ID: 1108470983

View in Genome Browser
Species Human (GRCh38)
Location 13:50766708-50766730
Sequence CAGTTTAAACTCAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108470976_1108470983 24 Left 1108470976 13:50766661-50766683 CCTAGGGAATTGGCTTTCCAACT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG 0: 1
1: 0
2: 1
3: 32
4: 289
1108470975_1108470983 30 Left 1108470975 13:50766655-50766677 CCTAGGCCTAGGGAATTGGCTTT 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG 0: 1
1: 0
2: 1
3: 32
4: 289
1108470977_1108470983 7 Left 1108470977 13:50766678-50766700 CCAACTGTTCATGAGAAATCCCT 0: 1
1: 0
2: 2
3: 7
4: 185
Right 1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG 0: 1
1: 0
2: 1
3: 32
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108470983 Original CRISPR CAGTTTAAACTCAGGCAGGC AGG Intronic
900350614 1:2232778-2232800 CAGTTTACACTGAGGCAGAGAGG - Intronic
900890067 1:5443254-5443276 CAGTTCAAAGGCAGACAGGCGGG - Intergenic
901799689 1:11700915-11700937 CAGTTGTCCCTCAGGCAGGCGGG + Intronic
903471813 1:23592580-23592602 CAGTCTATTCTCAGCCAGGCTGG - Intronic
903709073 1:25308576-25308598 CAGCTTGAACTCAGTCATGCGGG - Intronic
903968472 1:27103907-27103929 TGATTTAAACCCAGGCAGGCTGG + Intronic
904247114 1:29195639-29195661 GAATTTGAACCCAGGCAGGCTGG + Intronic
904492871 1:30871270-30871292 CAGATTCAAGTCAGGAAGGCAGG - Intronic
905502623 1:38451715-38451737 CAGTGATGACTCAGGCAGGCTGG - Intergenic
906517916 1:46450473-46450495 CAGTCTGGACTCAGCCAGGCTGG - Intergenic
908054619 1:60270348-60270370 CAGTTTAAACTCAGGGAGTAGGG - Intergenic
908837740 1:68245010-68245032 AAGTTCAAACTCAGGCAGTCTGG - Intergenic
911693224 1:100859013-100859035 CTGGCTAAACTCAGGCAGTCTGG + Intergenic
911782227 1:101896188-101896210 CAGTTTAAATTCAGGAAAGCAGG - Intronic
912674479 1:111664753-111664775 CGATTTAAACTCAGGCAACCTGG - Intronic
915484358 1:156210050-156210072 GAATTCAAACTCAGGCAGTCAGG + Intronic
916146316 1:161743361-161743383 CAGTTTGACCTCCGGGAGGCTGG - Intergenic
918396139 1:184115000-184115022 CAGTTCAAAGGCAGTCAGGCAGG + Intergenic
918590228 1:186232720-186232742 CAGTTCAAAGGCTGGCAGGCAGG + Intergenic
919265486 1:195259030-195259052 CAGTCTAAACTCAAGGAGGTGGG - Intergenic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
921705379 1:218316569-218316591 CATTTTGAACTCAGGCAGTCTGG - Intronic
922927386 1:229361256-229361278 CAGATTAAAGTCAGCCAAGCTGG - Intergenic
924932016 1:248740316-248740338 CAGGGAAAACTCAGGCAGGGAGG - Intronic
924940750 1:248811352-248811374 CAGGTTACACACGGGCAGGCTGG + Exonic
1064469669 10:15623279-15623301 AAGTTTAAACCCAGGCAGTCTGG + Intronic
1064507696 10:16050981-16051003 CAATTTCAACCCAGACAGGCCGG - Intergenic
1064920706 10:20514701-20514723 GAATGTCAACTCAGGCAGGCTGG - Intergenic
1066758147 10:38730664-38730686 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1066963540 10:42242043-42242065 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1070435534 10:76388915-76388937 GACTTCAAACTCAGGCAGTCTGG + Intronic
