenic
1177143897 21:17386706-17386728 TGTGGTTCAGAGAATAATGATGG - Intergenic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1177380020 21:20327802-20327824 TGTTCTTCACAGGATGATATGGG - Intergenic
1177477930 21:21648400-21648422 ATTGGTTCACATGATGATGGAGG + Intergenic
1179496879 21:41777547-41777569 ACTGGCTCACAGGATGATGATGG - Intergenic
1179703341 21:43168113-43168135 TGTGGATAACAGGATCATGTGGG + Intergenic
1183088717 22:35506423-35506445 TGTGGCTCACAGGTTTATAAGGG + Intergenic
1184380098 22:44140112-44140134 TCTTGTTTGCAGGATGATGATGG + Exonic
1184940923 22:47764272-47764294 TGTGGTTGCCAGGATTATGGGGG - Intergenic
949609954 3:5693743-5693765 TGTGGTCCTCAGGCTGATGTTGG + Intergenic
950229694 3:11265785-11265807 TGTTGTTCACAGGATGAGGTAGG + Intergenic
951769668 3:26241548-26241570 TTTGGTTATCAGGATGATGCTGG + Intergenic
953956584 3:47236288-47236310 TGTGGTTCCCAGGACTGTGAGGG - Intronic
954696221 3:52428418-52428440 TGTGTTTAACAGGCTGAAGATGG - Intergenic
956782844 3:72617971-72617993 TCTGGTAGAAAGGATGATGAGGG - Intergenic
958493014 3:94802547-94802569 ATTGGTTCACATGATTATGAAGG + Intergenic
958931259 3:100210418-100210440 TGGGGTTGGCAGGATGAGGAAGG + Intergenic
960387001 3:117032891-117032913 TGTGGTTCACAGGAATAAGCAGG - Intronic
960561937 3:119094131-119094153 TATGGGTCCCAGGAAGATGAAGG + Intronic
961747907 3:129077381-129077403 ATTCGTTCACATGATGATGAAGG + Intergenic
962166584 3:133055616-133055638 TGTGGTTCATAGGAAGAATAGGG - Intronic
964074972 3:152682807-152682829 GGTGATTGATAGGATGATGAAGG - Intergenic
967821550 3:193843518-193843540 TGTTGTTAACATGATGATGTTGG - Intergenic
969257158 4:6010070-6010092 TGATGTTCACAGTGTGATGAGGG - Intergenic
974097204 4:57376332-57376354 ATTGGCTCACAGGATGATGGAGG - Intergenic
974101869 4:57425758-57425780 TGTGGTAGAGAAGATGATGATGG + Intergenic
976536517 4:86223665-86223687 TGTGGTGCAGAGGAAGAAGAGGG - Intronic
976831165 4:89316161-89316183 TGTGATTCAGAAGATGATGGAGG + Intergenic
976922687 4:90457860-90457882 TGTGGATGGCAGGTTGATGATGG - Intronic
978489406 4:109296082-109296104 TGTTGTAGACAGGAGGATGATGG - Intronic
978698866 4:111618301-111618323 TGTGTTTCACAGTATGATCTAGG + Intergenic
981071844 4:140549058-140549080 TGTGGTTCCTAGGATGGTGGGGG - Intronic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
987702161 5:21414619-21414641 TGTAGATCACAGGGTGATCAGGG + Intergenic
988247384 5:28704388-28704410 AGTGGTTCATGGGATTATGAAGG - Intergenic
990884734 5:60578591-60578613 TGTGGTTGACAAGCTGATGAGGG - Intergenic
992418385 5:76575471-76575493 AGTGGTCCACAGGAGGATGGTGG - Intronic
993994462 5:94705485-94705507 GGTGGTTCAGAGATTGATGAGGG - Exonic
994988340 5:106966600-106966622 ATTGGCTCACATGATGATGAAGG + Intergenic
996739156 5:126783241-126783263 AGTAATACACAGGATGATGAAGG - Intronic
1000670332 5:164054220-164054242 TGTGGTTGCCAGGATGAGGATGG - Intergenic
1000992189 5:167922709-167922731 TGGTGTTCACAGGATAATTAAGG - Intronic
1002810458 6:623137-623159 TGTGGTGCACGGGATGTTCATGG - Intronic
1005502047 6:26437227-26437249 TGTGGCCCACCGGATGAGGATGG + Intergenic
1006582168 6:35083445-35083467 TGTGATGGACAGGATGATGGTGG - Exonic
1007251265 6:40496662-40496684 TGTGGGTGGCAGGATGATGGAGG - Intronic
1010500503 6:76593899-76593921 TGTGGTTCTCAGGCTGATGGAGG - Intergenic
1012631096 6:101468740-101468762 TGTGGTTTACTGGATTATCATGG - Intronic
1012740160 6:103006525-103006547 TTTGGTCCTCAGGATGATGCTGG - Intergenic
1013701020 6:112769774-112769796 AATGGTTCACACGATTATGATGG + Intergenic
1014655564 6:124099633-124099655 TGTGGTTCTCAGGAGGAGGTGGG + Intronic
1015937339 6:138416642-138416664 AGTGGTTAACAGGATACTGATGG - Exonic
1016112251 6:140239622-140239644 TGTGGTTTATAGGATTCTGAGGG + Intergenic
1017881632 6:158566383-158566405 AGTGTGTCCCAGGATGATGATGG + Intronic
1018872114 6:167791148-167791170 TGTGGTTGATGGGCTGATGAAGG - Intronic
