ID: 1108463031

View in Genome Browser
Species Human (GRCh38)
Location 13:50686417-50686439
Sequence CAGCTTGAACACCTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108463031 Original CRISPR CAGCTTGAACACCTTGAGGT TGG Intronic
905612861 1:39370169-39370191 CAGATTGAACACCTGAAGGTAGG + Exonic
909747415 1:79114885-79114907 CAGCATTTAGACCTTGAGGTAGG + Intergenic
910488957 1:87746697-87746719 AAGCTTAAACACCTTGTGGGAGG - Intergenic
911578807 1:99611454-99611476 CAGATTGCATACCTTGAAGTTGG - Intergenic
912379271 1:109238368-109238390 CTGCTTGAAATCATTGAGGTAGG + Intergenic
916600324 1:166286996-166287018 CAGCAAAAACACCTTCAGGTAGG - Intergenic
917370010 1:174282687-174282709 CATCTTCACAACCTTGAGGTAGG - Intronic
918231565 1:182538029-182538051 CCACTTTACCACCTTGAGGTAGG - Intronic
919586664 1:199448091-199448113 CAGTTTGAACTCCTTGGGGAGGG - Intergenic
921185163 1:212664312-212664334 CAGCTTGAGAAACTTGAGGTGGG + Intergenic
922609129 1:226911421-226911443 CAGCTTGAACATAGTGAGGGTGG + Intronic
1064303888 10:14147975-14147997 ATCCTAGAACACCTTGAGGTAGG - Intronic
1064794988 10:19001493-19001515 CAGATTGAACCCCTTGAGCCAGG + Intergenic
1067077486 10:43196471-43196493 CAGCTGGAAGACCCTCAGGTAGG - Exonic
1068129206 10:52876389-52876411 CAGCATGAATACCAGGAGGTAGG + Intergenic
1068194615 10:53699476-53699498 CAGCATGAACACCAAGGGGTAGG + Intergenic
1070465334 10:76717024-76717046 CATCTTGAAAAGCTTGTGGTGGG + Intergenic
1071428010 10:85579177-85579199 GAGCTTGAACATGTTGAGGAGGG - Intergenic
1072581119 10:96740996-96741018 GAGCTTGAACAATTTGAGGGAGG - Intergenic
1073289308 10:102405470-102405492 CCGCTTGATGACCTTGGGGTTGG + Exonic
1073897747 10:108182978-108183000 TATCCTGAATACCTTGAGGTGGG - Intergenic
1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG + Exonic
1076133494 10:128029272-128029294 CAGCTTGGAAACCTGTAGGTGGG - Intronic
1078162925 11:8857492-8857514 CATCTTGAAGACTTTGAGTTTGG - Intronic
1079306050 11:19323642-19323664 CAGTTTGAACACTTTGACCTTGG - Intergenic
1081256311 11:40900244-40900266 CAGTTGGAGCACCTTCAGGTGGG + Intronic
1087499686 11:98933944-98933966 CAGCTTGAATACCTGGAAGCAGG + Intergenic
1088685873 11:112284293-112284315 CAGGTGGATCACCTTGGGGTCGG - Intergenic
1088844453 11:113652978-113653000 TAGCTTGAGCACCTGGAGATTGG - Intergenic
1089522925 11:119077630-119077652 CAGCTAGAAGACATTAAGGTAGG + Exonic
1090271528 11:125389450-125389472 CAGCTTGACCACCATGAGGGTGG - Intronic
1090660966 11:128881164-128881186 CAGCTTGATCAGCTGGAGGCAGG + Intergenic
1091556133 12:1574717-1574739 CTGCTTGAACAGCTGGATGTGGG + Intronic
1092928959 12:13297227-13297249 AAGGTTGAAGACCTTGAGATGGG - Intergenic
1093787272 12:23207212-23207234 CAGCATGAAAAGCTTCAGGTGGG - Intergenic
1097538861 12:60910161-60910183 CAGCTTGAATATCTTGAAGGTGG + Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1098585234 12:72146586-72146608 CAGCTCAAACCCCTTGAGGAAGG + Intronic