1070529988 10:77328312-77328334 CACTAAAATCTCAGGCAGGCAGG + Intronic
1070568544 10:77622408-77622430 CAGTTTAAATCCAGGCAGGTGGG - Intronic
1071614052 10:87058202-87058224 CATTTAAAACTCAGTCAGGAAGG + Intronic
1073488711 10:103838471-103838493 AAATTTGAACTCAGGCAGTCTGG + Intronic
1075068779 10:119307229-119307251 GGGTTTAAACCCAGGCAGTCTGG + Intronic
1075811441 10:125227565-125227587 CAATTTAAGCTCAGGGAGTCTGG - Intergenic
1076277043 10:129209643-129209665 CTGTTTACACTCAGGCAGCGGGG + Intergenic
1076285178 10:129288742-129288764 CAAGTGCAACTCAGGCAGGCTGG + Intergenic
1077827210 11:5824238-5824260 GAATTTAAACCCAGGCAGTCTGG + Intronic
1078440341 11:11359825-11359847 CATTTTAAAACCAGTCAGGCTGG + Intronic
1078664984 11:13316681-13316703 CAGTTGAAGCTCAGCCAGCCTGG - Intronic
1079105979 11:17572710-17572732 CAATTTGAATTCAGGCAGTCAGG - Intronic
1079266606 11:18939099-18939121 CAGTTGAAACTCACACAGTCTGG + Intronic
1079336178 11:19572661-19572683 GAGTTCAAACTCAGACAGACTGG - Intronic
1079436151 11:20453182-20453204 CAGTTAAAAATCAGGCCGGCTGG + Intronic
1082082337 11:48021956-48021978 GGGTTTGAACTCAGGCAGCCAGG - Intronic
1083690501 11:64405525-64405547 CAGTTTTAACCTAGGCAGTCCGG - Intergenic
1083949438 11:65945929-65945951 CAGATGAAACTCAGGGAGGCAGG + Intronic
1087006445 11:93476665-93476687 GATTTTAAACCCAGGCAGCCTGG - Intergenic
1088405847 11:109477608-109477630 CAGTTTAAAATCTGCCAGGGTGG + Intergenic
1089926942 11:122268665-122268687 AAATTCAAACCCAGGCAGGCTGG + Intergenic
1091535668 12:1406248-1406270 GAGTTTAAACTCAGGCAATTTGG + Intronic
1094231954 12:28115769-28115791 CAGTTTGAAAGCAGTCAGGCAGG + Intergenic
1095490360 12:42727064-42727086 CAGTTGAAACTCAGTGAGGGAGG - Intergenic
1096367827 12:51043645-51043667 GAATTTGAACCCAGGCAGGCTGG - Intergenic
1096526561 12:52213437-52213459 CAGCTTGAACTCAGGGAGGCGGG - Intergenic
1096601803 12:52735079-52735101 AAGCTTAAACTCGGGCAGTCTGG + Intergenic
1097602672 12:61713780-61713802 AAGTTTAAATTCTGGCATGCTGG + Intronic
1098399474 12:70058399-70058421 CAGTTAAAAGTCAGGCAGTTAGG + Intergenic
1100599599 12:96101858-96101880 AAGTTTAAACTCAGGTAGTTTGG + Intergenic
1100796147 12:98183792-98183814 GAGTTTGAAATCAGGCAGTCAGG + Intergenic
1100805151 12:98275628-98275650 CAGACTAAAATCAGGCTGGCTGG - Intergenic
1101003419 12:100378738-100378760 CAGTATAAATGCAGGCCGGCAGG + Intronic
1102254456 12:111407497-111407519 CTGTTTCCACTCAGGCAGCCAGG - Intronic
1102576091 12:113856962-113856984 GGGTTCAAACTCAGGCAGTCTGG + Intronic
1103734922 12:123054634-123054656 CAGTTTGAACTCAGGCAAAAAGG - Intronic
1104373411 12:128243748-128243770 CAGTACAAACCCAGGGAGGCAGG - Intergenic
1104586741 12:130053806-130053828 TAATTCAAACACAGGCAGGCTGG + Intergenic
1104641958 12:130473096-130473118 CTGTTAAAACTCAGCCAAGCTGG + Intronic
1105534724 13:21254793-21254815 CAGGTTAAACCCAGGCAGTCTGG - Intergenic
