ID: 1108462316

View in Genome Browser
Species Human (GRCh38)
Location 13:50678781-50678803
Sequence CCTGGGGGTCACTCTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108462316_1108462334 1 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462334 13:50678805-50678827 CCGGGGGTGGGAGGGATGGTGGG 0: 1
1: 2
2: 10
3: 94
4: 721
1108462316_1108462336 9 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462336 13:50678813-50678835 GGGAGGGATGGTGGGCAGGCAGG 0: 1
1: 0
2: 16
3: 234
4: 2967
1108462316_1108462327 -7 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462327 13:50678797-50678819 CCCCAGGCCCGGGGGTGGGAGGG 0: 1
1: 2
2: 7
3: 69
4: 636
1108462316_1108462332 0 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462332 13:50678804-50678826 CCCGGGGGTGGGAGGGATGGTGG 0: 1
1: 0
2: 11
3: 130
4: 1141
1108462316_1108462325 -8 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462325 13:50678796-50678818 CCCCCAGGCCCGGGGGTGGGAGG 0: 1
1: 1
2: 7
3: 85
4: 656
1108462316_1108462330 -3 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462330 13:50678801-50678823 AGGCCCGGGGGTGGGAGGGATGG 0: 1
1: 0
2: 13
3: 150
4: 1403
1108462316_1108462335 5 Left 1108462316 13:50678781-50678803 CCTACTACAGAGTGACCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1108462335 13:50678809-50678831 GGGTGGGAGGGATGGTGGGCAGG 0: 1
1: 1
2: 28
3: 361
4: 7446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108462316 Original CRISPR CCTGGGGGTCACTCTGTAGT AGG (reversed) Intronic
900278057 1:1845742-1845764 CCTGGGGTTCAATCTGAATTTGG + Intronic
901803733 1:11724658-11724680 CGTGGGGCTCACTCTGCAGCTGG + Exonic
908037863 1:60075008-60075030 CCAGGGGCTCACTCTCTAGAGGG + Intergenic
912468947 1:109893419-109893441 CCTGGAGCTCACACTTTAGTGGG + Intergenic
917453413 1:175166022-175166044 TTTGGAGGTCACTCTGGAGTTGG - Intronic
918141217 1:181721493-181721515 GGTGGGAGACACTCTGTAGTTGG + Intronic
918536574 1:185581704-185581726 CCTGGGGGTCACTCCTTGGTTGG - Intergenic
919788371 1:201274664-201274686 CCTGGGGGACAGCCTCTAGTAGG + Intergenic
920304782 1:205011601-205011623 CCAGGGGCTTACTCTGTAGCTGG - Intronic
923139802 1:231151612-231151634 CCTGGGGGAGACTCTGTTGGGGG + Intergenic
923144027 1:231185412-231185434 CCTGGGGGTCCCGCCGTGGTGGG - Intronic
923251328 1:232181820-232181842 CCTGGGTGTTCCTCTGGAGTTGG - Intergenic
1063590303 10:7388813-7388835 CCTGCGTGTCACTCTGCAGATGG + Intronic
1066674731 10:37876135-37876157 CCTGGAGTTCACTCTGCAGTGGG + Intergenic
1067750634 10:48968996-48969018 CCTGGGGGCCCAGCTGTAGTGGG + Intronic
1070448987 10:76538587-76538609 CCTGGGAATCACTCTATATTAGG + Intronic
1071347416 10:84706080-84706102 CCTGGTGGTAGCTCTGTAGAAGG + Intergenic
