ID: 1108478374

View in Genome Browser
Species Human (GRCh38)
Location 13:50843214-50843236
Sequence GCTGCTGGGGCCCCTCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108478374_1108478381 22 Left 1108478374 13:50843214-50843236 CCTGCTGGAGGGGCCCCAGCAGC 0: 1
1: 0
2: 2
3: 75
4: 422
Right 1108478381 13:50843259-50843281 CCGAAGTCGAGTCCACCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 15
1108478374_1108478382 23 Left 1108478374 13:50843214-50843236 CCTGCTGGAGGGGCCCCAGCAGC 0: 1
1: 0
2: 2
3: 75
4: 422
Right 1108478382 13:50843260-50843282 CGAAGTCGAGTCCACCACGCGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108478374 Original CRISPR GCTGCTGGGGCCCCTCCAGC AGG (reversed) Exonic
900360596 1:2287077-2287099 GCTGCTGTGGGGCCTGCAGCTGG - Intronic
900367165 1:2315992-2316014 CCTGCTAGGGCCCCACCTGCCGG - Intergenic
900391835 1:2436992-2437014 GCTGCTGGGGCCCCTCCCCGGGG + Intronic
900394211 1:2446481-2446503 CCTCCTGGGACCCCTGCAGCTGG - Intronic
900600249 1:3499803-3499825 GCAGAAGGTGCCCCTCCAGCCGG + Exonic
900606519 1:3525999-3526021 GCTGCTGGGCCCCTGCCAGCTGG + Intronic
900644342 1:3702277-3702299 GTAGCTGGGCCCCCTCCAGGAGG - Intronic
900659125 1:3774159-3774181 TTTGCTGGGCCCCCTCCAGCGGG - Intronic
901027864 1:6288486-6288508 TCAGCTTGAGCCCCTCCAGCTGG - Intronic
901216526 1:7558370-7558392 GCTCCTGGGTCCCATCCAGAGGG - Intronic
901627306 1:10631509-10631531 GCTCCAGGGGTCCCTCCAGCAGG - Intergenic
902081024 1:13820751-13820773 GCTGCTGTGGCCTCCCCAGAGGG + Intronic
903068016 1:20711603-20711625 CCTGAGGGGGCCTCTCCAGCGGG - Intronic
903189532 1:21649025-21649047 GCTGCTGCTTCACCTCCAGCAGG - Intronic
903513037 1:23890794-23890816 GCAGCAGGGGCCCAGCCAGCTGG - Intronic
904258518 1:29273008-29273030 GATGCTGAGGTCCCTCTAGCTGG + Intronic
904317098 1:29672651-29672673 GCAGGTGGGGCCCCTGAAGCTGG - Intergenic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904462623 1:30689252-30689274 CCTGCTGGGGCACCACCAGTAGG + Intergenic
904743324 1:32695302-32695324 CCTGCTGGCGGCACTCCAGCTGG + Exonic
905414369 1:37794351-37794373 GCTGCCGGGGCCCTGGCAGCGGG - Exonic
906671109 1:47655689-47655711 CCTGCTGGAGCTCCTCCAGCTGG + Intergenic
909548017 1:76868574-76868596 GCTGCGGGGGCCGCTCCTTCTGG - Exonic
911491595 1:98575785-98575807 GCTGCTGGTGTCCCTTCTGCTGG + Intergenic
911605361 1:99898701-99898723 GCTTCTGGGGCCTCTCCAGGAGG + Intronic
914463726 1:147908378-147908400 TCAGCAGGGTCCCCTCCAGCCGG - Exonic
915242913 1:154536668-154536690 GCTGCTGGGGGCCCTGAAGGGGG - Intronic
915300014 1:154946443-154946465 GCTGCTGGGGTCTGTACAGCAGG - Exonic
915904719 1:159869371-159869393 GCTGCTGAGTCACATCCAGCTGG + Intronic