1106247128 13:27960257-27960279 AAGTTAAAACTAAGTCAGGCAGG - Intergenic
1107574096 13:41698070-41698092 CAATTTAAAATAAGGCAGGCAGG - Intronic
1107672883 13:42764563-42764585 GGGTTTAAACGCAGGCAGCCTGG - Intergenic
1107964581 13:45587625-45587647 CAGTTTAAAATCAAGCAGTGAGG + Intronic
1108317656 13:49253476-49253498 GAGTCTGAACCCAGGCAGGCTGG - Intronic
1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG + Intronic
1110461008 13:75745761-75745783 CAGTTCAAACTCCAGCAGTCAGG - Intronic
1110958679 13:81591998-81592020 TAGTTCAAACACAGGCAGGTAGG - Intergenic
1113412007 13:110098412-110098434 TAGTTCAAACGCAGCCAGGCAGG - Intergenic
1113736264 13:112680692-112680714 CAGTTTACAGACAGGCAAGCAGG + Intronic
1115334575 14:32231956-32231978 GAATTCAAACCCAGGCAGGCTGG - Intergenic
1116041613 14:39692846-39692868 CAGTTTGAAGGCAGGCAGGCAGG + Intergenic
1116531025 14:45973777-45973799 CAGTTGAAAGGCAGTCAGGCAGG - Intergenic
1116655625 14:47650140-47650162 CAGTTTGAAGGCAGTCAGGCAGG - Intronic
1118289926 14:64510329-64510351 GAATTTAAACCCAGGCAGTCTGG + Intronic
1118627027 14:67669184-67669206 GAATTTAAACTCAGGCAATCTGG + Intronic
1118814303 14:69299058-69299080 CAGTTGAGACTGAGGCAGACAGG + Intronic
1119609110 14:76046737-76046759 CACTTTAAACTCTGCCAAGCTGG - Intronic
1120189431 14:81427113-81427135 CAATTCAAACCCAGGCAGTCTGG + Exonic
1121331092 14:93050257-93050279 CAGCTGAGACTCAAGCAGGCAGG + Intronic
1121696912 14:95921064-95921086 CAGCTTGAAGGCAGGCAGGCAGG + Intergenic
1121817960 14:96942987-96943009 CAGTTTGAACCCAGGCAGCCTGG + Intergenic
1121857285 14:97281851-97281873 CAGTCCAAAAGCAGGCAGGCTGG + Intergenic
1124659865 15:31538378-31538400 CAGTTTAAGCTCCTGCTGGCTGG + Intronic
1126359012 15:47826442-47826464 CAGTTTAAAATCAGTCATGGTGG - Intergenic
1128304068 15:66586643-66586665 CAGCGTGGACTCAGGCAGGCTGG + Intronic
1128700094 15:69797663-69797685 GATTTTAAACTCAGGCAGTCTGG - Intergenic
1130355805 15:83129427-83129449 CTGTTTATTCTGAGGCAGGCAGG - Exonic
1130375922 15:83328515-83328537 GAGTGTAAACCCAGGAAGGCTGG - Intergenic
1132038864 15:98507873-98507895 CTGAGTAAGCTCAGGCAGGCTGG + Intronic
1132993298 16:2808546-2808568 AAATTCAAACCCAGGCAGGCAGG - Intergenic
1133678132 16:8095197-8095219 CAGTTCAAAGGCAGGCAGGCAGG + Intergenic
1136719652 16:32310125-32310147 TAGTGGAAACTGAGGCAGGCAGG + Intergenic
1136724684 16:32348522-32348544 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1136843011 16:33554562-33554584 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1138060917 16:53889409-53889431 AGGTGGAAACTCAGGCAGGCTGG + Intronic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1139044689 16:63042312-63042334 CAGTTTAAAATCTGTAAGGCAGG - Intergenic
1140349308 16:74246785-74246807 CAGTTTGAAGACAGTCAGGCAGG - Intergenic
1140435037 16:74940014-74940036 AAATTTGAACCCAGGCAGGCTGG - Intronic
1141498442 16:84426501-84426523 GAATTTAAACAGAGGCAGGCTGG - Intronic
