ID: 1108467464

View in Genome Browser
Species Human (GRCh38)
Location 13:50731091-50731113
Sequence CACAGGAGGTGACCAATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 9, 3: 62, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108467464_1108467470 12 Left 1108467464 13:50731091-50731113 CCTCTGATTGGTCACCTCCTGTG 0: 1
1: 1
2: 9
3: 62
4: 248
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47
1108467464_1108467468 -6 Left 1108467464 13:50731091-50731113 CCTCTGATTGGTCACCTCCTGTG 0: 1
1: 1
2: 9
3: 62
4: 248
Right 1108467468 13:50731108-50731130 CCTGTGACCAGAGTGGTCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108467464 Original CRISPR CACAGGAGGTGACCAATCAG AGG (reversed) Intronic
900468754 1:2840220-2840242 TGCTGGAGGTGACCAATCAGAGG + Intergenic
902639735 1:17759428-17759450 CACAGGAGGTGTCTCACCAGAGG - Intronic
903868517 1:26415406-26415428 GACATGAGGTGAGTAATCAGAGG - Intronic
904378155 1:30094668-30094690 CACAGCAGGTGTACCATCAGCGG + Intergenic
904734308 1:32618878-32618900 TGTAGGAGGTGACCAATCAGAGG - Intronic
904932949 1:34104897-34104919 CACTGCAGGTGACAAATTAGTGG - Intronic
906638204 1:47424549-47424571 CACACGAGGTGGCCAATAGGTGG - Intergenic
906694168 1:47812996-47813018 CACGGGAGGCGATCAGTCAGCGG + Intronic
906734493 1:48111885-48111907 CACAGAAGGAGAAAAATCAGGGG + Intergenic
907181210 1:52571897-52571919 TGCAGAAGGTGACCAATCAGAGG - Intergenic
907531929 1:55107953-55107975 CAGAGGAGGCAACCAATAAGTGG - Intronic
909706793 1:78594871-78594893 TGCAGAAGGTGACCAATCAGAGG - Intergenic
909728637 1:78867239-78867261 CACAGGAAGAGAACAACCAGGGG - Intergenic
909948755 1:81693777-81693799 CCCAGCAGGAGACAAATCAGTGG + Intronic
910734956 1:90443483-90443505 TGTAGAAGGTGACCAATCAGAGG + Intergenic
911809933 1:102263109-102263131 TGCAGGAGAGGACCAATCAGAGG - Intergenic
911987830 1:104652596-104652618 CAGAGGAAGTGACCAATTTGAGG - Intergenic
912949581 1:114111604-114111626 CAGAGGAGGTGACCCAAGAGGGG - Intronic
916584184 1:166135833-166135855 CACAGAATGTGACTATTCAGAGG - Intronic
919866414 1:201786443-201786465 CCCAGGAGGAGACCAAGGAGAGG + Exonic
920899234 1:210090011-210090033 TGGAGGAGGCGACCAATCAGAGG + Intronic
921410127 1:214826852-214826874 CATGGGAGGTGACCAATCAGAGG + Intergenic
923680494 1:236114617-236114639 CTCAGGAGGTGCTCAGTCAGTGG - Intergenic
1063080231 10:2760906-2760928 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1063974991 10:11407947-11407969 CACAGCAGGTGTCCAAGCACGGG + Intergenic
1068392300 10:56414154-56414176 CACAGGAGGTAGCCAGGCAGTGG - Intergenic
1071870172 10:89785392-89785414 TGCAGAAGGGGACCAATCAGAGG + Intergenic
1072523155 10:96247707-96247729 TACAGGAGGGGATCAATCAGAGG - Intronic
1072578203 10:96719307-96719329 TACAGGAGGTGAGCAAACACTGG - Intronic
1072694813 10:97595224-97595246 CACAGTAGGTGTACAATGAGAGG + Intronic
1073877006 10:107936506-107936528 TGCAGAAGGTGACCAATCAGAGG - Intergenic