1072563283 10:96596529-96596551 CTTGGGAGACACACTGTAGTAGG + Intronic
1073215390 10:101833359-101833381 CCTGGAGATCACTCTGCACTTGG + Intronic
1074058519 10:109943694-109943716 CCTGGTGGTCTCTCTGTGGAGGG - Intronic
1076032969 10:127175237-127175259 CTTGGGGGTCATTCAGGAGTTGG - Exonic
1076209037 10:128625923-128625945 CCTGGGGGTCTCTCTGCAGCAGG + Intergenic
1077045121 11:541278-541300 CCTGGGAGTCTCTCTGGAGACGG + Intronic
1077117229 11:890612-890634 CCCTTGGGTCACTCTCTAGTTGG - Intronic
1077717689 11:4598500-4598522 CCTGGGGGTAACTGAGAAGTAGG - Intergenic
1077864177 11:6209773-6209795 CCTGGGGGTCAATTTAAAGTAGG + Intronic
1078271373 11:9798205-9798227 CCTGGGTTTGACTCTCTAGTAGG + Intronic
1079404644 11:20133871-20133893 ACTGGGGGGCACTCTGTAACAGG - Intergenic
1081725270 11:45323317-45323339 CCTGGGGGACACTCTGAGGAGGG + Intergenic
1084000466 11:66292871-66292893 CCTGGGGGTCAGTTTGCAGTGGG + Intronic
1085336572 11:75701251-75701273 CCTGGGGATCCCTCTCCAGTGGG - Intergenic
1086248784 11:84788690-84788712 CATGGAGGTCCCACTGTAGTAGG - Intronic
1086483329 11:87269193-87269215 CCTCGGGGACAATGTGTAGTAGG - Intronic
1088909855 11:114182601-114182623 CCTGGGGCTCAACCTGGAGTAGG - Intronic
1089574793 11:119434063-119434085 CTTGGGGGTCATTCTGTATGAGG + Intergenic
1091468432 12:705760-705782 GCTGGGGGTGACTCTTTAATGGG - Intergenic
1091968680 12:4767124-4767146 CCAGGGGAACACTTTGTAGTTGG - Intronic
1094284310 12:28775488-28775510 CCAGAGCGTCACTCTGTGGTTGG + Intergenic
1095142157 12:38677426-38677448 AGTGGGGGTCACTCCGTATTGGG - Intronic
1096233337 12:49909692-49909714 CCTTGGCCTCACTCTGCAGTGGG - Intergenic
1096504603 12:52084823-52084845 CTTGGGGGTAAGTCTGTGGTGGG + Intergenic
1100737858 12:97557692-97557714 GCTGGGGGTCACTTTGTACTGGG + Intergenic
1103952580 12:124559034-124559056 CCTGGGGGTCAGTCTTTTCTGGG - Intronic
1104999434 12:132680123-132680145 CCTGTGTGTCATTCTGTGGTGGG - Intronic
1108462316 13:50678781-50678803 CCTGGGGGTCACTCTGTAGTAGG - Intronic
1114203397 14:20544312-20544334 CCTTTGGGTCACCCAGTAGTGGG + Intergenic
1120103732 14:80471782-80471804 CCTGGGGGTCACTCTTTGACTGG + Intergenic
1125078880 15:35653398-35653420 CCTGGGGGTAAGGCTGTAGAGGG + Intergenic
1127489159 15:59445946-59445968 GCTGGAGGTCACCCTGCAGTGGG - Intronic
1129160594 15:73745554-73745576 CATGGGGTTTACTGTGTAGTGGG - Intronic
1129375676 15:75129439-75129461 CCTGGGGGTCACTTCCTAGATGG - Intergenic
1132291506 15:100706785-100706807 GGTGGGGGTCTCTCTGTGGTTGG - Intergenic
1132644479 16:992466-992488 CCTGGGGGTCCCTGGGTAGAAGG + Intergenic
1133014412 16:2932866-2932888 CCTCTGGGTCACTCGGTGGTAGG + Intronic
1134452990 16:14374710-14374732 CCTGGGGTTCTCCCAGTAGTCGG + Intergenic
1141987635 16:87590161-87590183 CCTGGGGGTGCCTCCGAAGTGGG + Intergenic