1203001746 16_KI270728v1_random:169233-169255 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203006779 16_KI270728v1_random:207644-207666 TAGTGGAAACTGAGGCAGGCAGG - Intergenic
1203133349 16_KI270728v1_random:1705639-1705661 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203153176 16_KI270728v1_random:1854860-1854882 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1143981870 17:10877205-10877227 CAGCTGAAATTCAGCCAGGCAGG + Intergenic
1147676564 17:42210623-42210645 TAGGTAAAACTCAGGTAGGCGGG - Intronic
1152991270 18:365936-365958 AAGTTTATACACAGCCAGGCTGG + Intronic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1157681124 18:49607902-49607924 CAGTTTTTACACAGACAGGCAGG + Intergenic
1159381591 18:67666940-67666962 AAGTTTGAACCCAGGCAGTCTGG + Intergenic
1162083733 19:8235736-8235758 AATTTTAAAATTAGGCAGGCTGG + Intronic
1162352016 19:10156336-10156358 CACTTTAAAAACAGCCAGGCAGG - Intronic
1162927820 19:13938844-13938866 AGGTTCAAACCCAGGCAGGCTGG - Intronic
1164854663 19:31511593-31511615 CAGTTAAAAGCCAGGCAGGTAGG - Intergenic
1164908719 19:31988181-31988203 CAGTTTGAAGGCTGGCAGGCAGG - Intergenic
1165479930 19:36056744-36056766 AAGTTTAAGCTCAGGCTGCCTGG - Intronic
1165813028 19:38623761-38623783 AAGTTTAAACCGAGGCAGTCTGG + Intronic
1167574439 19:50311278-50311300 CAGTTTGAACCCAGACAGTCTGG + Intergenic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927477574 2:23425698-23425720 CAGTCTAATCTAAGGCAAGCTGG - Intronic
928085778 2:28345397-28345419 CAGGTTTGACTCAGGCCGGCTGG - Intergenic
928816400 2:35299956-35299978 AAATTTAAATTCAGGCAGTCTGG + Intergenic
929113350 2:38423766-38423788 CAGTTCAAAGGCAGTCAGGCAGG - Intergenic
930271361 2:49261490-49261512 CAGTTTGAACCTAGGCAGCCTGG - Intergenic
931823798 2:65978686-65978708 CAGCTTTAACACAGGCTGGCTGG + Intergenic
932096169 2:68850803-68850825 GAATTCAAACCCAGGCAGGCTGG + Intergenic
932131413 2:69190681-69190703 CAGTACAAACTGGGGCAGGCTGG + Intronic
932425850 2:71634685-71634707 AGGTTTAAACTTAGGCAGTCTGG + Intronic
933378206 2:81508302-81508324 CAGTTTGAAAGCAGTCAGGCAGG + Intergenic
934529888 2:95078390-95078412 CGGTTGACACCCAGGCAGGCTGG - Intergenic
934751836 2:96798839-96798861 CTGTTCAAGCCCAGGCAGGCAGG + Intronic
936784499 2:116077754-116077776 CAGCTAAAAGTCTGGCAGGCAGG + Intergenic
937373312 2:121317673-121317695 CATTTTCAACTCATGCAGGGTGG - Intergenic
940237641 2:151528130-151528152 GAATTTAAACCCAGGCAGTCTGG + Intronic
940404380 2:153283965-153283987 CAATTTAAGCTCAGGAAGGATGG + Intergenic
940868367 2:158838899-158838921 CACTTGAAAATCAGGAAGGCTGG - Intronic
941170293 2:162127701-162127723 GACTTTAAAATCAAGCAGGCTGG - Intergenic
941320544 2:164049005-164049027 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
943236028 2:185320966-185320988 CATTTTAAACTCACAGAGGCTGG - Intergenic
943360217 2:186910289-186910311 GAATTTAAACTCAAGCAGACTGG - Intergenic