916834811 1:168532652-168532674 GCATCTGGGGCCTCTCCACCTGG - Intergenic
917878208 1:179306276-179306298 CTTGCTGGGGACCCTCCAGTGGG + Intronic
917920274 1:179744392-179744414 GCTGCTGGGACCCCGCCACCCGG + Intronic
920203573 1:204275602-204275624 CCTGCTGTGGCTCCTCCGGCTGG + Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
921065103 1:211617009-211617031 GCTGCTGTGGCACATCCAGTGGG + Intergenic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922057846 1:222058441-222058463 CTTGCCAGGGCCCCTCCAGCAGG + Intergenic
924624500 1:245687836-245687858 GCTGCTGGTGCCGCTGCCGCTGG - Exonic
1062964442 10:1596532-1596554 CCTGATGGGGCCTCTCCAGGGGG - Intronic
1065917319 10:30364738-30364760 GGGGCTGGGGCCCCTGGAGCAGG + Intronic
1067274060 10:44819053-44819075 GCTGCTGGCGAGGCTCCAGCTGG - Intergenic
1067721502 10:48731243-48731265 GCTGCAGGGTCCACTCCAGCAGG - Exonic
1070145627 10:73771760-73771782 AGTGTTGGGGCCTCTCCAGCTGG - Exonic
1070865512 10:79706158-79706180 ACTGCAGGGGCTCCTCCAGGCGG + Exonic
1070879306 10:79844289-79844311 ACTGCAGGGGCTCCTCCAGGCGG + Exonic
1071262970 10:83937873-83937895 GCTGCTGGCCCCCCTCCAAATGG + Intergenic
1071632412 10:87228379-87228401 ACTGCAGGGGCTCCTCCAGGCGG + Exonic
1071645865 10:87360597-87360619 ACTGCAGGGGCTCCTCCAGGCGG + Exonic
1072207802 10:93220566-93220588 CCTGCAGGGTCCCCACCAGCAGG + Intergenic
1074200968 10:111234879-111234901 GCTGCTGGCTCTTCTCCAGCAGG + Intergenic
1075084007 10:119401992-119402014 GCTCCTGTGGCCCCACCATCTGG + Intronic
1075091513 10:119446514-119446536 GCTGCTGCAGCCCCTGCAGAAGG + Intronic
1075244672 10:120810565-120810587 GCTGCTGGCAGCCTTCCAGCTGG - Intergenic
1075629546 10:123992528-123992550 GCTGTTGGTGCCCCTCCAATGGG - Intergenic
1076042950 10:127267052-127267074 GATGCTCTGGACCCTCCAGCAGG + Intronic
1076175573 10:128365275-128365297 GCTGGTGGGCGCCCTCCAGTTGG + Intergenic
1076187240 10:128459448-128459470 CCTGATGGGGACCATCCAGCAGG + Intergenic
1076209579 10:128629627-128629649 ACTGCAGGGGACACTCCAGCAGG - Intergenic
1076272119 10:129162917-129162939 GCTGCTGCGGGTCCTGCAGCAGG + Intergenic
1076544975 10:131239094-131239116 GCTGCTGAAGCCCAGCCAGCTGG + Intronic
1076681687 10:132175479-132175501 GCTGGTGGGGTCCCTTGAGCCGG + Intronic
1076699546 10:132264392-132264414 GCCGCAGGGACCCCTCGAGCTGG + Intronic
1076754617 10:132562808-132562830 GCTGCAGAGGCCCCTCGAGAGGG + Intronic
1077145027 11:1040866-1040888 GCTGCTGGGGTCCACCCTGCCGG + Intergenic
1077174092 11:1180908-1180930 CCTCGTGGGGCCCCTCCAGTCGG - Intronic
1077306503 11:1870986-1871008 GCTCCTTGGTCCCCTCCTGCGGG + Intronic
1077451702 11:2652161-2652183 TCTGCTGGGGCCCCACCCCCAGG - Intronic
1077469158 11:2748703-2748725 GCTGCTGCTGCCCCTCCCTCTGG + Intronic
