ID: 1108452337

View in Genome Browser
Species Human (GRCh38)
Location 13:50579721-50579743
Sequence GAGCCTGATGTCACTACATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108452337_1108452342 10 Left 1108452337 13:50579721-50579743 CCCGATGTAGTGACATCAGGCTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1108452342 13:50579754-50579776 GTTTTAAGCTGCCGAGGGTGAGG 0: 1
1: 0
2: 3
3: 57
4: 455
1108452337_1108452343 11 Left 1108452337 13:50579721-50579743 CCCGATGTAGTGACATCAGGCTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1108452343 13:50579755-50579777 TTTTAAGCTGCCGAGGGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 141
1108452337_1108452340 4 Left 1108452337 13:50579721-50579743 CCCGATGTAGTGACATCAGGCTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1108452340 13:50579748-50579770 AGGTCAGTTTTAAGCTGCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1108452337_1108452344 15 Left 1108452337 13:50579721-50579743 CCCGATGTAGTGACATCAGGCTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1108452344 13:50579759-50579781 AAGCTGCCGAGGGTGAGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 354
1108452337_1108452341 5 Left 1108452337 13:50579721-50579743 CCCGATGTAGTGACATCAGGCTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1108452341 13:50579749-50579771 GGTCAGTTTTAAGCTGCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108452337 Original CRISPR GAGCCTGATGTCACTACATC GGG (reversed) Intronic
906214063 1:44029110-44029132 GTGGCTGATGTCTCAACATCTGG - Intronic
909895199 1:81060372-81060394 GAGTCTAATGTCACTATATTTGG + Intergenic
911172684 1:94785614-94785636 CAGGCTCATGCCACTACATCCGG + Intergenic
918422592 1:184379170-184379192 GAGCCTAATGTCAAGACAACTGG + Intergenic
919613105 1:199771448-199771470 CAACGTGATGTCACTAAATCTGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1062982176 10:1734534-1734556 GAGCCAGATGTCACCACACTGGG + Intronic
1065213776 10:23430289-23430311 GAGGCTCATGCCACCACATCCGG + Intergenic
1069373650 10:67772076-67772098 GAGACAGATGTCTTTACATCTGG - Intergenic
1070614793 10:77961418-77961440 GACCCTGATGACACCACTTCTGG + Intergenic
1073685443 10:105747415-105747437 GATCCTGATTTCACTTCCTCTGG - Intergenic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1079784563 11:24655341-24655363 AATCTTGATATCACTACATCAGG - Intronic
1087152290 11:94869738-94869760 GGGTCTGTTGTCACTCCATCCGG - Intronic
1090181224 11:124701746-124701768 CAGGCTTATGCCACTACATCTGG + Intergenic
1091201977 11:133787971-133787993 GAGTCTGTTGTCACCACAGCTGG + Intergenic
1106455751 13:29925108-29925130 AAGCCTGATGTCCTTACTTCTGG - Intergenic
1108452337 13:50579721-50579743 GAGCCTGATGTCACTACATCGGG - Intronic
1109637416 13:65140774-65140796 GGGCATGATGTCATTATATCAGG + Intergenic
1113433359 13:110269064-110269086 GAGCATGCTGTCAATACAGCTGG - Intronic
1122155829 14:99749915-99749937 GAGCACGATGTCACCCCATCGGG - Intronic
1129668401 15:77592598-77592620 GAGCCTCATGTCATTTCCTCAGG - Intergenic
1133592550 16:7259954-7259976 GAGCCTGAAATTACTAAATCAGG - Intronic
1137022023 16:35437640-35437662 GAGCCTGATGTCATGACTTATGG - Intergenic
1138854615 16:60674429-60674451 GATCTTGATCTCACTACATATGG + Intergenic
1138879499 16:60993923-60993945 ATGCATGATGTCACTTCATCTGG - Intergenic
1139964448 16:70737694-70737716 GATTCTCATGTCACCACATCAGG - Intronic