943489994 2:188540044-188540066 CAGTTTCATCTAAGGAAGGCTGG - Intronic
944299418 2:198106192-198106214 AATTTTAAGCTCAGGCAGTCTGG + Intronic
945920014 2:215746383-215746405 CAGTTCAAAGGCAGTCAGGCAGG - Intergenic
947024409 2:225720678-225720700 CAGTTTGAAGGCAGTCAGGCAGG + Intergenic
947232298 2:227900830-227900852 CACTTTTAACTCAGGCAGCTGGG - Intronic
947671526 2:231939581-231939603 CAGATTAAACCCAGGTGGGCTGG + Intergenic
1168917979 20:1506903-1506925 GAGTTTGAACCCAGGCAGTCTGG - Intergenic
1169410592 20:5366367-5366389 GAGGTTAAACTAAGGCAGACAGG - Intergenic
1170010683 20:11719309-11719331 CAGTGTAGAATCAGGCAGGCTGG - Intergenic
1170574995 20:17655640-17655662 CAGTGTAAACTGTGGCAGCCAGG - Intronic
1173010989 20:39181837-39181859 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
1173214779 20:41070842-41070864 GGATTTAAACTCAGGCAGTCTGG - Intronic
1173284414 20:41657234-41657256 GAATTTGAACTCAGGCAGTCTGG - Intergenic
1174264211 20:49319556-49319578 TGGTTAGAACTCAGGCAGGCGGG + Intergenic
1174515705 20:51090854-51090876 CAGTTCAAACCCAGGCAGGCAGG - Intergenic
1174544570 20:51315729-51315751 GAGTTTAAAATCAGAAAGGCTGG + Intergenic
1174594252 20:51670759-51670781 AAGCTTTAACTCAGGCAGTCAGG - Intronic
1174703296 20:52631046-52631068 AGGTTTAAACCCAGGCAGTCTGG - Intergenic
1175325725 20:58127138-58127160 GAGTTTAAACTCAGTCTGTCTGG + Intergenic
1177549110 21:22597987-22598009 GAATTCAAACGCAGGCAGGCGGG - Intergenic
1177820614 21:26027377-26027399 CAGTTTAGACTCTGGCAGTTTGG - Intronic
1178370162 21:32020812-32020834 CACTGAAAACTCAGGCAGGAGGG - Intronic
1179068153 21:38045874-38045896 CAGGATAAACTCAGGAAGGGAGG + Intronic
1180309717 22:11159073-11159095 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1180548194 22:16520883-16520905 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1182066257 22:27433786-27433808 CAGATAAAGCTCAGCCAGGCAGG + Intergenic
1182503119 22:30762986-30763008 CGATTTGAACCCAGGCAGGCTGG - Intronic
1182861156 22:33560619-33560641 CAGTAAAAACTAAGGCATGCAGG + Intronic
1183985364 22:41566978-41567000 GGATTTAAACTCAGGCAGTCTGG + Intronic
949963734 3:9337113-9337135 CAGTTCAAAGTCAGTCAGGCAGG + Intronic
952427613 3:33191646-33191668 GAATTTACACTCAGGCTGGCTGG + Intronic
953844424 3:46416131-46416153 CAGTGTAAACTTAATCAGGCGGG + Intergenic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
956029667 3:65024010-65024032 CAGGTGAATCTCAGGCAGGGAGG + Intergenic
960389984 3:117065508-117065530 AAATTTAAACTCAGGCAGTCTGG + Intronic
960714741 3:120563777-120563799 CTGCTTAAACTCAGCCAGGCAGG - Intergenic
960767264 3:121147839-121147861 CAGTTCAAAAGCAGTCAGGCAGG - Intronic
961228061 3:125271901-125271923 AAGTTAAAACTGAGGCAGACCGG - Intronic
961489274 3:127241512-127241534 CAGTTCAAACGCAGTCAGACAGG - Intergenic
961569611 3:127788409-127788431 GAATTTTAACTCAGCCAGGCTGG + Intronic
961950942 3:130748167-130748189 ATGTTTAAAATCAGGCAGGCTGG - Intergenic