1078003182 11:7513802-7513824 CCTGCTGGGACCCGTCCACCAGG - Exonic
1078467893 11:11563650-11563672 GCTGGTGGGGGCCCCACAGCCGG + Intronic
1078498108 11:11841376-11841398 GCCCCTGAGGTCCCTCCAGCTGG + Intergenic
1079096936 11:17517106-17517128 GCTGCTCTGGCCCCTCCCCCAGG - Intronic
1080417767 11:32084807-32084829 GCTGCTGTGGCCACTTCAGGAGG - Intronic
1081662690 11:44897573-44897595 GCACCTGAGGCCACTCCAGCGGG - Intronic
1082936273 11:58660177-58660199 GCTGCTGGGGCACTTACAGCAGG + Intronic
1083201614 11:61124207-61124229 GCTGCTGGGGACCCTAGAGATGG - Intronic
1083289615 11:61682535-61682557 CCTGCTTGGGCCACTCCTGCAGG - Intronic
1083459235 11:62799724-62799746 AGAGCTGGGGCCCCGCCAGCAGG - Intronic
1083642676 11:64153864-64153886 GCTGCAGGTCCCCCTCCACCAGG + Intronic
1083873557 11:65507427-65507449 GCTTCTGAGGCCCCTCCATTAGG - Intergenic
1083887912 11:65581651-65581673 GCCTCAGGGGCTCCTCCAGCAGG + Exonic
1083923272 11:65791700-65791722 GCTTATGGGTCCCCTCCTGCTGG - Intronic
1084044635 11:66561562-66561584 GCTGGTGGTCACCCTCCAGCCGG - Exonic
1084330171 11:68425511-68425533 GCTGCTTGGGGCCCCACAGCAGG + Intronic
1084358886 11:68657023-68657045 GCTGCTGGGACCCTCCCAGAAGG + Intergenic
1084590398 11:70086742-70086764 GCAGCTGGGGTCCGTCCTGCTGG - Intronic
1084726103 11:70943237-70943259 GCTGCTGAGCCACCTCCAACAGG - Intronic
1084979618 11:72822221-72822243 GCTGCACGAGCCTCTCCAGCAGG - Exonic
1085261854 11:75210267-75210289 GCAGCTGGGGACATTCCAGCTGG + Intergenic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1086955598 11:92931855-92931877 GCTGCTGGTGATCCTACAGCTGG + Intergenic
1088585083 11:111354521-111354543 GGTGCTCTGGGCCCTCCAGCGGG + Exonic
1089370527 11:117952548-117952570 GCTGCTGGGGACCCGAAAGCTGG - Intergenic
1089556491 11:119318250-119318272 TCTGCTGGCGCGCCTCCACCAGG + Intronic
1092099769 12:5873506-5873528 TGGGCTGGGGCCCATCCAGCAGG + Intronic
1092831312 12:12447244-12447266 TCTGCTGTGCCCCCTCCTGCTGG + Intronic
1096255936 12:50062534-50062556 GCTGCTGGGCCCCATCCAACAGG + Intronic
1096518723 12:52172316-52172338 GCTGCAGGGCGGCCTCCAGCTGG + Exonic
1096670876 12:53197649-53197671 GCTGCTGGGGCTCCCCTAGGGGG + Exonic
1098226686 12:68332077-68332099 GATTCTGGGGCCCCTCGAGCAGG + Intronic
1101092779 12:101304688-101304710 GCTGCTGAGCCCCCTGCAGTGGG + Intronic
1101131767 12:101697679-101697701 GGGGCTGGGGCCCCGGCAGCCGG + Exonic
1101414734 12:104499313-104499335 GCTTCTGGGGCCCCACTGGCTGG - Intronic
1101642857 12:106601167-106601189 GCAGCTGTGGCCTCTCCAGGGGG - Exonic
1101784959 12:107874746-107874768 GCTGCTGAGGCCCCTCCCCAGGG + Intergenic
1103264051 12:119614013-119614035 CCTGCAGGGGCCACTCCTGCAGG + Intronic
1103678508 12:122675619-122675641 GGTGCTGGGGCCCCTTCAGTGGG + Intergenic
