ID: 1108462251

View in Genome Browser
Species Human (GRCh38)
Location 13:50678305-50678327
Sequence CCATCCACTACTTGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108462251_1108462254 -8 Left 1108462251 13:50678305-50678327 CCTGCTTACCAAGTAGTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1108462254 13:50678320-50678342 GTGGATGGATGTACATCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 82
1108462251_1108462256 25 Left 1108462251 13:50678305-50678327 CCTGCTTACCAAGTAGTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1108462256 13:50678353-50678375 TTTCTGTGTTCTTTTTCTTGTGG 0: 1
1: 0
2: 7
3: 176
4: 1972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108462251 Original CRISPR CCATCCACTACTTGGTAAGC AGG (reversed) Intronic
903177492 1:21589764-21589786 CCATCCACAGCCTGGTCAGCTGG + Intergenic
903678097 1:25078540-25078562 CCAACTACTACTTGGGAGGCTGG + Intergenic
912118515 1:106438567-106438589 TCATCTACAACTTGGTCAGCAGG - Intergenic
920318175 1:205095038-205095060 CCATCCACTACTGGGTGTGAAGG - Exonic
920455511 1:206098152-206098174 CCATCAACTACCTGCTCAGCAGG + Exonic
921720831 1:218469273-218469295 CTATTCACTACTTGGGAGGCTGG + Intergenic
1071457997 10:85865779-85865801 CCAACAACTACTTGGGCAGCTGG - Intronic
1077510217 11:2955936-2955958 CCATCCACCACTTCTGAAGCTGG + Intronic
1078442620 11:11379771-11379793 CCATCCACTTCCTGGAAAGATGG - Intronic
1082939806 11:58692462-58692484 CCATTTACCACTGGGTAAGCAGG + Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1093516868 12:19997944-19997966 CTTTCCACTACATGTTAAGCAGG - Intergenic
1094220579 12:27988490-27988512 CAATCCAGTCCTTGGTATGCTGG - Intergenic
1101722834 12:107365530-107365552 CCCTCCACAACTTGGGAGGCAGG - Intronic
1105512500 13:21061931-21061953 CCAGCCACTAGTTGGTAACTTGG - Intergenic
1106606829 13:31236162-31236184 CAATCCACTACGTGCTATGCGGG - Intronic
1108462251 13:50678305-50678327 CCATCCACTACTTGGTAAGCAGG - Intronic
1113847195 13:113399193-113399215 CCCTCCACTACTCTGTATGCAGG - Intergenic
1128409568 15:67380902-67380924 ACAACTACTACTTGGTAATCAGG + Intronic
1129567070 15:76633955-76633977 CCATCCACTCCATGGGAAGGGGG - Intronic
1135704067 16:24659420-24659442 CCACCCACCACTTGGTAAAAGGG - Intergenic
1138925626 16:61587395-61587417 CCATCCACTCCATGGAAAGATGG - Intergenic
1143601482 17:7949019-7949041 CCATCCAGTATTGGGTAACCGGG + Intronic
1154012336 18:10586226-10586248 TCATCCAATACTTGCTAAGTGGG + Intergenic
1154950141 18:21201976-21201998 CCATCTAATACTTTGGAAGCAGG - Intergenic
1159095743 18:63899585-63899607 CCAACCACAAATTGGTAAGATGG - Intronic
1160147219 18:76375495-76375517 CCATCCTCTACCTGGTATCCAGG - Intronic
1162074301 19:8174866-8174888 TCATCCACCACGTGGTATGCGGG + Intronic
1166067773 19:40370156-40370178 CCACCCAGAACTTGGTATGCAGG - Exonic
932363904 2:71134120-71134142 CCATCCTTTACATTGTAAGCTGG + Intronic
933524865 2:83423880-83423902 CTATCTACAACTTGGTAAGCAGG - Intergenic