963281219 3:143386268-143386290 CTGTTTATACCCAGGCATGCAGG + Intronic
964284430 3:155102090-155102112 CATTTTAAAGTCATGTAGGCAGG - Intronic
964441521 3:156716369-156716391 AAGTTTAAACTCAAGCAGTTTGG + Intergenic
967984211 3:195083276-195083298 CAGTTTACACACAGGTAGACAGG - Intronic
968425336 4:519480-519502 CAAATGAAACTCAGGCAGTCTGG - Intronic
968740363 4:2326454-2326476 CAGTTTAAAATCAGGTAGTGTGG + Intronic
971066602 4:23039817-23039839 CAGTTTAAAGGTGGGCAGGCTGG + Intergenic
971470219 4:27017116-27017138 CAGTTGAGACTCATGCAGGTGGG - Intronic
971678232 4:29663770-29663792 CAGCTTGAAGGCAGGCAGGCAGG - Intergenic
974284684 4:59848576-59848598 CAGTCTGAAGTCTGGCAGGCTGG + Intergenic
975315305 4:72945446-72945468 CAGATTCAACCCAGGCAGGTTGG - Intergenic
976321029 4:83715771-83715793 CAGTTCAAAAGCAGTCAGGCAGG - Intergenic
976427045 4:84916530-84916552 CAGTTTGTACTCAGGCAGGAGGG + Intronic
976820133 4:89196934-89196956 GAGTTTAGACTCAGACAGTCTGG + Intergenic
978163959 4:105584558-105584580 GAGTTTGAACCCAGGCAGTCTGG + Intronic
979277532 4:118830219-118830241 CAGTTTAAACTAAAGCATGAAGG + Intronic
980011324 4:127597867-127597889 CAGTGAAGAGTCAGGCAGGCAGG + Intergenic
981035898 4:140168657-140168679 CAGTTTGAAGGCAGTCAGGCAGG - Intergenic
981219772 4:142217859-142217881 CAGTTTGAAGGCAGTCAGGCAGG - Intronic
984810094 4:183788386-183788408 CAGTTCAAGCCCAGGCAGTCTGG - Intergenic
985015789 4:185634038-185634060 CATTTTATAGCCAGGCAGGCAGG - Intronic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
986637308 5:9835835-9835857 CAGTTTTAACTCAGCCACCCTGG - Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988126010 5:27038607-27038629 CACTTTTAACTCAGACAGGCAGG + Intronic
988415519 5:30942207-30942229 CAGTTGAAAATCATGGAGGCTGG - Intergenic
989459710 5:41683426-41683448 AAGTTATAACACAGGCAGGCTGG - Intergenic
991385015 5:66077541-66077563 GAATTTAAACTCAGGCAGTCTGG - Intronic
993912308 5:93698481-93698503 CAGTTTCAAATGAGGCAGTCAGG + Intronic
995625073 5:114067347-114067369 CAGTTTCAACTGAGCCAGTCTGG - Intergenic
997268150 5:132510735-132510757 CAGTTCAAAGATAGGCAGGCAGG - Intergenic
997423486 5:133787353-133787375 TCCTTTAAACCCAGGCAGGCTGG - Intergenic
997456164 5:134019035-134019057 CAGATTAAAATCAGCCAAGCGGG - Intergenic
998639642 5:143995226-143995248 CAGTTTAGATCCAGGCAGTCTGG + Intergenic
1000269116 5:159666467-159666489 CAATTTGAACCCAGGCAGCCTGG + Intergenic
1001220756 5:169898384-169898406 GATTTTAAACCCAGGCAGCCTGG - Intronic
1001521379 5:172396019-172396041 CAGATCAAGCTCGGGCAGGCAGG + Intronic
1003207176 6:4023429-4023451 CCATTTAAACTCAGGCAGTCTGG + Intronic
1003376564 6:5583762-5583784 CAGGTTAAACCCAGGCAGTCTGG + Intronic
1005241954 6:23840329-23840351 GATTTTAGACTCAGGCAGCCAGG + Intergenic
1006423348 6:33949069-33949091 GAGTTTAAAGTCAGGAAGCCTGG + Intergenic
1006544436 6:34767989-34768011 AAGTTTAAACTTACGAAGGCTGG - Exonic