1099277852 12:80600968-80600990 CAGCGTGAAGACCCTGAGGCAGG - Intronic
1100320546 12:93487572-93487594 AAAGTTGAACACCTTGAGGAAGG + Exonic
1101532300 12:105584702-105584724 TAGCTTGAACACCTGGTGGGAGG + Intergenic
1102059253 12:109920430-109920452 CAGCTTGAGCACCCTCACGTGGG - Intronic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1109176320 13:59161334-59161356 CATCTTGAGAACCTGGAGGTGGG - Intergenic
1112331074 13:98477442-98477464 CGGGTGGATCACCTTGAGGTCGG + Intronic
1116046931 14:39754933-39754955 CAAGTTGACCACCTTCAGGTTGG - Intergenic
1117740956 14:58818823-58818845 CTGCTTTAACTTCTTGAGGTTGG + Intergenic
1120095655 14:80384743-80384765 CAGTTTGAAGAACTGGAGGTAGG + Intronic
1121497404 14:94403423-94403445 CATGTTGAAGACCTTGAGGAGGG + Intergenic
1130689069 15:86064624-86064646 AAGCATGAACACCAGGAGGTGGG + Intergenic
1132887507 16:2189146-2189168 CAGCTGGACCACCTTGAAGGAGG + Exonic
1133230037 16:4362078-4362100 GAGGTTGAGCCCCTTGAGGTTGG + Exonic
1135946063 16:26865990-26866012 CAGCTTTATCTCCTAGAGGTGGG + Intergenic
1139672793 16:68503127-68503149 CAGCTTGATGACCTAGAGCTGGG + Intergenic
1139763795 16:69209842-69209864 TAGTTTAAACATCTTGAGGTGGG - Intronic
1140709096 16:77659728-77659750 CAGTTTCAAAACCTTGAGGAGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1143542428 17:7577558-7577580 CAGCTTCCACTCCTGGAGGTTGG - Exonic
1144662659 17:17081395-17081417 CAGCTTGAAAACCTTAAGACAGG + Intronic
1145784127 17:27583000-27583022 CAGCTGGAAGACCTTGCGGCTGG - Exonic
1146941410 17:36846559-36846581 CAGCTTGAACACCCAGGGGCGGG - Intergenic
1151858067 17:76737098-76737120 CAGGTTGTCCACCTTGAGGGAGG + Exonic
1154035482 18:10797793-10797815 CAGCATGAACACCAGGAGGTGGG - Intronic
1155489551 18:26386487-26386509 CAGCATGAACACATTCATGTAGG + Intronic
1157848712 18:51028250-51028272 AAGCTTGAACACCAGGAGGTGGG - Intronic
1158296409 18:56001892-56001914 CAGCTTTAGCACCGTGTGGTCGG - Intergenic
1162745264 19:12794128-12794150 CAGCTGGGACACGTGGAGGTGGG + Intronic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1166863829 19:45824443-45824465 CAGCTGGACCACCTTGAGAATGG + Intronic
925405636 2:3604028-3604050 CAGATCGAACTCCTTGGGGTGGG + Intronic
926134836 2:10329305-10329327 AAGATTGAGGACCTTGAGGTGGG + Intronic
929594870 2:43169731-43169753 CAGATGGACCACCTTGAGGAGGG - Intergenic
930110134 2:47671891-47671913 CAGCTTTAAAAAATTGAGGTTGG - Intergenic
931444521 2:62315658-62315680 CAGCTTGGATACCATGAGGGGGG + Intergenic
933076890 2:77940105-77940127 CAGCATGAATACCTGGAGGCAGG + Intergenic
933257833 2:80100670-80100692 CACCTGGAATACCTTGAGCTGGG - Intronic
937426169 2:121800973-121800995 CAGCTTGAACACCCTGAGCGGGG - Intergenic
940861902 2:158779386-158779408 GAATTTGAACATCTTGAGGTGGG - Intergenic
