ID: 1108467470

View in Genome Browser
Species Human (GRCh38)
Location 13:50731126-50731148
Sequence GTCGGCCAAGTCTTCATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108467467_1108467470 -5 Left 1108467467 13:50731108-50731130 CCTGTGACCAGAGTGGTCGTCGG 0: 1
1: 0
2: 1
3: 2
4: 36
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47
1108467464_1108467470 12 Left 1108467464 13:50731091-50731113 CCTCTGATTGGTCACCTCCTGTG 0: 1
1: 1
2: 9
3: 62
4: 248
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47
1108467466_1108467470 -2 Left 1108467466 13:50731105-50731127 CCTCCTGTGACCAGAGTGGTCGT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG 0: 1
1: 0
2: 1
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108467470 Original CRISPR GTCGGCCAAGTCTTCATTTA TGG Intronic
902088457 1:13881693-13881715 GTGGAACAAGTCTTCATTTCTGG + Intergenic
907786552 1:57618443-57618465 GGCTGACAAGTCTTCCTTTAGGG + Intronic
910534066 1:88276411-88276433 TTTGGTCACGTCTTCATTTATGG - Intergenic
918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG + Intergenic
920563518 1:206956235-206956257 GTTGGCCAACTCTTCAGTAAAGG - Intergenic
1080870501 11:36232777-36232799 GACAGCCCAGTCTTCATTTGAGG - Intergenic
1081542534 11:44046354-44046376 ATGGCCAAAGTCTTCATTTATGG + Intergenic
1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG + Intronic
1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG + Intronic
1092265377 12:6976745-6976767 GCCAGCCAAGTCTTCATTTGGGG - Exonic
1096625173 12:52890707-52890729 GTGGGCCAAGTCAAGATTTAGGG + Intergenic
1097785478 12:63754101-63754123 GTCTGCCAATTCTCCATTTAGGG - Intergenic
1101014388 12:100484495-100484517 GTAACCTAAGTCTTCATTTAAGG - Intronic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1107676583 13:42804022-42804044 GTAGAGCAAGTCTTCTTTTAAGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1115014594 14:28594579-28594601 GACAGGCAAGTCTTCATTTTAGG - Intergenic
1143275047 17:5704055-5704077 GTCTTCCAAGTCTCCATTCAGGG + Intergenic
1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG + Intronic
1154966731 18:21365723-21365745 GTCTGTCAAGTCTGCATTTATGG - Intronic
925625957 2:5842275-5842297 GTCTGCCATGGCTTCATTAAGGG + Intergenic
941473295 2:165917234-165917256 GTAGGTCAAGTTTTAATTTAAGG - Intronic
1168911948 20:1455343-1455365 GACAGCCAAGGCTTCCTTTAAGG + Intronic
1184253519 22:43274428-43274450 GTCCGCCATGGCTTCCTTTAGGG - Intronic
953181110 3:40596223-40596245 GTGGGCCAAGCCTTCAGTCAGGG - Intergenic
969864906 4:10068918-10068940 GTGGGTCAAGTATTCATTTAGGG + Intergenic
970777515 4:19693780-19693802 GTCTGACAAATCTTTATTTAAGG - Intergenic
974102003 4:57427451-57427473 GTTGGACAGGTCTTCATGTAAGG - Intergenic
978672832 4:111271767-111271789 GTTCTCCATGTCTTCATTTAAGG + Intergenic
979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG + Intronic
984113848 4:175653463-175653485 GTCTGCCAAATCTTAGTTTAAGG - Intronic
988481025 5:31630714-31630736 GGAGGCCATGTCTTCATTGAAGG + Intergenic
994005620 5:94834234-94834256 GTCTGCCCAGTCTGCATTGAAGG + Intronic
994374005 5:98997586-98997608 CCCGGCCAAGTCTCCATTTTTGG - Intergenic
998165626 5:139841413-139841435 GTAAGCCAAGTGTTCATTGATGG - Intronic
998983425 5:147729166-147729188 GTCAGCCAACTCTTAATTCAGGG - Intronic
1003411470 6:5866757-5866779 GTCGGACAAGTCTGCAGTGAGGG + Intergenic
1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG + Exonic
1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG + Intergenic
1010347354 6:74827040-74827062 GTAGTCCAACTCTTCATTTTGGG + Intergenic
1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG + Intronic
1017258245 6:152358869-152358891 TACGTCCAAATCTTCATTTAAGG - Intronic
1018741852 6:166735334-166735356 GGCGGACTAGTCTCCATTTAGGG + Intronic
1019110922 6:169713201-169713223 GTTGGAGAAGTCTTCATCTAGGG - Intronic
1021041696 7:15870891-15870913 GTATGACAAGTCTTTATTTAAGG - Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1026253253 7:68689281-68689303 GTGGGCCAAGTCTTCATTTGCGG - Intergenic
1028885499 7:95928251-95928273 GGAGGCCAAGTCCTCATTTCTGG + Intronic
1038196082 8:25369494-25369516 GTTGGCCATGTCTTCTTCTAAGG + Intronic
1040728757 8:50416745-50416767 GATGTCAAAGTCTTCATTTATGG - Intronic
1041771106 8:61473289-61473311 GTAGGACATGTCTTCATTTCAGG - Intronic
1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG + Intronic
1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG + Intergenic
1188177910 X:27016881-27016903 GTTGGCAAAGTCTTCCTTAAAGG - Intergenic