ID: 1108468920

View in Genome Browser
Species Human (GRCh38)
Location 13:50748562-50748584
Sequence GTCACCTGAGGACACCCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108468920_1108468929 16 Left 1108468920 13:50748562-50748584 CCATGCGGGTGTCCTCAGGTGAC 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1108468929 13:50748601-50748623 CCTAGTCCCACCTTTTTTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 138
1108468920_1108468923 -10 Left 1108468920 13:50748562-50748584 CCATGCGGGTGTCCTCAGGTGAC 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1108468923 13:50748575-50748597 CTCAGGTGACGGTCCTACCTCGG 0: 1
1: 0
2: 4
3: 228
4: 6541
1108468920_1108468924 -9 Left 1108468920 13:50748562-50748584 CCATGCGGGTGTCCTCAGGTGAC 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1108468924 13:50748576-50748598 TCAGGTGACGGTCCTACCTCGGG 0: 1
1: 0
2: 2
3: 20
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108468920 Original CRISPR GTCACCTGAGGACACCCGCA TGG (reversed) Intronic
900097604 1:946357-946379 GCCACCTGAGGGCACCTGCCAGG - Intronic
900797803 1:4719837-4719859 GCCAACTGTGGACACCGGCAGGG - Intronic
901042530 1:6374157-6374179 GTCACCTGAGGACAGAGGCCTGG + Intronic
901111803 1:6803117-6803139 TCCACCTGAGAACACCCACAGGG - Intronic
901687006 1:10948590-10948612 GGCATCTGAGGACACGGGCAGGG + Exonic
905937913 1:41839514-41839536 GCCACCTGTGGGCACCCCCAAGG + Intronic
915692941 1:157708686-157708708 GTCCCATGAGGATACCCACAAGG + Intergenic
923090334 1:230735711-230735733 GTCACCTGAGGCCAACCTAAGGG - Intergenic
1073088528 10:100912668-100912690 GACAGCTGACGACACCCGCCTGG - Intronic
1074867780 10:117554921-117554943 GTCAACTGAGGCCTCCTGCAAGG + Intergenic
1076238329 10:128883129-128883151 GTCACCTGAGACCACCGGGAGGG - Intergenic
1077266704 11:1654512-1654534 GTCACCTGTGGACACCAGCATGG + Intergenic
1080780836 11:35428616-35428638 GTCAACTGAGGACACCTTCAGGG - Intergenic
1085476035 11:76789443-76789465 GTCACCTGGGGAGACCTGCCTGG + Intronic
1090260020 11:125312752-125312774 ATCACCTGAGCACACCTGTATGG - Intronic
1091224161 11:133947502-133947524 GCCAGCTGGGGACTCCCGCAGGG + Intronic
1091298385 11:134489370-134489392 GTCACCTGAGGTCAGCTGAAGGG - Intergenic
1096727444 12:53576078-53576100 GACACCAGAGGACACACCCAGGG + Intronic
1097126310 12:56778495-56778517 ATCACCTGAGGTCACCAGCCTGG - Intronic
1097711011 12:62917294-62917316 GTGACCTGAGGACATCTACATGG - Intronic
1105436213 13:20380555-20380577 GCCACCTGAAGACACAGGCAGGG + Intergenic
1108468920 13:50748562-50748584 GTCACCTGAGGACACCCGCATGG - Intronic
1112402386 13:99087370-99087392 GTAACCTGAGGACAACGGCCTGG + Intergenic
1113179570 13:107609608-107609630 GTCACTTGCGGAGACCCACAGGG - Intronic
1113463954 13:110501202-110501224 GGCACTGGAGGACAGCCGCAGGG + Intronic
1116520046 14:45835700-45835722 GTAACCTGTGGACAGCCTCATGG - Intergenic
1120764203 14:88313603-88313625 GTCACATGAGCACACCAGCTTGG + Intronic
1123937639 15:25201765-25201787 GCCTCCTGAGGAAACCCTCATGG - Intergenic
1124156078 15:27226214-27226236 GTCACCTGAGGGCATCACCAGGG - Intronic
1125525214 15:40370047-40370069 GTCATCTGGGGACACACCCACGG - Exonic
1127536534 15:59894875-59894897 GTTACCTGAGGACACCAGGCTGG - Intergenic
1128225141 15:65996216-65996238 GTCACCTGGGGAAATCCGTAGGG + Intronic
1130445904 15:84001728-84001750 CTCACCTGAGGACTGCCCCATGG + Intronic