1019180590 6:170185327-170185349 TGTGGAGCACAGGAGGAGGATGG - Intergenic
1019753740 7:2752006-2752028 TGTGGGTACCAGGATGATGCTGG - Intronic
1019877919 7:3831657-3831679 TTTGGTTCAAAGCATAATGAAGG + Intronic
1020269100 7:6581766-6581788 TGTGGTTTCCAGCATGGTGAGGG + Intronic
1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG + Intergenic
1021447847 7:20752377-20752399 TGTGATTCAGAGGACCATGATGG + Intronic
1022219865 7:28302911-28302933 TGCTGTTCACAGAATGATGGCGG + Intronic
1023327422 7:39075204-39075226 TGTTGTTCACATTATAATGATGG - Intronic
1024213567 7:47227764-47227786 AGGGCTTCTCAGGATGATGAGGG - Intergenic
1025247005 7:57325114-57325136 TGTAGCACACAGGATGATGATGG + Intergenic
1028399678 7:90411266-90411288 TTTTGTTCAGAGCATGATGAAGG - Intronic
1029306899 7:99626227-99626249 GCTGGTTCCCAGGATGGTGAGGG + Intronic
1030227979 7:107173347-107173369 TGTGGATTCCATGATGATGATGG + Intronic
1030243772 7:107359451-107359473 TGTGGATGACAGGTTGATGGTGG + Intronic
1031168057 7:118254418-118254440 TGTGGTTCACTTGACTATGAAGG - Intergenic
1036140228 8:6200885-6200907 TGTGGTGCTGTGGATGATGAGGG - Intergenic
1036781637 8:11651806-11651828 TCTGCTTCTCCGGATGATGAGGG - Intergenic
1039170708 8:34741691-34741713 TTTGGTTATCAGGATGATGCTGG - Intergenic
1041433043 8:57805742-57805764 AGTGGTTCTCAGGAGGAAGATGG + Intergenic
1044535977 8:93356876-93356898 TGGGGGTCTCAGGATGAAGACGG - Intergenic
1044634577 8:94309788-94309810 TGTGGTTCATAGGATCTAGAAGG + Intergenic
1046281268 8:112035432-112035454 GGTGGTTACCAGGATCATGATGG + Intergenic
1048621153 8:136134141-136134163 TGTGGTTCAGGGGACAATGATGG - Intergenic
1048855362 8:138682312-138682334 AGTGGCTCAAGGGATGATGACGG + Intronic
1049494932 8:142925450-142925472 TCGGGTTCACATGAAGATGAGGG + Intergenic
1050085975 9:1966111-1966133 TGTGCTTCACAGGAAGAAGGAGG - Intergenic
1050931868 9:11339198-11339220 TGTTGGTCACATTATGATGATGG - Intergenic
1052454860 9:28683321-28683343 TGGAGTTCACAGGAAAATGATGG - Intergenic
1052538197 9:29775132-29775154 TCTGGGTCACAAGCTGATGAGGG - Intergenic
1052628653 9:31008410-31008432 TTTTGGTAACAGGATGATGAAGG - Intergenic
1053105768 9:35406531-35406553 GGTAGATCACAGGCTGATGAGGG - Intergenic
1056317456 9:85404308-85404330 TGTGGTCCATAAGATTATGATGG + Intergenic
1056719584 9:89060403-89060425 GATGGTACACAGGATGATCAGGG + Intronic
1060873258 9:127059793-127059815 TTTGGTTTCCAGGAAGATGATGG + Intronic
1185518764 X:720840-720862 GGTGGTTCAAATTATGATGATGG - Intergenic
1186497997 X:10027419-10027441 TGTGGTTCCCAGAATAATGGAGG + Intronic
1187048302 X:15671442-15671464 AGTGGTTCAGAGGAAGATGGGGG + Intergenic
1187527112 X:20064233-20064255 TGTTCTTCACAGGATGCTGAGGG - Intronic
1188708191 X:33361176-33361198 TTTGGTTATCAGGATGATGCTGG - Intergenic
1189160857 X:38806325-38806347 TGTTGTACATAGAATGATGAAGG + Exonic
1189710015 X:43800645-43800667 TGTGTTCAACAGGATGATAATGG + Intronic
1190027957 X:46943696-46943718 TTTGGTTATCAGGATGATGTTGG + Intronic
1190791248 X:53702555-53702577 TTTAGTTAACAGGATGAAGAAGG - Intergenic
1192950871 X:76014782-76014804 TGTGGTTCCCAGGACAATGGAGG - Intergenic
1194113099 X:89861468-89861490 TTTGGTTACCAGGATAATGATGG - Intergenic
1194908383 X:99607944-99607966 GTTGGTTCACATGATTATGAAGG - Intergenic
1198415143 X:136412278-136412300 TGTGTTTCACTGTGTGATGAAGG + Exonic
1198540044 X:137628542-137628564 TGATGTTCATAGTATGATGATGG - Intergenic
1198915882 X:141671223-141671245 TGTGGTTCAAAGGACAAAGAAGG - Intronic
1199168187 X:144702404-144702426 TGAAGTTCACAGCCTGATGAGGG - Intergenic
1199856472 X:151762914-151762936 TGTGGTTCACAGTCTGGTGCTGG - Intergenic
1200465748 Y:3516299-3516321 TTTGGTTACCAGGATAATGATGG - Intergenic
1200741637 Y:6860510-6860532 TTTGGTTATCAGGATGATGCTGG + Intergenic
1200944154 Y:8815705-8815727 TGTGGTTCAAAGGAAAAAGAAGG - Intergenic