ID: 1108446722

View in Genome Browser
Species Human (GRCh38)
Location 13:50516804-50516826
Sequence CATTAAGAAGGTTTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108446722_1108446729 18 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446729 13:50516845-50516867 TTGCAAAGGGTTTACTATTATGG 0: 1
1: 0
2: 0
3: 11
4: 123
1108446722_1108446727 5 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446727 13:50516832-50516854 ATGTGCCTGTTTCTTGCAAAGGG 0: 1
1: 0
2: 2
3: 19
4: 241
1108446722_1108446726 4 Left 1108446722 13:50516804-50516826 CCTGCAGCCAAACCTTCTTAATG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1108446726 13:50516831-50516853 GATGTGCCTGTTTCTTGCAAAGG 0: 1
1: 0
2: 0
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108446722 Original CRISPR CATTAAGAAGGTTTGGCTGC AGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900173049 1:1279696-1279718 GTTTAAAAAGGTTTGTCTGCTGG - Intergenic
901093409 1:6659089-6659111 CATTGAGCAAGTTGGGCTGCTGG - Intronic
901627273 1:10631397-10631419 CATTAAGAAGGGTTTGCTGCAGG - Intergenic
904151607 1:28446311-28446333 CATTAATAAGGTTTGGATCTAGG + Intronic
904241102 1:29146050-29146072 CATTGTGAAGGATTGGATGCAGG - Intergenic
907089021 1:51707354-51707376 CATTAAGAAGGTATTGAAGCAGG - Intronic
909942405 1:81625810-81625832 CAATAAGAAGTTTGGGTTGCTGG - Intronic
910236425 1:85041293-85041315 CATCAAGAAGGTTTTGCAGCAGG + Intronic
911793171 1:102044962-102044984 CAATAAGAAGGCTTGGGGGCTGG + Intergenic
913520425 1:119640404-119640426 AATTAAGCATGTTTGGCTCCTGG - Intronic
915646712 1:157277741-157277763 AATTAAGAAGGTTTTGTTGTGGG + Intergenic
917367106 1:174244217-174244239 CAGTAAGAATGTTTGTCAGCTGG - Intronic
924026862 1:239842529-239842551 CATTAAGAAAGAAGGGCTGCTGG - Intronic
924835827 1:247646212-247646234 CATTTATAAGCTTTGGCTGGAGG + Intergenic
1071168528 10:82834997-82835019 CATTAAGAAGGATTTGTAGCAGG + Intronic
1071559109 10:86631933-86631955 CATTAAATAGGCTTTGCTGCCGG - Intergenic
1078845874 11:15118025-15118047 CATGAGGAAGGGGTGGCTGCGGG - Intronic
1085468742 11:76742953-76742975 AATTAAGAAAGCGTGGCTGCCGG + Intergenic
1086237296 11:84646583-84646605 CATTATGAAGCTTTGGATTCTGG - Intronic
1086331378 11:85757662-85757684 CATCATGAAGGTTTTGCAGCGGG - Exonic
1089988350 11:122834637-122834659 CATAAAGAAGGTGTGGCCCCGGG + Intergenic
1093113557 12:15181856-15181878 CATTGCAAAGGTGTGGCTGCAGG + Intronic
1101902145 12:108798749-108798771 CATAAAGCTGGTTTTGCTGCTGG - Intronic
1102850404 12:116238794-116238816 AATTAAAAAGGTTTTGCTTCAGG + Intronic
1104360407 12:128127827-128127849 CATTACGAAGATTTGCCTACTGG - Intergenic
1106165111 13:27238266-27238288 CATTAACAAGATATGGATGCTGG + Intergenic
1106841917 13:33692880-33692902 CATTCAGATGGTTTGGCAGGGGG + Intergenic
1106956695 13:34946196-34946218 CGTTAACAAAGTTTGGCTTCTGG + Intronic
1108256623 13:48617636-48617658 CATTAGCAAGGTGTTGCTGCAGG - Intergenic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1109342759 13:61082338-61082360 CATTAAGAAGGTATGGATAGGGG + Intergenic