1142263999 16:89055296-89055318 CCATGGTGTCACTCTGTAGTCGG - Intergenic
1151351897 17:73536762-73536784 ACTGGGGGCCTCTCTGAAGTTGG + Intronic
1151525704 17:74665405-74665427 CCTGGGGGTCAGTCTTAGGTGGG + Intergenic
1157289622 18:46400263-46400285 CCTGGGGGACTCTCTTTACTTGG + Intronic
1158462131 18:57655711-57655733 CCTGGGGCTCACCCTGTGGATGG - Intronic
1160557688 18:79736563-79736585 CCCGGAGGTGACTCTGCAGTTGG + Intronic
1160914080 19:1488411-1488433 CCTGGGGCTCTGTCTGCAGTCGG + Intronic
1161335879 19:3713042-3713064 CATGGGGGGCACTTTGAAGTAGG - Intronic
1161335885 19:3713068-3713090 CATGGGGGGCACTTTGAAGTAGG - Intronic
1162474004 19:10888992-10889014 CCTGGGGGGCACTCAGTAGGGGG - Intronic
1162655006 19:12121984-12122006 CATTGGGGTCAATATGTAGTAGG + Intronic
1162777219 19:12987192-12987214 CCTGGCTGTCACTCTGTGGGTGG + Intergenic
1163166153 19:15499590-15499612 CCTAGTGGTCACTCTGCAGGAGG - Intergenic
1163416942 19:17192648-17192670 CCTAGGTCTCACTCTGGAGTGGG + Intronic
1164292875 19:23883159-23883181 CCTGCGGGTCACTCTTTGATTGG - Intergenic
1164448873 19:28342094-28342116 CATGGGGGTCTTTCTGTTGTTGG - Intergenic
1164573648 19:29392487-29392509 CCTGGGGCTCACTCTGCTGTGGG + Intergenic
1167440351 19:49504963-49504985 CCTGGGTCTAACACTGTAGTAGG + Intergenic
1167713907 19:51128554-51128576 CCTGGGGGTCATCCTGTGGGAGG - Intronic
925044118 2:758381-758403 CCTGGGGATCACTCCACAGTAGG - Intergenic
925838361 2:7966969-7966991 CCAGGAGGTCACTATATAGTGGG - Intergenic
930202659 2:48559903-48559925 CCTGGGTGACTCTCTGTAGATGG + Intronic
931627144 2:64267070-64267092 TCTGAGGCTCACTCTGTAGAGGG + Intergenic
937040663 2:118818208-118818230 GATGGGGGTCTCTCTGGAGTTGG - Intergenic
937043389 2:118837632-118837654 CCTGGGTGCCACTCTGGAGATGG - Intergenic
937259269 2:120575073-120575095 CCTTGGGGTCACATTGTAGTGGG - Intergenic
938141146 2:128795492-128795514 CCTGGGCATCACTCTGCCGTTGG + Intergenic
938197660 2:129343936-129343958 ACTGGGGGGGACTCTGTTGTTGG - Intergenic
938695652 2:133833151-133833173 CATGGCAGGCACTCTGTAGTTGG - Intergenic
939128685 2:138207271-138207293 CCTGGAGTTTACACTGTAGTGGG - Intergenic
942093798 2:172519080-172519102 CCTGGGGGTCACTCTTTGACTGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1173927712 20:46793042-46793064 CCTCTGGGTGACTCTGTAGCTGG + Intergenic
1176140045 20:63541035-63541057 CCTGGGGGTCCCTATGGAGGAGG + Intronic
1176458202 21:6931137-6931159 CCTGGGGGTAGGTCTGTAGACGG - Intergenic
1176836376 21:13796232-13796254 CCTGGGGGTAGGTCTGTAGACGG - Intergenic
1179938920 21:44625833-44625855 CCTGGGGGTGTCTCTAAAGTGGG - Intronic
1180084445 21:45501671-45501693 CCTGGGGGTCCTTCTGCAGAGGG - Intronic
1180084459 21:45501714-45501736 CCTGGGGGTCCTTCTGCAGAGGG - Intronic