1007474360 6:42108867-42108889 CAGTTTGAAGTCAGGCAGCTGGG - Intronic
1007913123 6:45535812-45535834 CAATGTAAACCCAGGCAGGAAGG + Intronic
1010701261 6:79050432-79050454 AGGTTTAAACTCAGGCAGTCTGG + Intronic
1011118178 6:83919661-83919683 CATTTGGAACTCAGGCAGTCTGG + Intronic
1011224118 6:85088195-85088217 GGATTCAAACTCAGGCAGGCTGG + Intergenic
1012275676 6:97272579-97272601 GAATTTCAACTCAGGCAGTCAGG + Intronic
1012655239 6:101809252-101809274 GCCTGTAAACTCAGGCAGGCAGG - Intronic
1012997300 6:105986310-105986332 CAGACTAGAGTCAGGCAGGCAGG - Intergenic
1013639467 6:112059139-112059161 CTGATTTAAATCAGGCAGGCAGG - Intronic
1015369832 6:132438122-132438144 AGTTTTAAACTCAGGCAGTCTGG - Intergenic
1017253715 6:152309830-152309852 CAGTGTAACATCATGCAGGCAGG - Exonic
1017693535 6:156991139-156991161 CAGTTTCAACCCTGGCAGTCTGG + Intronic
1019021900 6:168925852-168925874 CCGTGAAAACACAGGCAGGCCGG + Intergenic
1019644669 7:2122672-2122694 CAGGTGAGACTCAGGCAGGAAGG + Intronic
1019763157 7:2829222-2829244 CAGTTTAAAATCAGGCACACAGG + Intronic
1019924723 7:4184629-4184651 CTGTTTAAACTCAGAGAGGAAGG + Intronic
1020741375 7:12023203-12023225 CAGGTTCAGCTCAAGCAGGCAGG + Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1023312544 7:38902648-38902670 CAGCACAAACTCAGGCAGGCAGG - Intronic
1023993837 7:45146639-45146661 CAGTATGAACGAAGGCAGGCCGG + Intergenic
1024296410 7:47846484-47846506 CAGTTTGTAGTCAGGCAGGTGGG - Intronic
1025062596 7:55823507-55823529 AAGCTTTAACACAGGCAGGCTGG + Intronic
1027538306 7:79434948-79434970 CAGTTTGAAGGCAAGCAGGCAGG - Intronic
1027986314 7:85295512-85295534 GAGTTTAAATTCAGGTAGGTGGG + Intergenic
1028315884 7:89402405-89402427 CAGTTTAATTTCAAGGAGGCTGG - Intergenic
1028656534 7:93214907-93214929 GAGTTTAAAGACAGGCAGGTAGG + Intronic
1028909754 7:96194906-96194928 GAGTTTCAGCTGAGGCAGGCTGG - Intronic
1030724358 7:112908314-112908336 CAGTTCAAAGGCAGTCAGGCAGG - Intronic
1031368622 7:120935954-120935976 CAGTTAAATCTCAGGCAGTTTGG + Intergenic
1031517017 7:122713285-122713307 GGATTTAAACTCAGGCAGTCTGG - Intronic
1031586773 7:123539978-123540000 AAGTTTGAACCCAGGCAGTCTGG - Exonic
1032064714 7:128758526-128758548 GAGTTCAAACTCAGGCAGTATGG + Intronic
1034695106 7:153046384-153046406 CAGCTCAAAAGCAGGCAGGCAGG - Intergenic
1036052010 8:5209456-5209478 GAGTTTAAACTCAGGCAGAGAGG + Intergenic
1036581572 8:10080388-10080410 TAGTTGAAACTCAGGCAGTTTGG + Intronic
1036727648 8:11233748-11233770 GAGTTTGATCTCAGGCAGTCTGG - Intergenic
1037549226 8:19953886-19953908 CAGTTTCCACTCAGGATGGCTGG - Intronic
1037587781 8:20289768-20289790 CTTGTTAAACTCAGGCAGCCTGG - Intronic
1037960521 8:23094451-23094473 CAGTATCAACTCAGGAATGCTGG + Intronic
1040705366 8:50120036-50120058 CATTTTTAACTCAGGAAGACTGG - Intronic
1040816288 8:51511635-51511657 CAGGCCAGACTCAGGCAGGCAGG + Intronic
1042792757 8:72626710-72626732 CAATTTTAATTCAGGCAGTCTGG + Intronic
1043052874 8:75404710-75404732 CAGTTTACACGCAGGAAGGGGGG - Intergenic