1109771326 13:66977420-66977442 CATAAAGAAAGTTTTGATGCTGG + Intronic
1112976572 13:105326838-105326860 CATTAAGAATGATTGCCTGGAGG + Intergenic
1113383918 13:109829745-109829767 CTGTTAGAATGTTTGGCTGCAGG - Intergenic
1114475432 14:22991228-22991250 CATTAAAAAGTTTTGCCAGCCGG + Intronic
1114475568 14:22992167-22992189 CATTAAAAAGTTTTGCCGGCTGG + Intronic
1127244887 15:57161854-57161876 CATTAATAAGATTTAGCAGCAGG - Intronic
1127308118 15:57728027-57728049 CCTTAAGAAGGTGTGACTTCAGG - Intronic
1130771904 15:86932740-86932762 CATTATGAATGTTTTGCTGAAGG + Intronic
1133354943 16:5129253-5129275 CTTTAAGTATGTTTGGATGCTGG + Intergenic
1141275693 16:82585890-82585912 CATGAAGGGGGTCTGGCTGCTGG + Intergenic
1142404350 16:89878940-89878962 CAGTAATAAGGTTTGTCTGACGG + Intronic
1144299908 17:13913632-13913654 CATTCAGATGGTTTGGCAGGGGG - Intergenic
1157329633 18:46694124-46694146 CCTTAAGAAGGAGTGGGTGCTGG - Intronic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1160309058 18:77771786-77771808 CATTAAGAAGCTCTGGCTACAGG - Intergenic
932109944 2:68989199-68989221 CATTGCCAAGGTTTGGCTCCTGG + Intergenic
938313189 2:130308126-130308148 CAATAAGCTGGTTTGGCTCCAGG - Intergenic
942053187 2:172159808-172159830 CATTAAGGTGGTTTGGTTGTTGG + Intergenic
945070284 2:205982380-205982402 CATTAAGAATGTTTGGGGCCGGG - Intergenic
1171452088 20:25243117-25243139 CACTAAGAAGGGATGGATGCTGG - Intergenic
1179471784 21:41615128-41615150 TATTAAGAATATTTGGCTTCTGG + Intergenic
1181155043 22:20914941-20914963 GATTAAGAAGGTTGAGCAGCTGG + Intergenic
1181617352 22:24064142-24064164 CATTATGGAGGTTGGGCAGCCGG - Exonic
1184354842 22:43972663-43972685 CATTAATCAGGTTTGAATGCAGG + Intronic
949324238 3:2846016-2846038 CCTTAAGAAGGTGTGGGAGCAGG + Intronic
949530037 3:4946848-4946870 CCTTAAGAAGCTTTGCCTGGGGG + Intergenic
952103686 3:30044497-30044519 GATTAAGTAGGTTTGGAAGCAGG - Intergenic
954237254 3:49266232-49266254 AATTAAAAAGGGCTGGCTGCAGG - Intergenic
954352732 3:50058612-50058634 CTTCAAGAAGGTTTGACTGGGGG + Intronic
957966090 3:87323582-87323604 CATTGACAAGGTATGGTTGCTGG + Intergenic
959040131 3:101412615-101412637 CATTAAGAAGAGTTAGCTGCTGG - Intronic
961704722 3:128775076-128775098 CATTAAGAAGGGATGTCGGCCGG - Intronic
963064235 3:141250880-141250902 TATAAAGATGGCTTGGCTGCAGG - Intronic
965435858 3:168650582-168650604 AAATAAGAAAGTTTGGCTTCTGG - Intergenic
965769780 3:172169605-172169627 CTGTAAGAAGGTTTCTCTGCCGG - Intronic
968766375 4:2472744-2472766 CATTAAGAATATTTGTCTCCAGG + Intronic
970654554 4:18217093-18217115 TATTAAGAGGGTCTGGATGCTGG - Intergenic
970785802 4:19794502-19794524 AGAGAAGAAGGTTTGGCTGCAGG - Intergenic
973260025 4:48153806-48153828 CATTATGAAGGCGTTGCTGCAGG - Intronic
974878185 4:67722670-67722692 CATTCAGATGGTTTGGCTGGCGG - Intergenic
977382644 4:96295763-96295785 AATTAAGAAGGTTTGCTTTCGGG - Intergenic
