ID: 1108446722

View in Genome Browser
Species Human (GRCh38)
Location 13:50516804-50516826
Sequence CATTAAGAAGGTTTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108446722_1108446727 5 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446727 13:50516832-50516854 ATGTGCCTGTTTCTTGCAAAGGG 0: 1
1: 0
2: 2
3: 19
4: 241
1108446722_1108446726 4 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446726 13:50516831-50516853 GATGTGCCTGTTTCTTGCAAAGG 0: 1
1: 0
2: 0
3: 32
4: 415
1108446722_1108446729 18 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446729 13:50516845-50516867 TTGCAAAGGGTTTACTATTATGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108446722 Original CRISPR CATTAAGAAGGTTTGGCTGC AGG (reversed) Intronic