1043150624 8:76710876-76710898 CAGTTTCAAGTCAAGCAGCCAGG - Intronic
1044467078 8:92520027-92520049 CAGGTTAATCACAGACAGGCTGG - Intergenic
1045180426 8:99775599-99775621 CAGATTTAACTCATACAGGCTGG + Intronic
1045449146 8:102302851-102302873 CAGTTCAAACTCAGGGCTGCCGG - Intronic
1045469027 8:102494696-102494718 GAGTTTAAACCCAGGAAGTCTGG - Intergenic
1045802461 8:106117571-106117593 CAGTCTAGAGGCAGGCAGGCAGG + Intergenic
1047861250 8:128969781-128969803 CAGTTCAAAGACAGTCAGGCAGG + Intergenic
1047878558 8:129168035-129168057 CAGGTTAAACTAAGGCAGCTGGG + Intergenic
1048607273 8:135982563-135982585 CAGTGGAAACCCAGGCAGGTGGG + Intergenic
1048864224 8:138747669-138747691 CTGTTTATATTCTGGCAGGCCGG - Intronic
1049287829 8:141786104-141786126 CAGATCGAACCCAGGCAGGCTGG - Intergenic
1050663062 9:7904968-7904990 CAGTATGAACCCAGGCAGCCTGG + Intergenic
1051440980 9:17082540-17082562 CAGTGAAAGTTCAGGCAGGCCGG + Intergenic
1051612858 9:18978453-18978475 GAGTTTGAGCTCAGGCAGGAAGG - Intronic
1052867433 9:33473141-33473163 TAGTGTAAACTGAGGCAGTCAGG - Intronic
1053549149 9:39057169-39057191 GAATTTGAACTCAGGCAGTCTGG - Intergenic
1053813276 9:41877253-41877275 GAATTTGAACTCAGGCAGTCTGG - Intergenic
1054617319 9:67310186-67310208 GAATTTGAACTCAGGCAGTCTGG + Intergenic
1055820525 9:80256475-80256497 CAGTTTAATCTTAGGCATTCTGG + Intergenic
1056070248 9:82978884-82978906 CAGGTTCAAACCAGGCAGGCTGG + Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057977570 9:99622541-99622563 CAGTTCTAACTCAGGCCAGCAGG - Intergenic
1059526467 9:114995630-114995652 AAATTTAAACTCAGGCAGGGAGG + Intergenic
1060143667 9:121232756-121232778 CAGTTAGGTCTCAGGCAGGCCGG + Intronic
1060671314 9:125472100-125472122 CAATTTGAACTCAGGAAGTCTGG + Intronic
1060728759 9:126023794-126023816 CAGTTGTAACCAAGGCAGGCAGG - Intergenic
1061322737 9:129841500-129841522 CAGTCCACACTCAGGCATGCTGG + Intronic
1062386149 9:136312310-136312332 AAGTTAAAACTTAGCCAGGCTGG + Intergenic
1186117782 X:6323220-6323242 CATTTTTAGCTGAGGCAGGCGGG + Intergenic
1187241289 X:17515843-17515865 CAATTGGAACTCAGGCAGTCTGG + Intronic
1188087400 X:25916853-25916875 GAATTTGAACCCAGGCAGGCTGG - Intergenic
1188573321 X:31616097-31616119 CGATTTAAACTCAGGCAGTCGGG + Intronic
1189052279 X:37658407-37658429 CAGTTCAAAGACAGTCAGGCAGG + Intronic
1190246814 X:48696383-48696405 CATTTTAACCCCAAGCAGGCCGG - Intronic
1190631042 X:52386416-52386438 CAGATCAAAATCAGGTAGGCAGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1190761875 X:53443680-53443702 GACTTCAAACTCAGGCAGTCTGG + Intergenic
1192176537 X:68889698-68889720 GGGTTCAAACCCAGGCAGGCTGG + Intergenic
1192233601 X:69282504-69282526 GATTTTGAACTCAGGCAGTCTGG + Intergenic
1193902679 X:87202276-87202298 CAGCTTAAAGGCAGTCAGGCAGG - Intergenic
1198868760 X:141154013-141154035 CAGTTTGAAGGCAGTCAGGCAGG + Intergenic
1201188947 Y:11430229-11430251 CCGTGGAAACTGAGGCAGGCAGG - Intergenic