ID: 1108467466

View in Genome Browser
Species Human (GRCh38)
Location 13:50731105-50731127
Sequence ACGACCACTCTGGTCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108467466_1108467473 23 Left 1108467466 13:50731105-50731127 CCTCCTGTGACCAGAGTGGTCGT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1108467473 13:50731151-50731173 AGTGTAACCAAGTAACCAATGGG 0: 5
1: 15
2: 25
3: 27
4: 108
1108467466_1108467472 22 Left 1108467466 13:50731105-50731127 CCTCCTGTGACCAGAGTGGTCGT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1108467472 13:50731150-50731172 GAGTGTAACCAAGTAACCAATGG 0: 4
1: 16
2: 27
3: 29
4: 103
1108467466_1108467470 -2 Left 1108467466 13:50731105-50731127 CCTCCTGTGACCAGAGTGGTCGT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108467466 Original CRISPR ACGACCACTCTGGTCACAGG AGG (reversed) Intronic
907514075 1:54982171-54982193 ATGACCACTGTAGTCAGAGGGGG + Intronic
914346917 1:146807787-146807809 AATACCACTCTGAACACAGGAGG - Intergenic
919729127 1:200901736-200901758 ACAACCACCCTGGTCAAGGGTGG + Intronic
919860938 1:201739311-201739333 ACGACCCTTCTGCTCACAGCCGG - Intronic
920845547 1:209590335-209590357 GCGATCACTCTGGTTACAGAGGG + Intronic
1063132457 10:3189856-3189878 ACCAGCATTCTGTTCACAGGTGG + Intergenic
1066106762 10:32163522-32163544 ACCTCCCCTGTGGTCACAGGTGG + Intergenic
1066682557 10:37948099-37948121 CCTGCCACTCTGGTCACAAGAGG - Intergenic
1067557329 10:47282183-47282205 ACGGGCACTGTGGACACAGGAGG + Intergenic
1068541091 10:58295697-58295719 AGGACCATTCAGGTCACAGGTGG - Intergenic
1072196683 10:93122063-93122085 AAGACCTCTCTGGCCACATGGGG + Intergenic
1072534476 10:96351388-96351410 ACGTCCTCTCCTGTCACAGGTGG - Exonic
1073193874 10:101672273-101672295 AAGACTTCTCTGCTCACAGGTGG + Intronic
1074051771 10:109887061-109887083 ATGCCCACCCTGCTCACAGGTGG - Intronic
1075575400 10:123573807-123573829 ACTACCTGCCTGGTCACAGGTGG - Intergenic
1076941690 10:133614432-133614454 ACCACCACGCTGGCCTCAGGAGG - Intergenic
1077114357 11:876622-876644 ACGCCCACTCTAGTCCAAGGAGG - Intronic
1079444403 11:20546167-20546189 AGGACCACTGTGGGCACAAGTGG + Intergenic
1080352925 11:31405743-31405765 ATGACCACTCTGGGTGCAGGGGG - Intronic
1086323674 11:85676720-85676742 TCGACCACCCTGGGCTCAGGTGG + Intronic
1086457090 11:86969671-86969693 TCTACCACTCTGGTCTCATGTGG - Intergenic
1088226357 11:107624564-107624586 TCGACCTCTCTGGGCTCAGGTGG - Intronic
1089007603 11:115105514-115105536 GTGACCACTGTGGTCACACGTGG + Intergenic
1097066613 12:56325214-56325236 ACTACCACCCTGGACCCAGGAGG - Intronic
1098555063 12:71809148-71809170 AGGACCACTCTGGCCATATGTGG + Intergenic
1102651297 12:114444347-114444369 AGGACCAACCTGGTCACAGCTGG + Intergenic
1103332915 12:120166927-120166949 TCGACCTCCCTGGTCTCAGGTGG - Intronic
1108467466 13:50731105-50731127 ACGACCACTCTGGTCACAGGAGG - Intronic
1110964684 13:81677940-81677962 ACCACCAATCTGGGCACAAGAGG - Intergenic
1112143731 13:96674514-96674536 ACTAGCACTCTGGGAACAGGGGG + Intronic
1113940191 13:114014886-114014908 ACGACCACAGTGGTCTCTGGGGG - Intronic
1115459994 14:33649868-33649890 ACAACCACTCTGGTCAAACTTGG - Intronic
1121318245 14:92974868-92974890 ATGAGGACTGTGGTCACAGGAGG + Intronic
1124455207 15:29836105-29836127 ACAACCACTGTGGTGTCAGGAGG + Intronic
1127116513 15:55733008-55733030 GAGACCATTCTGGTCACATGGGG + Intronic