1074433077 10:113409850-113409872 CACCAGAGGTGTCCAAGCAGAGG + Intergenic
1074695777 10:116049244-116049266 TGCAGGAGGGAACCAATCAGAGG - Intergenic
1075734447 10:124655286-124655308 CACAGCAGGAGGCCATTCAGAGG + Intronic
1075800228 10:125149186-125149208 CACAGGAAATGACCATTCATGGG + Intronic
1075825498 10:125354253-125354275 GACAAGAGCTGACAAATCAGAGG + Intergenic
1076249558 10:128974744-128974766 CACAGCAGGTCCCCTATCAGAGG + Intergenic
1079192246 11:18289262-18289284 CAGAGGAGGAGGCCATTCAGAGG + Intronic
1083411006 11:62492355-62492377 CACAGTAGATCTCCAATCAGAGG + Intronic
1083462555 11:62824165-62824187 AACAGGAGGAAACCATTCAGAGG - Exonic
1084395085 11:68904177-68904199 CTCGGGAGGTGGCCAAGCAGGGG - Intronic
1085333781 11:75674167-75674189 TACAGGAGGGAACCAATCAGAGG - Intergenic
1085399080 11:76224814-76224836 AACAGGAGGTGCCCAATAAATGG - Intergenic
1086249661 11:84798164-84798186 CACAGGTGGTAGCCAAGCAGTGG - Intronic
1086849658 11:91794365-91794387 TGCAGGAGGGGACCAATCAGAGG + Intergenic
1086929575 11:92678003-92678025 TGTGGGAGGTGACCAATCAGAGG + Intronic
1088068458 11:105751780-105751802 CACAGAAGGTGATTAATAAGAGG - Intronic
1088295280 11:108286569-108286591 TATAGGAGGGGACCAATCAGAGG + Intronic
1089083497 11:115797442-115797464 CCTAGGAGGTGACCACTGAGTGG + Intergenic
1090100935 11:123796249-123796271 CACAGGAGGGGACCAATCGCAGG + Intergenic
1090557906 11:127897150-127897172 TGCAGGAGGGGAACAATCAGAGG - Intergenic
1095240454 12:39852757-39852779 TTCAGGAGAGGACCAATCAGAGG - Intronic
1096434735 12:51579613-51579635 TGCAGAAGGTGAACAATCAGAGG + Intergenic
1097424047 12:59419725-59419747 TGCAGGAGGGTACCAATCAGAGG - Intergenic
1097479194 12:60099905-60099927 TGCAAGAGGAGACCAATCAGAGG + Intergenic
1098684470 12:73400966-73400988 CAGGGGAGGGGACCAATCAAAGG + Intergenic
1098826924 12:75308142-75308164 CATGGAAAGTGACCAATCAGAGG - Intronic
1101497810 12:105272346-105272368 CATGGGAGGTGACCAGTCAGAGG + Intronic
1104092067 12:125525790-125525812 CAAAGGATGTGGCCACTCAGTGG - Intronic
1104279411 12:127360766-127360788 CGCAGTAGGTGACCAATCAGAGG - Intergenic
1105420676 13:20248965-20248987 CCCAGGAGGTGTCTCATCAGAGG + Intergenic
1107031083 13:35854368-35854390 AACAGGAGGTGACCAATGAGGGG - Intronic
1107134456 13:36928568-36928590 CACATGAGATGACAAAACAGAGG - Intergenic
1107407666 13:40129619-40129641 TGCAGGAGAGGACCAATCAGAGG + Intergenic
1108356802 13:49635726-49635748 TGCAGAAAGTGACCAATCAGAGG + Intergenic
1108356814 13:49635817-49635839 TGCAGGAGGGGACCAATCAGAGG + Intergenic
1108467451 13:50731010-50731032 TGCAGGAGGGGACCAATCAGGGG - Intronic
1108467464 13:50731091-50731113 CACAGGAGGTGACCAATCAGAGG - Intronic
1108598123 13:51967499-51967521 CACAAGAGGTGCCCAACAAGAGG - Intronic
1108938280 13:55914410-55914432 AACAAGAGGTGACCAAGCTGGGG + Intergenic
1109850087 13:68051718-68051740 CATAGCAGGATACCAATCAGGGG + Intergenic
1110251258 13:73383237-73383259 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1110555662 13:76856516-76856538 TGCAGGAGGGGACCAATCAGAGG + Intergenic