934723095 2:96595570-96595592 CCATCACCAACTTGGTAAGGAGG + Exonic
943064175 2:183069652-183069674 TCACCCACAACTTGGCAAGCAGG - Intergenic
945134176 2:206608710-206608732 CCATCCAGTGCTTGGTGGGCAGG - Intronic
946560587 2:220908001-220908023 CCATCCCCTCCTCTGTAAGCTGG + Intergenic
947739180 2:232477155-232477177 CCATCCACAGCTTTGTGAGCAGG - Intergenic
1173944808 20:46942141-46942163 CCACCCACTCCTTGGTGAGGAGG - Intronic
1175247781 20:57591957-57591979 CCAGCCACTCCTTGGTGAGATGG - Intergenic
1183185307 22:36288426-36288448 ACATCAACAACTTGGGAAGCTGG + Intronic
949567686 3:5260151-5260173 CCATCCATTACTTGTTTAGCTGG + Intergenic
950710955 3:14812293-14812315 CCAGCCACTGCTTGGAAAGGGGG + Intergenic
951785732 3:26416830-26416852 CTTTCCACTAGTTGGTATGCTGG - Intergenic
954196351 3:48999325-48999347 CCATCCAGCAGTTGGTCAGCTGG - Intronic
954307334 3:49735586-49735608 ATACCCACTTCTTGGTAAGCAGG - Intronic
954530883 3:51319414-51319436 TCATCCACTTCTTGGTAACTGGG - Intronic
955864319 3:63366621-63366643 CCATCTCCTACTTTCTAAGCTGG - Intronic
959327659 3:104957265-104957287 CCACCCACAATTTGGCAAGCCGG + Intergenic
959511204 3:107214428-107214450 GCATTCACTACTTGGTTAACTGG - Intergenic
962890153 3:139664607-139664629 CCATCATCTATTTGGTAACCTGG + Intronic
966930463 3:184672425-184672447 CCATCCAACACGTGGTAAGTGGG - Intronic
968943205 4:3650053-3650075 GCATCCACGCCTTGGAAAGCAGG - Intergenic
969941203 4:10733438-10733460 CCATGTTATACTTGGTAAGCTGG + Intergenic
970614607 4:17756572-17756594 TCATCAACTATTTGGTTAGCTGG - Intronic
974615275 4:64271957-64271979 CCACCCACAGCTTGGCAAGCTGG - Intergenic
979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG + Intergenic
991039603 5:62162101-62162123 TCATCCACAACATGGTGAGCAGG + Intergenic
992194994 5:74330419-74330441 CCTTCCACTACTAGGTCAGTAGG - Intergenic
994921801 5:106054746-106054768 CCATTCTTTACATGGTAAGCAGG + Intergenic
999431645 5:151529926-151529948 CCATTAACTATTTGGTTAGCCGG - Intronic
1008231665 6:48990632-48990654 TCATCCACAACTTGGTGAGCAGG - Intergenic
1017739164 6:157391194-157391216 TCTTCCACTGTTTGGTAAGCTGG - Intronic
1019089468 6:169516319-169516341 CCATCCAGTACATGGAATGCAGG - Intronic
1034282714 7:149864994-149865016 CCATCCTCTCCTGGGTAAACCGG - Exonic
1035081878 7:156222868-156222890 CCATCCACTACGTTGGAAGCTGG - Intergenic
1038403999 8:27308511-27308533 CCCTCCACCACTTGGTAAGAAGG - Intronic
1038404582 8:27311674-27311696 CCAGCCACTACTTCGGAAGCAGG - Exonic
1041364190 8:57083685-57083707 TCTTCCACTACTGGGTGAGCAGG - Intergenic
1046635824 8:116674368-116674390 CCATCCACTACTTCGTTTGCTGG - Intronic
1049193756 8:141304172-141304194 CCAGCAGCTACTTGGGAAGCTGG + Intronic
1053261094 9:36665346-36665368 CTGTCCAGTACTTGGTAAACTGG - Exonic
1058470897 9:105277748-105277770 CCATGCACTACTTGGTTACATGG - Intronic
1188808147 X:34617091-34617113 TCATACTCTACTTGGTCAGCTGG + Intergenic
1195240056 X:102942225-102942247 CCACCCACAACCTGGGAAGCTGG + Intergenic