1103927627 12:124432674-124432696 GCTGCTGGGGTCCTCACAGCTGG - Intronic
1104013548 12:124948234-124948256 GCTGCTGGGGGCCCGAAAGCAGG + Intronic
1104356132 12:128088684-128088706 GTTTCTGGGGCCTCTCCTGCTGG + Intergenic
1104665275 12:130643249-130643271 GCTGCTGTGGCCCGTGCACCCGG - Intronic
1104987835 12:132607030-132607052 GCAGCAAGGGCCCCTCCAGGAGG - Intronic
1105705575 13:22965815-22965837 GCTGCCTGGGCCCTGCCAGCTGG + Intergenic
1105837425 13:24223568-24223590 GGTTCTGGGGCGCATCCAGCAGG - Exonic
1105858480 13:24390800-24390822 GCTGCCTGGGCCCTGCCAGCTGG + Intergenic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106757611 13:32838546-32838568 GCTGCAGGGTCCCATCCAGCTGG + Intergenic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1111195745 13:84872406-84872428 GCTGCAGGGCCCCCATCAGCTGG - Intergenic
1111195746 13:84872409-84872431 GCTGATGGGGGCCCTGCAGCTGG + Intergenic
1112437884 13:99404610-99404632 GCTGCAGAGGGGCCTCCAGCAGG - Intergenic
1113037243 13:106063650-106063672 CATGCTGTGGCCCCACCAGCTGG + Intergenic
1113683601 13:112262206-112262228 GCTGCCCTGGCCCCTGCAGCCGG + Intergenic
1113710821 13:112464106-112464128 CCCGCAGGAGCCCCTCCAGCTGG - Intergenic
1113841265 13:113363096-113363118 GCTGCAGGGCCCCCTCCTCCGGG - Intronic
1118312793 14:64705539-64705561 CCTGCTGGGGCCCCCAGAGCAGG - Intronic
1118336140 14:64854920-64854942 GCTGCTGATGCCCCTCCAATGGG + Intronic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1119951661 14:78751781-78751803 GCTACTGCTGCTCCTCCAGCAGG - Intronic
1119956003 14:78798981-78799003 GCTTCTGGGGCACCTGCAGTTGG + Intronic
1121089432 14:91170938-91170960 GCAGCTGGGGCCTCTCTGGCAGG - Intronic
1122405855 14:101500658-101500680 GCTGCTGATGCCCGCCCAGCTGG + Intergenic
1122441903 14:101737614-101737636 TCTCCTGGGGCCCCTCCACAAGG - Intergenic
1122613563 14:103001687-103001709 GCTGCCGGGGCCGCTCCCTCTGG - Intronic
1122651886 14:103230852-103230874 GCAGCCAGGGCCCCTCCAGCAGG - Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1122771876 14:104101243-104101265 GCTGCTGGGGCCCCTGGGGAGGG + Intronic
1123113623 14:105884081-105884103 GCTGCAGAGGCCTCTCCAGGGGG - Intergenic
1123115848 14:105893720-105893742 GCTGCAGAGGCCTCTCCAGGGGG - Intergenic
1123120090 14:105912435-105912457 GCTGCAGAGGCCTCTCCAGGGGG - Intergenic
1123402828 15:20004021-20004043 GCTGCAGAGGCCTCTCCAGGGGG - Intergenic
1123512165 15:21010675-21010697 GCTGCAGAGGCCTCTCCAGGGGG - Intergenic
1124415441 15:29469829-29469851 CCTGCTGGGTCCCTTCCAGGAGG - Intronic
1124965273 15:34428793-34428815 GCTGCAGAGGCCTCTGCAGCAGG - Intronic
1125516508 15:40323996-40324018 GCCGCCAGGCCCCCTCCAGCCGG + Intergenic