1110964672 13:81677857-81677879 TGCAGGAGGGGACCAATCAGAGG - Intergenic
1110964681 13:81677926-81677948 CACAAGAGGTGACCAATGAGAGG - Intergenic
1113800186 13:113082451-113082473 GACAGGAGGTGAGCCATCAGTGG - Exonic
1115338828 14:32270678-32270700 TGCAGGAGGGGACCAATCAGAGG - Intergenic
1115338839 14:32270769-32270791 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1121339222 14:93094986-93095008 CACAGGTGGTGACCCTTGAGAGG - Intronic
1121410517 14:93745621-93745643 CACAGGATGTGGCCACTCAGAGG - Intronic
1121435521 14:93916723-93916745 GACAGGAGGTGACCGATCAGAGG + Intergenic
1121728818 14:96172314-96172336 CACAGGAGGTGCTCCATCTGGGG - Intergenic
1122739389 14:103862701-103862723 TATAGAAAGTGACCAATCAGAGG + Intergenic
1122828748 14:104385102-104385124 CACAGGAGGCGGCTAATGAGAGG + Intergenic
1124649441 15:31464204-31464226 CACAGCACGTGGCCAACCAGGGG + Intergenic
1127583215 15:60356248-60356270 CACGAGAGGTCACCAATCAACGG - Intronic
1127891794 15:63258766-63258788 TGCAGAAGGTGACCAATCAAAGG + Intronic
1129063070 15:72876487-72876509 TGCAGGAGGGGACCAATCAGAGG - Intergenic
1129502854 15:76057122-76057144 CACTGCAGGTGACTAATGAGAGG - Intronic
1129506612 15:76086862-76086884 TGCAGGAGGGGACCAATCAGAGG + Intronic
1129927213 15:79375276-79375298 GACAGAAGGAGACCAAGCAGAGG - Intronic
1130861099 15:87890507-87890529 CTCCAGAGGTGACCAATGAGAGG + Intronic
1132205435 15:99983273-99983295 CACAGTAGGTGCTCAATAAGTGG + Intronic
1133026006 16:2989265-2989287 CAGAGGAGGTGAGCAGTCTGGGG - Intergenic
1133099071 16:3468224-3468246 TGCAGGAGGGGACCAATCAGAGG + Intronic
1133177604 16:4027051-4027073 TGCAGGAGGCGACCAATCAGAGG - Intronic
1133442035 16:5829109-5829131 CTCAGGAGGAGACCACTCAAAGG + Intergenic
1134132851 16:11661365-11661387 CGCAGGTGGTGACCAAGCACCGG + Intergenic
1137609908 16:49811261-49811283 CATGGGAGGGGACCAAGCAGCGG + Intronic
1137802310 16:51272598-51272620 CACAAGAAGTGACCAATCAGAGG + Intergenic
1138807511 16:60108125-60108147 CGTGGGAGGCGACCAATCAGAGG + Intergenic
1138807524 16:60108206-60108228 TGCAGGAGGGGGCCAATCAGAGG + Intergenic
1140565535 16:76037044-76037066 TGCTGGAGGGGACCAATCAGAGG + Intergenic
1140565550 16:76037136-76037158 TGCAGGAGGGGACCAGTCAGAGG + Intergenic
1140642056 16:76986596-76986618 TGCACAAGGTGACCAATCAGAGG + Intergenic
1140750263 16:78017055-78017077 TACAGTAGGTGAACAATCAAAGG - Intergenic
1141890525 16:86923877-86923899 CTCTGGCGGAGACCAATCAGTGG - Intergenic
1142174009 16:88636705-88636727 CACAGGAGGTATGCAAGCAGAGG + Intergenic
1142557677 17:790717-790739 CAGTTGAGGTGGCCAATCAGCGG - Intronic
1142557735 17:790929-790951 CAGTTGAGGTGGCCAATCAGCGG - Intronic
1143144868 17:4768364-4768386 CTCAGGAGGTGGCCGATGAGAGG - Intergenic
1143437000 17:6936569-6936591 TGCAGGAGGGGACCAATCAGAGG + Intronic
1143437570 17:6940482-6940504 TGCAGGAGGGGACCAATCAGAGG + Intronic