1180084473 21:45501757-45501779 CCTGGGGGTCCTTCTGCAGAGGG - Intronic
1180084499 21:45501843-45501865 CCTGGGGGTCCTTCTGCAGAGGG - Intronic
1180084512 21:45501886-45501908 CCTGGGGGTCCTTCTGCAGAGGG - Intronic
1180258747 21:46651600-46651622 CCTGGGGGGGAGTCTGAAGTCGG - Intronic
1180999407 22:19981131-19981153 CAAGTGGGGCACTCTGTAGTTGG + Intronic
1183240121 22:36651648-36651670 CTTGGGGCTCACTTTCTAGTGGG - Intronic
1183262802 22:36806729-36806751 TCTGGGGCTCACTCTGTACCAGG + Intronic
1183436406 22:37798076-37798098 CGTGGGGCTCAGTCTCTAGTGGG + Intergenic
1184068054 22:42131249-42131271 GCTGAAGGTCACTCTGGAGTGGG - Intergenic
1184070789 22:42144922-42144944 GCTGAAGGTCACTCTGGAGTGGG - Intergenic
1184650667 22:45918205-45918227 GCTGGGGCTCACTCTGCAGGGGG + Intergenic
953480359 3:43246330-43246352 CCTGGGGGTCATTCTCCACTGGG - Intergenic
953816583 3:46163174-46163196 CCTAGTGGTCACTCTGTCCTAGG + Intergenic
954481702 3:50806017-50806039 CCTGGGGGTGCTTCTGTAGAGGG + Intronic
960116924 3:113904496-113904518 CCTGGGCATCAGTCTGTAGGGGG + Intronic
962159863 3:132987782-132987804 CCTGGGGGAAGCACTGTAGTTGG + Intergenic
963100945 3:141603222-141603244 CCTTGGGGCCAATATGTAGTTGG + Intronic
964461518 3:156936209-156936231 CCTGGTGGTCAGTCTGTAAAAGG - Intronic
965095114 3:164216253-164216275 CCTGGGGGTCACTCCTTGATTGG - Intergenic
966881728 3:184354547-184354569 CCTGGGGGCTACGCTGTGGTCGG - Exonic
968792188 4:2673351-2673373 TCTAGGGGTCACTGTGAAGTGGG + Intronic
969624974 4:8297753-8297775 CCGGGGGATCACTCTCTAGGTGG - Intronic
975078362 4:70242471-70242493 CCTTTGGGTCAGTCTGTGGTGGG - Intergenic
977927651 4:102719182-102719204 CCTGGGGGTAGGTCTGTAGACGG - Intronic
978525614 4:109662041-109662063 CTTTGCGGTCACTGTGTAGTAGG - Intronic
981141793 4:141277801-141277823 ACTGGGGGTCACCCTGGAGCAGG + Intergenic
982235579 4:153248858-153248880 CCTGGAGGTGACACTGAAGTAGG - Intronic
982793285 4:159616878-159616900 CATGGAGTTCACACTGTAGTGGG - Intergenic
985336692 4:188904885-188904907 ACTGGGGGACACTCTGGACTGGG + Intergenic
985336697 4:188904902-188904924 ACTGGGGGACACTCTGGACTGGG + Intergenic
985336737 4:188905038-188905060 GCTGGGGGACACTCTGGACTGGG + Intergenic
985336759 4:188905106-188905128 ACTGGGGGACACTCTGGACTGGG + Intergenic
985336778 4:188905174-188905196 ACTGGGGGACACTCTGGACTGGG + Intergenic
985336828 4:188905327-188905349 ACTGGGGGACACTCTGGACTGGG + Intergenic
991634096 5:68685893-68685915 CCTGGGAGTCACTCTTTACTTGG + Intergenic
992106023 5:73449158-73449180 CCTGGGGGACGCTCTGGGGTCGG + Intergenic
996216500 5:120873235-120873257 CCTGTGAGTCACTCTGTAAGAGG - Intergenic
997937013 5:138121351-138121373 CCAGGAGGTCAGGCTGTAGTGGG + Intronic
999318519 5:150599463-150599485 CCTGGGGCTCACTCAGTACTTGG - Intergenic