1125729076 15:41882710-41882732 GCTGCAGGGTCTGCTCCAGCAGG + Exonic
1125748273 15:42012041-42012063 GCTACTGGAGCCACTCCTGCTGG + Intronic
1125756508 15:42069022-42069044 AAAGCAGGGGCCCCTCCAGCGGG - Intronic
1127738314 15:61869545-61869567 GGTGCTGTGGCCCGTCCAACTGG - Exonic
1128074519 15:64817975-64817997 GCAGCAGCTGCCCCTCCAGCTGG - Exonic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1128767345 15:70259266-70259288 GCTGCTGGGCCCCCTCTCCCAGG + Intergenic
1129002208 15:72344175-72344197 GTTGCTGGGGCCCCTTCTGAGGG - Intronic
1129364553 15:75046361-75046383 GCTGCTGCTGACCCGCCAGCAGG - Intronic
1129476340 15:75786628-75786650 GGGGCTGGGGCCCCTGGAGCGGG - Intergenic
1129703916 15:77783838-77783860 GGTGCTGGACCCACTCCAGCCGG + Intronic
1130247175 15:82262613-82262635 GCTGGTGGGGCTGCTGCAGCCGG - Exonic
1130453459 15:84080305-84080327 GCTGGTGGGGCTGCTGCAGCCGG + Intergenic
1130651778 15:85766228-85766250 GCGGCTGGGCTCCCTCCGGCAGG + Intronic
1132331321 15:101014161-101014183 GCTGCTGGGCCCCACACAGCTGG + Intronic
1132499920 16:280716-280738 GCTGCTGGAGCTGCTCCGGCTGG + Exonic
1132500278 16:281897-281919 GCTGCTGGGGCCCCTGCCACCGG + Exonic
1132612062 16:822121-822143 GCTGCCGGGGACCCTCCTGCAGG - Intergenic
1132754365 16:1475341-1475363 CCTGGGGGAGCCCCTCCAGCCGG - Exonic
1132903348 16:2270071-2270093 GACTCTGGGGCCCCTTCAGCAGG - Intergenic
1133001834 16:2855799-2855821 GCTGCTGGGGGCCTGGCAGCTGG - Exonic
1135076458 16:19398449-19398471 GCTGCAGGGCCCCCATCAGCTGG + Intergenic
1135485925 16:22864559-22864581 GCTGCAGGGGCCCCTCCTGGGGG + Intronic
1135991784 16:27222973-27222995 GCTGCCCCGGCCCCTCCTGCAGG + Intergenic
1136031454 16:27506253-27506275 GCAGCTTGGGCCCCTCCTTCTGG + Intronic
1136172728 16:28498266-28498288 GCTCCAGGGGTTCCTCCAGCTGG - Exonic
1136637665 16:31535918-31535940 GCTGCTGTGGTGCCTCCAGAAGG + Intergenic
1136996793 16:35196092-35196114 GCTGCTGGTGCCGCTCGGGCAGG - Intergenic
1137684130 16:50374064-50374086 GCTGGTGATGCCCCTCCAGCAGG + Intergenic
1138453992 16:57110755-57110777 GCTGCTGGGGCACCCCCACTGGG - Exonic
1138522054 16:57576644-57576666 GCAGTTACGGCCCCTCCAGCTGG - Exonic
1139426047 16:66880619-66880641 GCGGCTGTGGCCTCGCCAGCTGG + Exonic
1140746838 16:77988021-77988043 GCTGCTGGGTCCTCTCCTGTTGG - Intergenic
1141149102 16:81551984-81552006 GCTGGTGGGGTCCTTCCACCTGG + Intronic
1141827028 16:86487818-86487840 GCTGTTGGAGGCCATCCAGCTGG - Intergenic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1141948203 16:87324530-87324552 GCTGCAGGGGCGCCTCCCCCTGG + Intronic
1142020543 16:87779484-87779506 GCCGCTGGGGCCCTGCCACCAGG + Intergenic
1142144750 16:88488185-88488207 TTTGCTGCGGCCCCTCCATCAGG - Intronic