1143951340 17:10634933-10634955 CACTGGAGAAGACCAAGCAGAGG - Exonic
1145225586 17:21125440-21125462 TGCAAGAGGGGACCAATCAGAGG + Intronic
1146276130 17:31516941-31516963 TGCAGGAGGGGACCAATCAGAGG + Intronic
1146756006 17:35432627-35432649 TGCGGGAGGGGACCAATCAGAGG + Intronic
1147162689 17:38577280-38577302 CACAGGAGGAACCCAATGAGAGG + Intronic
1148349382 17:46928696-46928718 CACTGGAGGAAACCATTCAGAGG - Intronic
1150849167 17:68687915-68687937 CATAGGAGGGGAAAAATCAGAGG - Intergenic
1151326742 17:73384339-73384361 CAAAGGAGGTGAACAAGGAGCGG - Intronic
1152429778 17:80242370-80242392 CACAGCAGGTGCTCAATAAGTGG - Intronic
1152694805 17:81738758-81738780 CCCAGGAGCTGACCCAGCAGCGG + Intergenic
1153261700 18:3230546-3230568 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1153721733 18:7910728-7910750 TGCAGGAGGGGACCAGTCAGAGG + Intronic
1154335496 18:13461774-13461796 TGCAGAAAGTGACCAATCAGAGG + Intronic
1155842096 18:30658844-30658866 TGCAGGAGGGGACCACTCAGAGG + Intergenic
1155925259 18:31649146-31649168 GACAGGAGGTGACCAATGGCTGG - Intronic
1156203436 18:34859492-34859514 TGCAGGAGGCGACCAATCAGAGG + Intronic
1156238412 18:35227493-35227515 TGCATGAGGGGACCAATCAGAGG + Intergenic
1156404368 18:36770382-36770404 CACAGGAGGTGACCAGGGTGTGG + Intronic
1158266342 18:55664674-55664696 AGCAGGAGGGGACCAAACAGAGG - Intronic
1158344933 18:56506666-56506688 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1158679872 18:59557553-59557575 TGCAGGAGGGGACCAATCAGAGG - Intronic
1158803813 18:60945712-60945734 ACCAGGAGGTGACCAATCACAGG - Intergenic
1160294102 18:77622204-77622226 TGCAGGAGGGGACCAATCAGAGG + Intergenic
1163185385 19:15635593-15635615 CACAGGTGGTAGCCAAGCAGTGG - Intronic
1163844841 19:19632690-19632712 CACAGCAGGTGCACATTCAGTGG + Intronic
1164444240 19:28303482-28303504 CACAGGAGGTGCTTTATCAGAGG + Intergenic
1164826900 19:31290547-31290569 CCGAGGAGGTGACAATTCAGTGG + Intronic
1165122836 19:33573119-33573141 TGCAAGAGGGGACCAATCAGAGG + Intergenic
1165533588 19:36424170-36424192 TGCGGGAGGGGACCAATCAGAGG + Intergenic
1165968483 19:39604871-39604893 TACAGGAGGAGAACACTCAGTGG + Intronic
1165997981 19:39858713-39858735 CGCGGGAGGGGACCAATCAGAGG + Intergenic
1167012647 19:46819035-46819057 TACAGGAGGGGACCACTCAGAGG + Intergenic
1168396549 19:56053507-56053529 CACAGGAGTGGACAAAACAGTGG + Intronic
1168673247 19:58257526-58257548 TGCAGGAGGGGACCAATCCGAGG + Intronic
926076022 2:9943496-9943518 CACAGGAGCTTTCAAATCAGTGG - Intergenic
926206650 2:10838582-10838604 CACAGTAGGTAACCAATGAATGG - Intergenic
927916495 2:26939998-26940020 AAAAGGAGGTGACCAGTAAGGGG - Intronic
929335993 2:40746342-40746364 TGCAGGAGGGGACCAATCAGAGG - Intergenic
929783698 2:44974135-44974157 CACTGGAGGTGATCAGGCAGAGG - Intergenic
931342492 2:61414973-61414995 TGCAGGAGGGGACCAATTAGAGG + Intronic
932692487 2:73925186-73925208 TGCAGGAGGGGACCAATCAGAGG + Intergenic
932837986 2:75055393-75055415 CAAAGGAGGCGACAATTCAGAGG - Intronic