940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG + Intronic
942488821 2:176469088-176469110 CAACTTGAAAATCTTGAGTTTGG + Intergenic
943845045 2:192634830-192634852 CAAGTTGTACTCCTTGAGGTTGG - Intergenic
945605098 2:211919233-211919255 GAGCTTGGAAACCTTGAGGAAGG - Intronic
947247851 2:228069934-228069956 CAGCTGGGACACAGTGAGGTGGG - Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1170029840 20:11933193-11933215 CAGGTTGAACACTGTGAGTTGGG - Intergenic
1174701357 20:52612384-52612406 CAGCATGAATACCAGGAGGTGGG - Intergenic
1175255562 20:57644655-57644677 TAGCATGAACACCTAGAGTTTGG + Intergenic
1175811644 20:61861619-61861641 CAGCTTGAACAAGTGGAGGCTGG + Intronic
1183771994 22:39934651-39934673 CAGCTTGACCATCTTCATGTTGG + Intronic
1185271779 22:49933130-49933152 CAGGTGGATCACTTTGAGGTCGG - Intergenic
1185418424 22:50721973-50721995 CAGCATGTCCACCTTGAGCTCGG + Intergenic
950250641 3:11462500-11462522 CAGCGTGAACACTTTAGGGTTGG + Intronic
952172164 3:30819066-30819088 CTGCTTGAACATATTGACGTGGG + Intronic
952531878 3:34271277-34271299 CAGCTTTGACTCTTTGAGGTTGG - Intergenic
953690098 3:45110606-45110628 CAGCTTGAACACCTCGGGGTTGG + Exonic
961637345 3:128341840-128341862 CAGCTTGTACACCTTCAGCCTGG - Exonic
961804362 3:129478286-129478308 CAGTTTTAAAACCATGAGGTGGG - Intronic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
966539668 3:181075321-181075343 CAGCTTGAGCTCCTTGGGGGAGG - Intergenic
967169763 3:186813873-186813895 AAGTGTGAACACCTGGAGGTAGG + Intergenic
968247872 3:197172717-197172739 CATCTTGAACACCTTCTGATTGG - Intronic
968716048 4:2160827-2160849 CATCTTTAAGGCCTTGAGGTAGG - Intronic
968861791 4:3177356-3177378 CAGTTTGAATACATTGAAGTGGG + Exonic
969618550 4:8267546-8267568 CATCTTGACCACCTTGCAGTGGG - Intergenic
971863628 4:32140744-32140766 TAGCTTGAACAGCTTAAGGGCGG - Intergenic
972402167 4:38715601-38715623 CAGCTTAAACACATTAAAGTTGG + Intergenic
977359731 4:95986730-95986752 CATCTCCAACACCTTGGGGTGGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
980632717 4:135456804-135456826 CACTGTGAACACCTTCAGGTGGG - Intergenic
981655721 4:147110587-147110609 CAGCTTGCACACTCTGTGGTTGG - Intergenic
983470075 4:168144809-168144831 CAACTAGGACACCCTGAGGTTGG + Intronic
985428909 4:189858632-189858654 CAGCTTTCACACCTTGTGGAGGG + Intergenic
986579944 5:9255448-9255470 CGGCTTGATCACCATGAAGTGGG + Intronic
990139058 5:52682325-52682347 GGGCTTGAACCCCTAGAGGTAGG - Intergenic
992134942 5:73734936-73734958 CAGCTTGGAGAACTTGAGGAGGG + Intronic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
994208537 5:97062346-97062368 CAGCTGGAACCCATTAAGGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997516477 5:134493381-134493403 CAGTTAGAAATCCTTGAGGTAGG - Intergenic
997785886 5:136713201-136713223 CCGCCTGAATACCTTGAGCTGGG + Intergenic