1136735223 16:32461278-32461300 GTCACAGGAGGACACCCAGAAGG - Intergenic
1139212636 16:65094795-65094817 GTCAACTGAGGACACTCAGAAGG + Intronic
1140048562 16:71459193-71459215 GACACCTGTGGACACCTGCTGGG + Intronic
1140552603 16:75883141-75883163 GTCACCTGAAGACTCCCAGAAGG + Intergenic
1141425269 16:83940743-83940765 TCCAGCTGAGGAGACCCGCAGGG + Intronic
1141675920 16:85517263-85517285 GTTACCTGAGGACACACGCAGGG + Intergenic
1141910875 16:87057625-87057647 GTCTCCTGAGGCCACAGGCATGG + Intergenic
1142436017 16:90057952-90057974 GTCACCAGAGGACACACACAGGG - Exonic
1203017857 16_KI270728v1_random:368315-368337 GTCACAGGAGGACACCCAGAAGG + Intergenic
1203036192 16_KI270728v1_random:641473-641495 GTCACAGGAGGACACCCAGAAGG + Intergenic
1142856139 17:2731433-2731455 GGCACCTGTGTACACCTGCAGGG + Intergenic
1147564768 17:41529299-41529321 GTCTCCTGAGAACAGCTGCAGGG + Intergenic
1148683233 17:49486483-49486505 GACACCTGAGAACATCCGCAAGG - Intergenic
1153020708 18:626320-626342 ATCACCTGAGGTCACCAGCCTGG - Intronic
1154185216 18:12177297-12177319 GACACCAGTGGACACCAGCAAGG + Intergenic
1155942124 18:31810077-31810099 GTCACCTTTGGACACCCCAAGGG - Intergenic
1158514985 18:58123430-58123452 GTCCCCTGAGGGCACCGGAAAGG - Intronic
1159003186 18:62991289-62991311 GTCACCTGAGGACAGCCCCCAGG - Intergenic
1159758746 18:72398382-72398404 GTCACCAGTGGAGAGCCGCAAGG + Intergenic
1160629279 18:80234058-80234080 GTGAGCTGTGGACACCCGCAGGG - Intronic
1160856139 19:1218851-1218873 GTCATCTGTGGACACCCCCATGG + Intronic
1161557533 19:4952600-4952622 ATCACCTGAGGTCACCAGCCTGG - Intronic
1164674250 19:30091195-30091217 GTCACCTGGTGACACCCACCAGG - Intergenic
1168352138 19:55682248-55682270 GTCTCCTGAGGAAACCTGGAAGG - Intronic
930451141 2:51539776-51539798 GTGACCTGAGGACTCACTCATGG + Intergenic
934310548 2:91858445-91858467 GTCACAGGAGGACACCCAGAAGG + Intergenic
936078707 2:109418044-109418066 CTCACCTGAGGACACACACTGGG + Intronic
937613749 2:123894713-123894735 GTCTCCAGAGGCCACCAGCATGG + Intergenic
941395065 2:164964040-164964062 GCCACCTGAGGTCACTCTCATGG - Intergenic
944678404 2:202053536-202053558 GTGACTTGGGGACACCAGCAAGG - Intergenic
948225409 2:236305930-236305952 GTCTCCTGATGACATCTGCAGGG + Intergenic
948860642 2:240751093-240751115 GAGCCCTGAGGACACCCCCAGGG + Intronic
948920620 2:241064366-241064388 TTCACCCGAGGACACACCCAGGG + Intronic
1169344230 20:4817665-4817687 GTCACCTCAGGACTCCGGCATGG - Intronic
1172129186 20:32644564-32644586 GTCCCCTGGGGGCACCTGCAGGG + Intergenic
1174126330 20:48309585-48309607 GTTCCCTGAGGACACTGGCATGG - Intergenic
1174720734 20:52809308-52809330 GTCACCTGAGGCCATGTGCATGG + Intergenic
1179834596 21:44021816-44021838 GCCACCTGAGGATAACAGCAAGG + Intronic
1180090533 21:45531594-45531616 GTCCCCACAGGCCACCCGCAGGG + Exonic
1181257821 22:21575363-21575385 ATCACTTGAGGAGACCAGCATGG + Intronic
1182057167 22:27368697-27368719 ATCACCTGAGGTCACCAGCTTGG - Intergenic
1183870168 22:40735694-40735716 GTCTCCTGAGGCCACACCCAGGG + Intergenic
1184348219 22:43925801-43925823 GTGGCCTGTGGACACCCACATGG + Intronic
1184824337 22:46937030-46937052 GTCTCCTGAGGAGGGCCGCAGGG + Intronic
949540872 3:5031168-5031190 ATCACCTGAGGAGACCAGCCTGG + Intergenic
950025412 3:9816715-9816737 ATCACCTGAGGTCACCAACATGG - Intronic
954302538 3:49707583-49707605 GGCACCTGAAGAGACCCTCAGGG - Intronic
954877938 3:53815370-53815392 GTCACCTGAGGAAGCCAGCATGG - Exonic
