ID: 1108467467

View in Genome Browser
Species Human (GRCh38)
Location 13:50731108-50731130
Sequence CCGACGACCACTCTGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108467467_1108467472 19 Left 1108467467 13:50731108-50731130 CCTGTGACCAGAGTGGTCGTCGG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1108467472 13:50731150-50731172 GAGTGTAACCAAGTAACCAATGG 0: 4
1: 16
2: 27
3: 29
4: 103
1108467467_1108467473 20 Left 1108467467 13:50731108-50731130 CCTGTGACCAGAGTGGTCGTCGG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1108467473 13:50731151-50731173 AGTGTAACCAAGTAACCAATGGG 0: 5
1: 15
2: 25
3: 27
4: 108
1108467467_1108467470 -5 Left 1108467467 13:50731108-50731130 CCTGTGACCAGAGTGGTCGTCGG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108467467 Original CRISPR CCGACGACCACTCTGGTCAC AGG (reversed) Intronic
1073650432 10:105352713-105352735 CCGATAACCATCCTGGTCACAGG + Intergenic
1078067035 11:8085419-8085441 CAGAGGACCACACTGCTCACAGG - Intronic
1078337964 11:10478626-10478648 CCCACAACCCCTGTGGTCACTGG + Exonic
1080548299 11:33343874-33343896 CAGACCACCACTGTGGCCACTGG - Intronic
1080571266 11:33559174-33559196 CTGAAAACCAGTCTGGTCACGGG - Intronic
1108467467 13:50731108-50731130 CCGACGACCACTCTGGTCACAGG - Intronic
1120401258 14:84035164-84035186 CTGACTACTACTCTGATCACTGG + Intergenic
1132382961 15:101379275-101379297 ACGTCCACCCCTCTGGTCACGGG - Intronic
1133042224 16:3066799-3066821 CCCACAACCACTATGGTCCCAGG - Intronic
1138201469 16:55091627-55091649 CGGACGCCTACTCTGGCCACGGG + Intergenic
1142381966 16:89738065-89738087 CCGCCGGCCACACTGGTCACAGG - Exonic
1143802131 17:9391993-9392015 CCAACTCCCAGTCTGGTCACTGG + Intronic
1150823698 17:68457004-68457026 CAGACACCCACTTTGGTCACTGG + Intronic
1151952388 17:77362304-77362326 GCCACGGCTACTCTGGTCACAGG - Intronic
1153477982 18:5517880-5517902 CTGACCACCACTCTGGTCTGTGG + Intronic
1161849100 19:6729810-6729832 CTGACCCCCACTCTGGGCACTGG + Intronic
925190252 2:1876551-1876573 CAGAGGTCCACTCTGGCCACGGG - Intronic
925371384 2:3348251-3348273 CTGACGAGGACCCTGGTCACCGG + Intronic
928208015 2:29301048-29301070 CAGACTACTTCTCTGGTCACTGG - Intronic
948005397 2:234603952-234603974 CCCACCACCACTGTGGCCACAGG - Intergenic
1173642608 20:44614594-44614616 CCGACGGCCTGTCCGGTCACAGG - Exonic
1180970830 22:19814558-19814580 CCGGGGACAACCCTGGTCACTGG - Intronic
1184236468 22:43185868-43185890 CCGAGGACCACTCTGGTCCCAGG - Intronic
956301209 3:67774777-67774799 CCAGCCACCACTCTGGGCACTGG + Intergenic
959685401 3:109140459-109140481 CCTCCGACCAGCCTGGTCACTGG - Intergenic
962265011 3:133938601-133938623 CTGACGAGCCCTCTGGTGACCGG + Intronic
965026217 3:163304367-163304389 CCAACACCCACTCTGGCCACAGG - Intergenic
971959765 4:33471005-33471027 CAGCCAACCACTCTGGACACTGG + Intergenic
982571420 4:157054934-157054956 CCGACAACCACCCTGGTAAATGG + Intergenic
987426887 5:17783283-17783305 CCCAGGACCACTCCAGTCACAGG + Intergenic
991711660 5:69415011-69415033 CCGACAACCGCTCTGGGCCCAGG - Intergenic
993670919 5:90760520-90760542 CAGACCACCAATCTGGTCACAGG + Intronic
997295235 5:132764778-132764800 CCCATGACCACCCTGGTCCCAGG - Intronic
1012102740 6:95111645-95111667 CAGACAATCACTGTGGTCACTGG - Intergenic
1018299079 6:162380946-162380968 ACGGCGGCCACTCTGGTCGCTGG - Intronic
1018718333 6:166552857-166552879 CCGATAACCACGCTGGTCCCTGG + Intronic
1039446289 8:37635831-37635853 CGGACGACCACTCTGTTGTCAGG + Intergenic
1057881474 9:98796088-98796110 CCGGGCACCACTCTGGTCCCGGG + Intronic
1058715621 9:107719697-107719719 CCCAAGCCCACTGTGGTCACTGG + Intergenic
1062394153 9:136345999-136346021 CCGCTGACCACTGTGGCCACAGG + Intronic