999240386 5:150124272-150124294 CAGGTTGACCACGTTCAGGTGGG + Exonic
1000062156 5:157667434-157667456 CAGTTTAAAAACCTTGAGGCTGG + Intronic
1000127936 5:158265620-158265642 CAGCATTATCACCTGGAGGTGGG - Intergenic
1000494186 5:161957731-161957753 CAGCTTTAACACATTGGTGTGGG + Intergenic
1001854011 5:174995096-174995118 CTGCTTGAGCATCTTGGGGTGGG + Intergenic
1002044313 5:176533438-176533460 CAGCTTTAACACTTTACGGTGGG - Intronic
1003569459 6:7246715-7246737 CAGCTTGAAGTCCATGAGCTTGG - Exonic
1007358602 6:41339683-41339705 AAGGTTGAAGACCTTGAGTTGGG - Intronic
1013071040 6:106729672-106729694 CAGCTTAAACAATTTGAGGTCGG - Intergenic
1013276766 6:108593009-108593031 CAGTTTGAACATCTAGATGTTGG + Intronic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019087553 6:169494312-169494334 CTGCTTGACTACCTTGAGCTAGG + Intronic
1022184389 7:27953114-27953136 CAGCTGGAAAAACTTGAGTTTGG - Intronic
1023890583 7:44389225-44389247 CATCTTTCACCCCTTGAGGTTGG + Intronic
1026326380 7:69314292-69314314 CATCTGGTACACCTTGAGGCAGG + Intergenic
1027201819 7:76068692-76068714 CAGCTGGATAACCTTGAGGGTGG + Intergenic
1029139206 7:98398281-98398303 CAGCTTGAACATCATGGGGCAGG + Intronic
1034918677 7:155061168-155061190 CAGCAAGGACACCATGAGGTGGG - Intergenic
1036544595 8:9754920-9754942 CAGCTTTCACACCTTCAGTTAGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1044680136 8:94769287-94769309 CGGGTGGATCACCTTGAGGTCGG - Intronic
1046798218 8:118395558-118395580 TGGCTTGAACTCTTTGAGGTTGG - Intronic
1047861621 8:128973243-128973265 CACCTTGAGCACCTTGATGGTGG + Intergenic
1048922591 8:139244834-139244856 CAGCTAGATGACCTTTAGGTGGG - Intergenic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1050474796 9:6029611-6029633 CAGCTTGTTCACTTTGAAGTAGG - Intergenic
1050981351 9:12019796-12019818 CAGCTTCAACATGTTGAGTTTGG - Intergenic
1053034601 9:34813835-34813857 AAGCATGAACACCAGGAGGTGGG + Intergenic
1053355426 9:37441599-37441621 CAGTGTGAAAACCCTGAGGTTGG - Exonic
1059037793 9:110776891-110776913 CAGACTAAAAACCTTGAGGTGGG - Intronic
1059951157 9:119463645-119463667 CAGCTGAAACCCCTTGAGGATGG - Intergenic
1061346572 9:130031034-130031056 CCCCTTGAACATCTTGAAGTGGG + Intronic
1185825631 X:3246512-3246534 CACTTTGATCACCTTAAGGTAGG - Intergenic
1186516181 X:10167455-10167477 GAGCATGAACACCTGGAGGTAGG - Intronic
1188399621 X:29728879-29728901 CAGCTGGAATACCTTGAGGCTGG + Intronic
1189214083 X:39308543-39308565 CAGCTTCATCACCCTCAGGTGGG - Intergenic
1190797500 X:53759036-53759058 CACATTGAAGATCTTGAGGTGGG - Intergenic
1191972291 X:66829971-66829993 CAGCTTGAATAGCTTGTGTTGGG + Intergenic
1191972330 X:66830646-66830668 CAGCTTGAATAGCTTGTGTTGGG + Intergenic
1197192381 X:123662235-123662257 CAGCTTTAAAACCTTGGGCTGGG + Intronic
1200176754 X:154122386-154122408 CTACTTGAACTCCTTGAGGCTGG + Intergenic