933079843 2:77972230-77972252 TGCAGGAGGTGAAAAATCAGAGG + Intergenic
936110440 2:109660241-109660263 TGCAGGAGGTGACCAATCAGAGG - Intergenic
940662372 2:156562636-156562658 CACAGGAAGTGACAATTAAGAGG - Intronic
940803122 2:158154726-158154748 CATAGGTGGTAACCAAGCAGTGG + Intergenic
942929390 2:181471475-181471497 CACAGGATGCGATCACTCAGAGG - Intronic
945063823 2:205931611-205931633 TGCAGAAAGTGACCAATCAGAGG + Intergenic
945063836 2:205931702-205931724 TGCAGGAGGGGACCAATCAGAGG + Intergenic
945373517 2:209051505-209051527 CAAACAAGATGACCAATCAGAGG + Intergenic
946442626 2:219709699-219709721 CACAGGAGGTCACAGATGAGAGG - Intergenic
946604864 2:221392602-221392624 TATGGGAGGAGACCAATCAGAGG - Intergenic
947713667 2:232329573-232329595 CACAGGAGCTAACCAGTCAGAGG + Intronic
947733109 2:232441811-232441833 CACAGGAGCTAACCAGTCAGAGG + Intergenic
948075466 2:235162293-235162315 TGCAGGAGGTGACCAATTAGAGG + Intergenic
948305405 2:236943768-236943790 CAGAGAAGGGGCCCAATCAGTGG + Intergenic
948381483 2:237553129-237553151 CGCAGGAGGCAACCAATCAGAGG + Intronic
948618796 2:239219953-239219975 CACAGGAGGTGTGCATACAGAGG + Intronic
1169107950 20:3013305-3013327 CACAGGAGGAGATGAAACAGAGG + Intronic
1170639943 20:18142938-18142960 CACAGGAATTGACAAATCAAAGG - Exonic
1171244769 20:23602542-23602564 CCCAGGAGTTGACATATCAGTGG - Exonic
1171392378 20:24809845-24809867 CACAGAAGGTGACTGATCTGTGG + Intergenic
1172810969 20:37647941-37647963 CACAGTAGGTGCTCAATAAGGGG - Intergenic
1173316559 20:41950157-41950179 CACAGGAAGAGACCAGTCAGGGG - Intergenic
1174693080 20:52528966-52528988 CATAGGAGGTGTCCAGTAAGTGG + Intergenic
1175286442 20:57839981-57840003 TCCAGGAGGTGACCAGGCAGAGG + Intergenic
1175602584 20:60287060-60287082 TTCAGAAGGTGACCAATCGGAGG - Intergenic
1177897109 21:26866662-26866684 TACAGGAGGGGACCTATCAGAGG - Intergenic
1178691623 21:34754803-34754825 CACAGGAGGCGTTCAACCAGAGG - Intergenic
1179116664 21:38499669-38499691 AACATGAGGTGATAAATCAGAGG - Intronic
1179784349 21:43720976-43720998 CACCTGAGGTGAGCAATCAGAGG - Intronic
1182809814 22:33106189-33106211 CAGCAGAGGTGCCCAATCAGTGG - Intergenic
1183464459 22:37972757-37972779 CCCAGGAGGTGACGAGGCAGGGG - Exonic
1183500724 22:38177204-38177226 CACAGCAGGTGCTCAATCTGTGG + Intronic
1184819341 22:46897416-46897438 TGCAGAAAGTGACCAATCAGAGG + Intronic
1184819355 22:46897502-46897524 TGCTGGAGGGGACCAATCAGAGG + Intronic
953146968 3:40286721-40286743 CACAGGTGAAGATCAATCAGTGG - Intergenic
953645710 3:44752168-44752190 TGCAGGAGGGGACCAATCAGAGG - Exonic
953645722 3:44752259-44752281 TGCAGAAAGTGACCAATCAGAGG - Exonic
956049954 3:65237076-65237098 CACAGTAAGTAACCAATAAGTGG - Intergenic
957078102 3:75617552-75617574 CACAGGGAGTGGCCACTCAGGGG - Intergenic
958183620 3:90090202-90090224 CAAATTAGGTGACCAAACAGTGG + Intergenic
959194257 3:103158372-103158394 TACAGGAGGTGACCAATCAGAGG + Intergenic
