ID: 1108462609

View in Genome Browser
Species Human (GRCh38)
Location 13:50682169-50682191
Sequence ACTAACTACCCCCATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108462609_1108462616 25 Left 1108462609 13:50682169-50682191 CCCACACCATGGGGGTAGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1108462616 13:50682217-50682239 AAAGAGACCCTAGGGTATAGTGG 0: 1
1: 0
2: 0
3: 12
4: 124
1108462609_1108462615 17 Left 1108462609 13:50682169-50682191 CCCACACCATGGGGGTAGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1108462615 13:50682209-50682231 GCTATAACAAAGAGACCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1108462609_1108462614 16 Left 1108462609 13:50682169-50682191 CCCACACCATGGGGGTAGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1108462614 13:50682208-50682230 TGCTATAACAAAGAGACCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108462609 Original CRISPR ACTAACTACCCCCATGGTGT GGG (reversed) Intronic
904751703 1:32744672-32744694 ACTAGCAAGCCCCATGATGTAGG + Intronic
907606003 1:55818137-55818159 ATTACCTATCCCCATTGTGTGGG + Intergenic
912889719 1:113516659-113516681 ACTACCTGCCCCCAAGGTGTGGG + Intronic
915192358 1:154162387-154162409 ACAAACCAACCCCATGGAGTTGG + Intronic
916717891 1:167460560-167460582 ACTAACTACTCCCACGGCCTCGG + Intronic
1068123411 10:52808024-52808046 GCTAACTACCCACAAGGTGCAGG - Intergenic
1072197996 10:93133170-93133192 TCTAACAACCCCCATGAAGTAGG - Intergenic
1079925921 11:26490933-26490955 ATTAAGAACCACCATGGTGTAGG - Intronic
1083719375 11:64596769-64596791 ACTCTCTACCCTCTTGGTGTTGG - Intronic
1086139666 11:83482406-83482428 AATAACTAACCCCATTGTGTAGG - Intronic
1086464220 11:87037376-87037398 ACTAACTACCCCCAAGTGCTGGG - Intergenic
1089938136 11:122386739-122386761 ACTAAGTAACCTCATGCTGTGGG + Intergenic
1108462609 13:50682169-50682191 ACTAACTACCCCCATGGTGTGGG - Intronic
1118349044 14:64960502-64960524 ACTAATTACCTGCATGGTGTTGG + Intronic
1127372707 15:58355861-58355883 ACTAACAACCCCCAAGTTTTGGG - Intronic
1131014076 15:89043116-89043138 CCTAGCTACTCCCATGGTTTTGG - Intergenic
1135150477 16:20000965-20000987 TCTAACTACCAGCATGGTGGGGG - Intergenic
1145019869 17:19421287-19421309 CCTAACTAACCCCAAGGTGATGG - Intergenic
1153937401 18:9941304-9941326 ACTAACAACCCAGATGGAGTTGG - Intronic
1156514310 18:37667170-37667192 TCTAACCACAGCCATGGTGTGGG + Intergenic
1162191638 19:8951594-8951616 ACTCGTTTCCCCCATGGTGTAGG + Exonic
1164912906 19:32026898-32026920 ACTATCTACCCCCTTGGCCTCGG + Intergenic
925023744 2:591858-591880 ACTAATTACAGCCATGCTGTAGG - Intergenic
928618792 2:33068394-33068416 ACAAATTACCCCTCTGGTGTGGG - Intronic
937264920 2:120609366-120609388 ACTCACACCCCTCATGGTGTGGG + Intergenic
937669188 2:124520655-124520677 ACTAAGCACCCCCATGATATAGG - Intronic
940232420 2:151470950-151470972 ACTAACTGCACCCATAGGGTAGG - Intronic
1169538070 20:6567966-6567988 ACTTACTTCCCCCATTTTGTGGG - Intergenic
1170200457 20:13738034-13738056 ACTCTCCACCCCAATGGTGTAGG + Intronic
1174104796 20:48154579-48154601 ACTCCCTGCTCCCATGGTGTGGG + Intergenic
1182151571 22:28030807-28030829 ACTAAATACCTACATTGTGTTGG + Intronic
952117036 3:30195218-30195240 ACTAACTACTCCCATGCTTTGGG + Intergenic
952187969 3:30991405-30991427 ATCAACTACCCTCATGGTTTTGG + Intergenic
952953790 3:38544152-38544174 CCTAACTACCACCTTGGTCTGGG - Intergenic
960972783 3:123151383-123151405 ACTAACTTGCCCCATGGCCTTGG - Intronic
961924849 3:130467679-130467701 AATAACTTCACCCATGGTGGTGG + Intronic
964588302 3:158332224-158332246 ACTAACAACACCCATAGTTTTGG + Intronic
969208677 4:5669515-5669537 ACTAACTTCTACCATGGTGTGGG - Intronic
975762560 4:77633485-77633507 AGTATCAACCCACATGGTGTTGG + Intergenic
975807854 4:78131948-78131970 ACAAACTATCCCCATGGAGATGG - Intronic
982422387 4:155212266-155212288 AGGTACTACCACCATGGTGTTGG + Intronic
988915109 5:35884192-35884214 ACTTGCTACCCCCATTGTCTGGG + Intergenic
990297354 5:54416259-54416281 ACTACCTACCCCCAGGGGGTTGG - Intergenic
993800985 5:92336694-92336716 AGTAACTACTCCCTTGTTGTGGG + Intergenic
995038102 5:107557970-107557992 AGTATCTACCCCCACGGTATAGG + Intronic
1005367189 6:25090385-25090407 ACTATCTGCCCCCATTTTGTGGG - Intergenic
1006857777 6:37147589-37147611 AGTAACTACACACATGGTGGTGG + Intergenic
1008346771 6:50437368-50437390 TCTAACTATACCCATGTTGTTGG + Intergenic
1015434445 6:133169441-133169463 ACTTACTTCCCCCAGTGTGTGGG - Intergenic
1018608000 6:165618636-165618658 ACCAACTACCCCCTTGTTGGAGG - Intronic
1026683495 7:72488556-72488578 ACTTACTAACCCCAAAGTGTAGG + Intergenic
1029409644 7:100400667-100400689 ACTAGCTACCTCCATGGCCTGGG - Intergenic
1031126310 7:117777169-117777191 TCTAACTAGCAGCATGGTGTTGG + Intronic
1031904682 7:127447358-127447380 ACTGGATTCCCCCATGGTGTTGG + Intergenic
1038317218 8:26496792-26496814 ACTACCTGCCCTCATGCTGTGGG + Intronic
1050238292 9:3606473-3606495 AATATCTACCCCCACAGTGTAGG + Intergenic
1053332659 9:37229217-37229239 ATTAACTACTCCCCTGTTGTTGG - Intronic
1058809103 9:108621767-108621789 TCTAACTACCTCCATGTTATAGG - Intergenic
1060300172 9:122370483-122370505 ACTTACTTCCCCCATGGGCTGGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1190939711 X:55028431-55028453 ACTACATACCCCAATGTTGTTGG - Intronic
1195370853 X:104170806-104170828 CCTAGCTACCCCAATTGTGTTGG - Intronic
1197942000 X:131800378-131800400 ATCAACTAACCCCATGGGGTGGG - Intergenic