1142187533 16:88701585-88701607 CCAGATGGGGCCCATCCAGCTGG - Intronic
1142189685 16:88712197-88712219 GCTGCAGGGCCACCTCCACCTGG - Intronic
1142257606 16:89022305-89022327 GCAGCTGGGGCTCCCGCAGCCGG - Intergenic
1142338475 16:89505903-89505925 GCTGCTGCCGCCACTACAGCAGG + Intronic
1142367997 16:89660404-89660426 ACTGCTGGGGCCCTTCCAACAGG - Intronic
1142480114 17:213874-213896 GCTGCTGACGCAGCTCCAGCAGG - Exonic
1142668335 17:1475089-1475111 GCTCCTGAGGCCCTTTCAGCAGG - Intronic
1142685657 17:1575672-1575694 GCTGCAGCTGCCGCTCCAGCTGG + Exonic
1142711723 17:1727200-1727222 GCTGCTCAGGCACCTCCAACAGG - Exonic
1142764890 17:2059293-2059315 GGTGCGGGGGGCCCTCCGGCCGG - Exonic
1142985762 17:3694761-3694783 GCTGCTGGGGCCCCACCCTCAGG + Intronic
1143119218 17:4596819-4596841 GCTGGAGGGGCCCCCGCAGCAGG + Intronic
1143186324 17:5012587-5012609 TCTGCTGAGACCTCTCCAGCTGG - Intronic
1143232530 17:5369174-5369196 GGTGCTGGGGACCTTCCAGAAGG + Intronic
1143491975 17:7290017-7290039 GCTGTTGGTGCCCCTCCAATGGG + Exonic
1143871656 17:9961026-9961048 GCTGCTGGGCCTGATCCAGCAGG + Intronic
1144497422 17:15757330-15757352 GCTGCAGGGGACCCTCATGCTGG + Intergenic
1144652212 17:17014299-17014321 GCTGCAGGGGACCCTCATGCTGG - Intergenic
1145032463 17:19515317-19515339 TCTGCTGTGGTCCCTCCAGTGGG - Intronic
1145160784 17:20572380-20572402 GCTGCAGGGGACCCTCAGGCTGG + Intergenic
1145246242 17:21271810-21271832 CCAGTTGGGTCCCCTCCAGCAGG + Intergenic
1145271203 17:21405776-21405798 GCTGCTGTGGCCCCTGCAGGTGG + Intronic
1145309407 17:21693163-21693185 GCTGCTGTGGCCCCTGCAGGTGG + Intronic
1146051773 17:29559846-29559868 GTGCCTGGGGCTCCTCCAGCTGG + Intergenic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1147554369 17:41467071-41467093 GCTGCCGGGGCCCATGGAGCCGG + Exonic
1147611279 17:41803164-41803186 GGTGCTGGGGCCCATCCTCCAGG - Intronic
1149570963 17:57672077-57672099 GCTGCTGGGTCCCCACTAGAGGG - Intronic
1150210508 17:63438810-63438832 GCTGCTGGGTGCTCTCCGGCCGG - Intronic
1150712906 17:67546771-67546793 GCTGCCGGGGCCTCCCCGGCAGG - Intronic
1151478534 17:74356833-74356855 GCTGGTGGGGGCGCGCCAGCAGG - Exonic
1151493608 17:74446696-74446718 GCTCCTGGGGCCCAGCCAGAGGG + Intronic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1151947839 17:77329223-77329245 GCTGCTGCAGGCCCTGCAGCTGG + Intronic
1151976884 17:77488318-77488340 ACTGGTGAGGCCCCTCCAGGGGG + Exonic
1152016848 17:77756452-77756474 TCTGCTGGGGCCCCTCCATCTGG + Intergenic
1152161913 17:78674340-78674362 GGTGCTGGAGCCTGTCCAGCTGG - Exonic
1152800394 17:82328156-82328178 GCTGCTGGGCAGCTTCCAGCAGG + Intronic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1153344055 18:4007214-4007236 GCTCCTGGGGCAGCTCCAGGAGG + Intronic