1142775925 17:2139017-2139039 GAGCCAGATGTCATAACTTCAGG - Intronic
1147228150 17:38996827-38996849 CAGCCTGAAGTAACTACTTCAGG - Intergenic
1152047363 17:77946211-77946233 GAGCCAAACGTCACAACATCTGG + Intergenic
1155700994 18:28743457-28743479 GAGCCAGATGTCACTATTGCAGG + Intergenic
1156652118 18:39236722-39236744 GCGCCTGCTGCCACTACACCTGG + Intergenic
1157670172 18:49521543-49521565 GATACTGATTTCACTTCATCTGG - Intergenic
1168278091 19:55287953-55287975 GGACCTGATGTCAGTTCATCCGG - Intronic
926559062 2:14395165-14395187 GAGCTTAATGTCACTACTTGGGG - Intergenic
926696609 2:15773871-15773893 GAACCTGGTGTCAATCCATCTGG - Intergenic
930757256 2:54988849-54988871 TAGCCTGATGTCTCAAAATCGGG + Intronic
932112645 2:69014406-69014428 GAGCTTGAATTCACTACATCTGG - Intronic
933171198 2:79127938-79127960 GCACCTCATGTCACCACATCCGG - Intergenic
933993707 2:87652104-87652126 GAGACTGATGGCACTACTTTGGG - Intergenic
936300155 2:111298779-111298801 GAGACTGATGGCACTACTTTGGG + Intergenic
937056191 2:118939054-118939076 GAACTTGATGTAACTACATTGGG + Intergenic
938846333 2:135213275-135213297 GAGCCTGATGTTTCTAAGTCTGG + Intronic
947820396 2:233064975-233064997 GAGCCAGATGTCAGTAGCTCTGG - Intronic
1168865187 20:1080286-1080308 TTGCTTGATGTCACTAAATCTGG - Intergenic
1174565191 20:51459481-51459503 CAGCCTGATGTCACTCTGTCCGG + Intronic
1184997933 22:48223899-48223921 GAGGCTGAAGTCTCTGCATCAGG - Intergenic
955322491 3:57984287-57984309 GAGCCTGCTGTGATTACATGGGG - Intergenic
956475191 3:69611923-69611945 TAACCTGATGTCACTCAATCAGG - Intergenic
962130387 3:132667140-132667162 GATACTGATGTTACTACTTCAGG - Intronic
970205137 4:13648266-13648288 AACCCTGTTGTCACTACCTCTGG + Intergenic
970629555 4:17925407-17925429 AAGCCTTAGGTCACTCCATCGGG + Intronic
975242870 4:72082207-72082229 TATGCTGATGTCTCTACATCAGG - Intronic
980046315 4:127992679-127992701 TAGACTGATGTCACTAGACCTGG + Intronic
980777742 4:137458742-137458764 GAGTCTGATGACACTAAATTTGG + Intergenic
982522580 4:156437893-156437915 GAGCCTGCTGTGCATACATCTGG + Intergenic
990208923 5:53460486-53460508 CAGCCTGATGTCACGAGTTCAGG + Intergenic
996049579 5:118916863-118916885 GAGTCTAATGTCACTAACTCTGG + Intronic
1008557031 6:52682672-52682694 AATCCTAATATCACTACATCTGG - Intronic
1018957058 6:168417259-168417281 AAGCCTCATGTCACAACCTCTGG + Intergenic
1019974308 7:4568305-4568327 GATCCTGCTGTCACTCCAGCTGG - Intergenic
1020000292 7:4751775-4751797 GATCCTGGTGTCACTCCAGCCGG - Intronic
1020692927 7:11379871-11379893 GGGCCTGGAGTCACTACATAAGG - Intronic
1021383739 7:20002394-20002416 GAACATGATGTCACTATTTCTGG + Intergenic
1027914790 7:84302773-84302795 GAGCCAGATCTTACTACATAAGG + Intronic
1029726295 7:102407788-102407810 GAGCCTGAGGACAGGACATCAGG - Intronic
1035940970 8:3900508-3900530 GAGCTGGATGACACTACAGCTGG + Intronic
1042699744 8:71599320-71599342 TAGCCTAATTTCACTACATGGGG + Intergenic
1044958250 8:97503935-97503957 GAGCATGACATCACCACATCAGG - Intergenic
1048336120 8:133503713-133503735 GTACCTGCTTTCACTACATCTGG - Intronic
1050971170 9:11876681-11876703 GAGAATGATGTCATTACAACAGG + Intergenic
1051346702 9:16157542-16157564 GAAGCTGATTTCACTACAGCTGG - Intergenic
1055599423 9:77900293-77900315 GATCCTTCTGTCACTCCATCAGG + Intronic
1056813343 9:89781587-89781609 GAGCCTGGTGTCATTCCATGTGG + Intergenic
1197767167 X:130066809-130066831 GAGCCTAGTGTGACCACATCTGG - Exonic