960259578 3:115551301-115551323 AACAGCAGCTGACCAATCAATGG + Intergenic
960798613 3:121514751-121514773 CAGTGGTGGTGCCCAATCAGAGG + Intronic
961627943 3:128276437-128276459 CACAGTATGTGACAAATCAGGGG - Intronic
961791528 3:129380021-129380043 TGCAGGAGGGGACCAATCAGAGG - Intergenic
963060588 3:141221740-141221762 CACAGGAGGTGCTCAATAAAGGG + Intergenic
963824482 3:149937093-149937115 CAAAGGAGATGCCAAATCAGAGG - Intronic
964613986 3:158642961-158642983 TGCAGGAGGTGACCAATCAGAGG + Intergenic
967095065 3:186171049-186171071 AACAGGAGTTGTCCAAGCAGAGG - Intronic
967268520 3:187713629-187713651 CATGGAAGGTGACCAATCAGAGG + Intronic
967268531 3:187713719-187713741 TGCAGGAGGGGACCAATCAGAGG + Intronic
967540015 3:190656373-190656395 CACAGTAGGTGACACAACAGCGG - Exonic
968580195 4:1386323-1386345 GCCAGGAGGCGACCACTCAGAGG + Exonic
968728723 4:2259987-2260009 CACAGGTGGGGACAAGTCAGGGG + Intronic
969192696 4:5535130-5535152 CACTGCAGGTGACCAGCCAGGGG - Intergenic
970228455 4:13883975-13883997 TGCAGGAGGGGACCGATCAGAGG + Intergenic
971308197 4:25502018-25502040 CACTGGAGGTGACCAACCCTAGG - Intergenic
976814669 4:89133780-89133802 TGCAGAAAGTGACCAATCAGAGG + Intergenic
985767815 5:1789408-1789430 TGCAGGAGGGGACTAATCAGAGG - Intergenic
986238251 5:5932842-5932864 TGCAGGAGGGGACCGATCAGAGG - Intergenic
986238269 5:5933006-5933028 TGCAGGAGGGGACCAATTAGAGG - Intergenic
986254285 5:6088824-6088846 TGCAGGAGGGGACCAATCAGAGG - Intergenic
987182409 5:15381494-15381516 ATCAGGAGGTGACCAGTTAGTGG + Intergenic
990364354 5:55054760-55054782 TGCAAGAGGGGACCAATCAGAGG + Intergenic
991011080 5:61883700-61883722 CACAGAATGTGTCCAAGCAGTGG - Intergenic
993660077 5:90622549-90622571 ATCAGGAGCTGAGCAATCAGAGG - Intronic
994188672 5:96843375-96843397 TGCAGAAAGTGACCAATCAGAGG + Intronic
995022348 5:107380940-107380962 CACAGGAGCTGACGAACCACTGG + Exonic
996207248 5:120756188-120756210 TGCAGTAGGGGACCAATCAGAGG + Intergenic
996392113 5:122973135-122973157 CACAGGTTTTGACCACTCAGAGG + Intronic
997665362 5:135625989-135626011 CACAGGGGGTGCCCAAACACAGG - Intergenic
999100032 5:149015793-149015815 AACAGGACATGACCAATTAGTGG - Intronic
999944759 5:156582861-156582883 CTCAGGAAGTGAAAAATCAGTGG - Intronic
1000086380 5:157891062-157891084 TGCAGGAGGGGACCAGTCAGAGG + Intergenic
1001222188 5:169910625-169910647 CACAGCAGATGACCCAGCAGGGG + Intronic
1002615931 5:180456094-180456116 TGCAGGAGGGAACCAATCAGAGG - Intergenic
1003348088 6:5289649-5289671 TGCAGGAGGGGACTAATCAGAGG + Intronic
1003351141 6:5318809-5318831 TGCAGGAGGGGACCAATCAGAGG + Intronic
1005525549 6:26644214-26644236 CCCAGGAGGTGGTCAATTAGGGG + Intronic
1006738192 6:36290107-36290129 CACAGGAGGTAACCAGGCAGAGG - Intronic
1007532593 6:42555974-42555996 TCCAGGAGGGGACCAATCAGAGG - Intergenic
1008544517 6:52573770-52573792 CAGAAGAGGTGACCAGTGAGTGG + Intronic
1008959206 6:57248698-57248720 TGCAGGAGGGGACCAGTCAGAGG + Intergenic