958072490 3:88632277-88632299 GTGACCTGAGGACACCAGGGGGG - Intergenic
961440854 3:126952436-126952458 GTCCCCTCAGCACACCAGCATGG - Intronic
963075892 3:141345860-141345882 GACAACTGAAGACACCCCCATGG + Intronic
966817553 3:183901453-183901475 GTCACCTGAAGACTCCCCTAGGG - Intergenic
967878232 3:194281191-194281213 GTCACCAGATGACACCCAGAAGG + Intergenic
968504803 4:966844-966866 ACCACCTCAGGACACCCGCGGGG + Intronic
970648921 4:18156438-18156460 GTCACATGAGGACAATCGCAGGG + Intergenic
972249190 4:37281250-37281272 GTCACACGAGGACACCCACTGGG - Intronic
973533146 4:51853087-51853109 GTCACTTCAGGACACCCGTCTGG - Intronic
977536412 4:98260815-98260837 GACACCTGAGGACGCCCGCTGGG - Intergenic
978405933 4:108378535-108378557 GTCTGCTGGGGACCCCCGCATGG + Intergenic
982139031 4:152299744-152299766 CTCCCCTGAGCACACCTGCATGG + Intergenic
983676172 4:170295951-170295973 GTCACCTGTGGACTCATGCAGGG + Intergenic
987865024 5:23526878-23526900 CTCACCAGAGGACACACACAGGG + Exonic
987865077 5:23527130-23527152 CTCACCAGAGGACACACACAGGG + Exonic
987865094 5:23527214-23527236 CTCACCAGAGGACACACACAGGG + Exonic
987865110 5:23527298-23527320 GACACCAGAGGACACACACAGGG + Exonic
987865126 5:23527382-23527404 GACACCAGAGGACACACACAGGG + Exonic
987865142 5:23527466-23527488 GTCACCAGAGGACACACACAGGG + Exonic
987865158 5:23527550-23527572 GACACCAGAGGACACACACAGGG + Exonic
987865174 5:23527634-23527656 GACACCAGAGGACACACACAGGG + Exonic
987865190 5:23527718-23527740 ATCACCAGAGGACACACACAGGG + Exonic
989172292 5:38484193-38484215 GTACCCTGAGGAGACCAGCAGGG - Intronic
990955220 5:61333059-61333081 GGCCAGTGAGGACACCCGCAGGG - Intronic
995646832 5:114321868-114321890 ATCACCTGAGGTCACCAACATGG - Intergenic
1001464539 5:171951689-171951711 ATCACCTGAGGTCACCAACATGG - Intronic
1005206133 6:23407198-23407220 GTCAACTGAGGACACAGACAGGG - Intergenic
1006794699 6:36724375-36724397 ATCACCTGAGGTCACCAGCCTGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1014104566 6:117547783-117547805 GACACCTGAGGGCACCCGGGGGG + Intronic
1014783779 6:125594638-125594660 GACACCTGAGGACAGGGGCAAGG + Intergenic
1017935782 6:159003608-159003630 GTCATCTGAGGCCAGGCGCAGGG - Intergenic
1021887587 7:25155092-25155114 GTCACCTGAGGACCTCTACACGG - Exonic
1024245611 7:47467662-47467684 GTGACCTGAGGAAACCGCCATGG + Intronic
1032416159 7:131737082-131737104 GGGACCTGAGGACACCCAAAGGG + Intergenic
1035729837 8:1846116-1846138 GTCTCCCGAGGACACCCTCCTGG - Intronic
1039346305 8:36709491-36709513 GTCACCTGTGGCCACCTCCAAGG + Intergenic
1039346798 8:36713609-36713631 TTTACCTGAGGACACCCCCTGGG - Intergenic
1049444363 8:142623282-142623304 GTTTCCTGAGGACACCGGCCCGG - Intergenic
1057297996 9:93860635-93860657 GTAACCCGAGGACACACGGAGGG - Intergenic
1057351285 9:94300814-94300836 GGCACCAGAGGACACACACAGGG + Exonic
1057351306 9:94300898-94300920 GACACCAGAGGACACACACAGGG + Exonic
1057351323 9:94300982-94301004 GACACCAGAGGACACACACAGGG + Exonic
1058460721 9:105179929-105179951 CTCACCTAAGAACACCCTCATGG - Intergenic
1059395218 9:114030023-114030045 GTCTCCTGAGGACAACTGAAGGG - Intronic
1060413515 9:123415276-123415298 GTCACCAGAGGAAACACACAGGG + Intronic
1061934670 9:133850703-133850725 GTCACCTGGAGACACCTGCCAGG + Intronic
1062406831 9:136400662-136400684 GTCACCTGTGCACACCCTCTGGG + Intergenic
1191107695 X:56781950-56781972 GTCAGCTGATGACATCCTCAGGG + Intergenic