1000624462 5:163523625-163523647 CCTGGGGGTGACGCTGTATAAGG - Intergenic
1001238624 5:170050747-170050769 ACTGGGAGTCACTCTGTACCAGG - Intronic
1001329052 5:170749420-170749442 CCTGGGGAGCTCTCTGGAGTAGG - Intergenic
1001442026 5:171750549-171750571 CCTGGGAGTCACTCTGCTTTGGG + Intergenic
1001705399 5:173737750-173737772 CCTGTGGCCCACTCTGTACTAGG - Intergenic
1002436671 5:179235812-179235834 CCTGGGGGTCTCCCTGCACTGGG + Intronic
1005481563 6:26259820-26259842 CCTGTGGGTCACTCTTTGATTGG + Intergenic
1006896352 6:37473595-37473617 CCTGGGGGTAAGTCTGCAGCTGG + Exonic
1007253903 6:40515405-40515427 CTTGAGGGTCACTCTGTTGGGGG + Intronic
1007776980 6:44229322-44229344 CCTGGGGCTCATTGTGGAGTGGG + Intronic
1010626354 6:78140039-78140061 CCTGGGGGTCACTCCTTGATTGG + Intergenic
1011117552 6:83910368-83910390 GCTGGGAGTCATTCTGAAGTGGG + Intronic
1013290271 6:108713335-108713357 CCTGCAGGTCACTCAGGAGTGGG + Intergenic
1013348458 6:109284868-109284890 CCTGTGGGTCACTCAAGAGTAGG - Intergenic
1013350289 6:109299511-109299533 CCTGTGGGTCACTCAGTGCTGGG - Intergenic
1017631234 6:156397786-156397808 CCTGGGGATCACAATGTAGGTGG + Intergenic
1018422635 6:163652693-163652715 CCTGGGGTTCACTTTGTAGTAGG - Intergenic
1018624153 6:165761088-165761110 CCTGGGGTTCAATCTGAGGTGGG + Intronic
1018866226 6:167748620-167748642 CCTGGGGTTCCCTCTGGAATGGG + Intergenic
1019894477 7:3972921-3972943 CCTGGGGGCCACCCTGGAGACGG + Intronic
1023242589 7:38163502-38163524 CCTGGGGGTCACTCTTTAATTGG + Intergenic
1029125692 7:98293861-98293883 CATGGGGGTCACTCTGGGGTGGG + Intronic
1030246694 7:107390687-107390709 CCTGGGGGTCACTCTTTGACTGG + Intronic
1032382896 7:131502956-131502978 CCTGGGGGACAGACTGTTGTGGG - Intronic
1033032149 7:137837604-137837626 CCTGGGGGTCTCTTTCTAGAGGG - Intronic
1036196421 8:6720150-6720172 CCTGGTGGACACTATCTAGTGGG - Intronic
1036550555 8:9811716-9811738 CCTGGGGGTCACTCCTTGATTGG + Intergenic
1038786583 8:30622700-30622722 CCTGGGGGTAGGTCTGTAGACGG - Intronic
1049000380 8:139822275-139822297 CCTGGGAGCCACTTTGGAGTGGG - Intronic
1049407372 8:142457712-142457734 TCTGGGGGTCACCCTGTCGGGGG + Intronic
1052862538 9:33445838-33445860 CCTGGGGATCCCTTTGTAGTGGG - Intronic
1053046736 9:34926510-34926532 CCTGGGGGTGTTTCTGCAGTGGG + Intergenic
1191634187 X:63358653-63358675 CCTGGGGGTCACTCCTTGATTGG - Intergenic
1193351703 X:80471571-80471593 CCTGGGGGTCACTCTTTGATTGG + Intergenic
1197973450 X:132139307-132139329 CCTTGGGGGTACTCAGTAGTGGG + Intergenic
1198267308 X:135021894-135021916 CCTGGGCCTCACTCTGGAGCGGG - Exonic
1199618241 X:149676231-149676253 CCTGGGGGTCACTCCTTGATTGG - Intergenic
1199624401 X:149727018-149727040 CCTGGGGGTCACTCCTTGATTGG + Intergenic