1012323099 6:97876952-97876974 TGCAGGAGGGGACCAATCAGAGG + Intergenic
1012711592 6:102613748-102613770 TGCAGGAGGAGACCAATTAGAGG - Intergenic
1012711603 6:102613839-102613861 CATGAGAGGTGACCAGTCAGAGG - Intergenic
1012711947 6:102617772-102617794 TGCAGGAGGAGACCAATCAGAGG - Intergenic
1012712913 6:102631543-102631565 TGCAGAAGGTAACCAATCAGAGG - Intergenic
1013614507 6:111829304-111829326 CACATCAGGTGAGAAATCAGAGG - Intronic
1014199389 6:118591384-118591406 TGCAGGAGGGGACCAATCAGAGG - Intronic
1014199407 6:118591545-118591567 TGCAGAAAGTGACCAATCAGAGG - Intronic
1015105691 6:129533427-129533449 TGCAGGAAGGGACCAATCAGAGG - Intergenic
1015105700 6:129533508-129533530 TGTAGAAGGTGACCAATCAGAGG - Intergenic
1015161653 6:130159037-130159059 TGCAAGAGGGGACCAATCAGAGG + Intronic
1015547788 6:134379172-134379194 TGCAGAAGGCGACCAATCAGAGG + Intergenic
1015630453 6:135227211-135227233 TGCAGAAGGGGACCAATCAGAGG - Intergenic
1015823496 6:137287770-137287792 CATAGGGGTTGACCAATCTGGGG + Intergenic
1016488527 6:144570299-144570321 CAGAGGCAGTGACCACTCAGAGG + Intronic
1017006282 6:150029848-150029870 TGCAGAAGGGGACCAATCAGAGG - Intergenic
1017032977 6:150240542-150240564 TGCAGAAGGTGACCAATCAGAGG + Intronic
1019873860 7:3791654-3791676 CACAACAGGTGCCCACTCAGCGG + Intronic
1020602399 7:10292545-10292567 CACAAAAGGCAACCAATCAGAGG + Intergenic
1020909011 7:14104770-14104792 TGCAGGAGGGTACCAATCAGAGG + Intergenic
1021226849 7:18037766-18037788 TGCAGGAGGGGCCCAATCAGTGG - Intergenic
1021236893 7:18153442-18153464 TGCAGAAAGTGACCAATCAGAGG + Intronic
1021500498 7:21328154-21328176 GGCAGAAAGTGACCAATCAGAGG + Intergenic
1022893452 7:34724801-34724823 TACAGTAGGTGACCAATAAATGG + Intronic
1023912903 7:44568038-44568060 CACAGGGGCTGACCCAGCAGTGG + Intronic
1024016926 7:45325601-45325623 CACAGGAGGTCACCACCCATTGG - Intergenic
1027749515 7:82124518-82124540 TGCAGAAAGTGACCAATCAGAGG - Intronic
1029581036 7:101436652-101436674 CACTGGAGGTGAGTAAGCAGAGG - Intronic
1030845178 7:114400753-114400775 AGCAGGAGGTGAGTAATCAGTGG - Intronic
1031298323 7:120033398-120033420 TGCAGAAAGTGACCAATCAGAGG - Intergenic
1031749283 7:125550753-125550775 TGCAGGAGGTGATCAATCAAAGG + Intergenic
1032252686 7:130271603-130271625 TGCAGGAGGGGACCAATCAGAGG + Intronic
1032870662 7:135981037-135981059 TGCAGGAGGGGACCAGTCAGAGG + Intergenic
1037518038 8:19653213-19653235 GACAGGAGGTGACCATCCATTGG - Intronic
1037855431 8:22367734-22367756 GACAGTAGGTGGCCAATCCGAGG + Intronic
1038142686 8:24863877-24863899 TGCAGGAGGGAACCAATCAGAGG + Intergenic
1040634967 8:49262519-49262541 TGCTGGAGGGGACCAATCAGAGG - Intergenic
1042367240 8:67951849-67951871 CACAGGAGGTTCCCAATCCCAGG - Intergenic
1043820647 8:84859227-84859249 TGCGGGAGGGGACCAATCAGAGG + Intronic
1044413516 8:91910686-91910708 CATGGAAGGTGACCAGTCAGAGG + Intergenic
1044413523 8:91910756-91910778 TGCAGGAGGGGACCAATTAGAGG + Intergenic
1045606311 8:103781127-103781149 CAAAGGAGATGCCAAATCAGAGG - Intronic