980900383 4:138899806-138899828 GATTAAGAAGGTTTGGCATGCGG - Intergenic
982924026 4:161312883-161312905 CACTAAGATGGTTTGTCTTCAGG + Intergenic
984591972 4:181627021-181627043 CGTTAACAAGGTTTCCCTGCAGG + Intergenic
984665787 4:182427749-182427771 TATTAAGAGGCTTTGGCTGAAGG + Intronic
996350144 5:122531191-122531213 CATTAACAAGGTAAGGCTTCAGG + Intergenic
996508513 5:124293590-124293612 CATAAACAAGGTTGGGCTGGTGG - Intergenic
997246225 5:132351696-132351718 AATGAAGAAGGATTGGCTGGGGG + Intergenic
997246344 5:132352926-132352948 AATGAAGAAGGATTGGCTGGGGG - Intergenic
997714398 5:136031049-136031071 AATTAAGAGGCTTTGCCTGCAGG - Intronic
1001266930 5:170280445-170280467 AATTTAGAAGGTTTGGCTCTTGG - Intronic
1003057531 6:2835843-2835865 CCTGAAGAAGGTATGGCTCCTGG - Exonic
1003094093 6:3129053-3129075 GTTTAAGAAGGTTTCTCTGCTGG + Exonic
1009268897 6:61592821-61592843 ATTCAAGAAGATTTGGCTGCTGG - Intergenic
1012075675 6:94681825-94681847 CATTAAGAATGTTTGACTTAAGG + Intergenic
1015656728 6:135526931-135526953 CATTATGTAGTATTGGCTGCTGG - Intergenic
1019895851 7:3982542-3982564 CATTAAGAATGTTTGTGGGCTGG + Intronic
1021052578 7:16006830-16006852 CAGTAACCAGGTTTGGATGCTGG + Intergenic
1028285173 7:88987878-88987900 GATTAAGAAGGTTTGGTTAATGG - Intronic
1028305325 7:89256255-89256277 CATTAAAAGGGTCTGGCTGCTGG + Intronic
1029696127 7:102214488-102214510 CATTTACTAGGTTTGGCTGTTGG + Intronic
1035492440 7:159291964-159291986 CTTTGACAAAGTTTGGCTGCTGG - Intergenic
1036812315 8:11875792-11875814 CATTCAGAAGCTTTTTCTGCTGG - Intergenic
1040694925 8:49984830-49984852 CATTAAAAATGTTTGGCTGGAGG + Intronic
1043164715 8:76889213-76889235 CAGTAGGATCGTTTGGCTGCTGG + Intergenic
1047105342 8:121725161-121725183 CATTAAAAAGTTTTCTCTGCAGG + Intergenic
1048574614 8:135680917-135680939 GTTTACGCAGGTTTGGCTGCAGG + Intergenic
1052583165 9:30388456-30388478 TATTAAGAAAGTTAGGCTTCAGG - Intergenic
1054779727 9:69155387-69155409 CAGTATGGAAGTTTGGCTGCTGG - Intronic
1054852127 9:69858021-69858043 GATTCAGAAGGTTTGTTTGCAGG + Intronic
1056542898 9:87589347-87589369 AATAAAGAAGGTTTTGCTTCTGG - Intronic
1061029452 9:128071066-128071088 CATTGAGAACGTCTGGCTGCGGG + Intronic
1061278344 9:129582559-129582581 CATTAACAAGATGTGGCGGCGGG - Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1203625743 Un_KI270750v1:18688-18710 CATTAAAAAGACTTGGCAGCTGG + Intergenic
1186226525 X:7404877-7404899 CATGAACAAGGTTTGGGTGCTGG - Intergenic
1187006497 X:15238046-15238068 CATTAAGAGGGAGTGGCTACAGG + Intronic
1187929491 X:24280938-24280960 CATATAGAAAGATTGGCTGCTGG + Intergenic
1189406734 X:40732220-40732242 CATCAAGAAGGTTTGGAGGCTGG + Intronic
1189700432 X:43713280-43713302 CATTAAGAAGACATGGATGCAGG + Intronic
1198215955 X:134554977-134554999 CATAAAGAAGGTGTGGCTGGAGG - Intergenic
1198821875 X:140656805-140656827 CATTTAGCAGGTGTGGCGGCGGG + Intergenic
1202109340 Y:21405085-21405107 CATTAGGCAGGTTAGGCTGATGG + Intergenic