1132402849 15:101523968-101523990 ACAGGGACTCTGGTCACAGGTGG + Intronic
1134861099 16:17561309-17561331 GCGGCCACTCTAGGCACAGGTGG + Intergenic
1137675708 16:50302832-50302854 ACGAGCACCCTGCACACAGGAGG - Intronic
1139987065 16:70907483-70907505 AATACCACTCTGAACACAGGAGG + Exonic
1143879783 17:10021252-10021274 ACCACCACTATGGGCACAGCTGG - Intronic
1145274529 17:21421822-21421844 AAGACCACTCTGGTGCCGGGTGG - Intergenic
1152509111 17:80773178-80773200 ACCACCACTCTTGGGACAGGTGG + Intronic
1152558567 17:81066775-81066797 ACGGCCCCTCTGGGCTCAGGCGG + Intronic
1153498450 18:5723106-5723128 AAGACCTCTCAGGTCAAAGGGGG - Intergenic
1161155039 19:2728099-2728121 ATGACCAGGCAGGTCACAGGCGG - Intronic
933787797 2:85857794-85857816 ACGACTACTCCGGCCACAGTGGG + Intronic
936391470 2:112078413-112078435 ACAACCACTCTGCTCTCACGGGG + Intronic
1175832597 20:61974429-61974451 ACGCCCTCTCTCGCCACAGGAGG + Intronic
1175929326 20:62486223-62486245 AAGCCCACTGTGGTCACAGTTGG - Intergenic
1179372102 21:40815946-40815968 ACAACCACAATGGTGACAGGTGG - Intronic
1182028367 22:27138057-27138079 CCGACCACTCTGCTCTCAGCTGG - Intergenic
949368266 3:3306704-3306726 AAGACCAGTCTGGCCACAGCTGG + Intergenic
951883756 3:27504332-27504354 ACCAACAATCTGGGCACAGGAGG - Intergenic
952358191 3:32604147-32604169 ATGAGCCCTATGGTCACAGGAGG - Intergenic
961275609 3:125723603-125723625 ACGCCCACTCTGCTGTCAGGAGG + Intergenic
967369260 3:188725238-188725260 TCTACCTCTCTGGTCACAGGTGG + Intronic
971959767 4:33471008-33471030 CCAACCACTCTGGACACTGGTGG + Intergenic
972287391 4:37662117-37662139 AAGACCACTCTGGGAACAGATGG + Intronic
988985529 5:36614771-36614793 ACTGCCACTCTGGTCAGAGTGGG + Intronic
993927404 5:93886279-93886301 CTGACCTCTCTGGTCACATGTGG - Intronic
996287835 5:121815659-121815681 ACCTCCACTCTGCCCACAGGCGG + Intergenic
996618000 5:125464579-125464601 ACTACCAATCAGGTCAAAGGAGG + Intergenic
997295233 5:132764775-132764797 ATGACCACCCTGGTCCCAGGAGG - Intronic
1015974350 6:138773953-138773975 CCCACCACTCTGGTCACTGCTGG + Intronic
1035599552 8:889554-889576 AAGAGCACTCTGGACACAGACGG + Intergenic
1035722580 8:1803113-1803135 CCGACCACCCTGGGCACATGTGG + Intergenic
1036086669 8:5620001-5620023 ACTACCACGCTGGTCAAAGGTGG - Intergenic
1039446290 8:37635834-37635856 ACGACCACTCTGTTGTCAGGAGG + Intergenic
1042737529 8:72005381-72005403 ACGCCCCCGCTGGTCACTGGTGG - Intronic
1048035456 8:130673351-130673373 ACCACCGCTCTGCTCACATGTGG + Intergenic
1050539359 9:6656999-6657021 AAGATAACTGTGGTCACAGGTGG + Intergenic
1052336855 9:27329243-27329265 ATGACCCCCCTCGTCACAGGTGG + Exonic
1056703000 9:88926122-88926144 ATGACCACACTGTTCACAGCAGG - Intergenic
1060391951 9:123285083-123285105 ATGACCATTCTGGTGACACGTGG - Intergenic
1060869871 9:127030914-127030936 AGGAACACCCTGGTGACAGGAGG + Intronic
1061201516 9:129140963-129140985 AAGCCCACTCTGGTCCCTGGGGG - Intronic
1062548254 9:137073607-137073629 TGGACCACTCTGGGCAGAGGTGG + Intergenic
1062704040 9:137924955-137924977 AGGAACCCCCTGGTCACAGGCGG - Intronic
1187682063 X:21777752-21777774 TCGACCTCTCTGGGCTCAGGTGG - Intergenic
1189259973 X:39671391-39671413 AAGATCACTCTGATCACAGTGGG - Intergenic
1198784676 X:140274055-140274077 ACCACCTCTCTGGTCTCAGTTGG + Intergenic
1200207478 X:154327747-154327769 AAGAGCACTCAGGGCACAGGAGG - Intronic