1046383650 8:113481253-113481275 TGTAGGAGGGGACCAATCAGAGG + Intergenic
1047333129 8:123910476-123910498 CACAGGATGTGGCCACACAGAGG - Intronic
1047351504 8:124078815-124078837 CACAGGAAGGGACCTAGCAGAGG + Intronic
1049248104 8:141573469-141573491 TGCAAGAGGGGACCAATCAGAGG - Intergenic
1052487942 9:29127043-29127065 CATGGAAGGTGACCAATCAGAGG - Intergenic
1052488492 9:29132379-29132401 TGCAGGAAGGGACCAATCAGAGG - Intergenic
1054903629 9:70395121-70395143 CACAGGAAAAGACAAATCAGTGG + Intronic
1055025216 9:71712243-71712265 CACAGGACGTTCCCAATTAGAGG - Exonic
1056570354 9:87809355-87809377 TTCAGGAGGGGACTAATCAGAGG + Intergenic
1057311581 9:93946395-93946417 CTCAGGAAGTGACCCTTCAGTGG - Intergenic
1057950024 9:99362390-99362412 CACTGAAGGTGTCCAAGCAGTGG - Intergenic
1058971597 9:110088280-110088302 TGCAGGAGGGGACCAATCAGAGG + Intronic
1059469515 9:114494056-114494078 AAGAGGAGGTGACCCATCACGGG - Intronic
1060766131 9:126296131-126296153 CACAGCAGGTGATCCATCTGTGG + Intergenic
1060876504 9:127087687-127087709 CTCAGGAGTTGAATAATCAGGGG - Exonic
1061255058 9:129450388-129450410 CTCAGGAGGTAACCATTTAGTGG - Intergenic
1061441822 9:130609949-130609971 CACAGTAGGTAACCAGTTAGGGG + Exonic
1062170144 9:135130328-135130350 TACAGGAGGCAACCAATCAGAGG + Intergenic
1062172847 9:135144977-135144999 CCCAGGAGGTGAGCCCTCAGCGG - Intergenic
1062706516 9:137947243-137947265 TGTGGGAGGTGACCAATCAGAGG + Intronic
1187335311 X:18376427-18376449 CGCGGGAGGGGACCAATCAGAGG - Intergenic
1187335360 X:18376781-18376803 CATGGGAGGCGAACAATCAGAGG - Intergenic
1188451055 X:30308643-30308665 CAGAGGAGGTGTCCCACCAGGGG + Exonic
1189734576 X:44056753-44056775 CACAGGAGGTGAGCAAGCAAAGG - Intergenic
1190105254 X:47556182-47556204 CACAGGAGGTGGCCAATGGGAGG - Intergenic
1190766426 X:53479492-53479514 TATAGGAGGGGCCCAATCAGAGG + Intergenic
1191718524 X:64209767-64209789 CAAAGGAGATGCCCAATGAGTGG - Intergenic
1192736103 X:73850870-73850892 GACAGGAGGGGACAAATAAGAGG + Intergenic
1193148530 X:78102223-78102245 TGCAGGAAGGGACCAATCAGAGG - Intronic
1193148542 X:78102314-78102336 TGCAGAAAGTGACCAATCAGAGG - Intronic
1193748143 X:85309143-85309165 TGCAGAAAGTGACCAATCAGAGG - Intronic
1195003295 X:100662993-100663015 CACAGGAAGTGACCAATACAGGG - Intronic
1195211378 X:102654410-102654432 CAAAGGAGGAGACCAATATGGGG + Exonic
1195657579 X:107346974-107346996 CACAAGGGGTGACAAATAAGTGG + Intergenic
1196288804 X:113915192-113915214 GAAAGGTGGGGACCAATCAGAGG - Intergenic
1197388202 X:125826838-125826860 AATATGAGGTGACCAAGCAGGGG + Intergenic
1199113720 X:143964680-143964702 TGCAGGAGGTGACCAATCAGAGG + Intergenic
1199848909 X:151711384-151711406 CCCAGGAGGTGTGCAGTCAGAGG + Intergenic
1199915109 X:152331009-152331031 CACAGGATGTTAACATTCAGTGG + Intronic
1201313457 Y:12619746-12619768 AAGAGGAGGTGGCCAATCAGAGG + Intergenic
1201593208 Y:15637780-15637802 CACAGGAGGAGGCCAATGGGTGG - Intergenic