1153794426 18:8609580-8609602 GCCGCCGGGGCCGCTCCAGCGGG + Exonic
1154502974 18:15005639-15005661 GTTGCTGGGGCCTCTGCGGCTGG + Intergenic
1155656102 18:28194895-28194917 TCTGGTGGGGGCCCTCCTGCTGG + Intergenic
1156294027 18:35773877-35773899 GCTGCTGGGGCCCCTGAGGCTGG - Intergenic
1157384306 18:47248337-47248359 TCTGCTGGGCCCCCACCTGCTGG - Intronic
1157621185 18:49018303-49018325 ACTCCTAGGGCCCCTTCAGCAGG + Intergenic
1157687061 18:49651047-49651069 GATGCAGGAGCCCCTCCACCTGG - Intergenic
1158096562 18:53778746-53778768 GCTGCCCTGGCCCCTCCAACTGG - Intergenic
1160544438 18:79643342-79643364 TCTGCTGGGGACGCACCAGCTGG - Intergenic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160781085 19:878250-878272 GCTGCTGGGGCCCGTGGGGCTGG - Intronic
1160794922 19:940880-940902 GCTGCTGGCGCCGGGCCAGCTGG + Intronic
1160795660 19:944304-944326 GCTGCAGGGGCGCGTCCAGGGGG + Intronic
1160900602 19:1426173-1426195 GCTCCTGGAGCCCCTCCCTCTGG + Intronic
1161014895 19:1978663-1978685 GCTGCTGGGGCCCAGCCTGGAGG + Exonic
1161199240 19:3005460-3005482 GCAGCTGGCGGCCCTCCCGCAGG + Exonic
1161456352 19:4371606-4371628 GCTGCTGTGGCCCAGCCTGCAGG + Intronic
1161588444 19:5117966-5117988 GCTTCTGGGGCGCCTCCTCCAGG - Intronic
1161843190 19:6694622-6694644 GCCACTGGGGTCCCTGCAGCAGG + Exonic
1161977623 19:7615227-7615249 GCCGCTGCTGCCGCTCCAGCAGG - Exonic
1162433261 19:10642203-10642225 GATGGTGGGGCCCTGCCAGCGGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162736311 19:12748844-12748866 ACTTCAGGAGCCCCTCCAGCCGG - Intergenic
1162799475 19:13102911-13102933 GCTGCTAGGTCCCCGCCCGCTGG - Intronic
1162923681 19:13918934-13918956 GCTGCTCCAGCGCCTCCAGCAGG - Exonic
1162937831 19:13990348-13990370 GCTGCTGGACCCCCTGCAGCTGG - Intronic
1163033044 19:14556780-14556802 GCTGCGGGTGCCCTTCCAGCAGG + Intronic
1163137509 19:15323337-15323359 GCTGCTGGGGCACACTCAGCAGG - Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163387422 19:17008375-17008397 CCTCCTTGGTCCCCTCCAGCTGG + Intronic
1163480905 19:17555776-17555798 GCTGCTGGCGCCACTGCCGCCGG + Exonic
1164157001 19:22603080-22603102 GGGGCTGGGGCCCCTGGAGCTGG - Intergenic
1165097441 19:33417326-33417348 GCTGGTGGAGCCCCCTCAGCTGG + Intronic
1165854217 19:38870207-38870229 GGTGCTGGCGCCCCTGAAGCCGG - Exonic
1165861626 19:38912104-38912126 GCTGCTGCGGCTGCTCCTGCTGG - Exonic
1165943089 19:39425019-39425041 GCTGCGGGGGCCCCTCCCCCAGG - Exonic
1166216924 19:41341932-41341954 GATGCTGGGCCCTCTCCAGCGGG + Exonic
1167070602 19:47220096-47220118 GCTCCAGGTGCTCCTCCAGCTGG + Intergenic
1167146299 19:47682149-47682171 GCTGCTGGGGTCCCTCTACCTGG - Exonic
1167374581 19:49104000-49104022 CCTGGCGGGGCCCCTGCAGCAGG - Intronic
1167492151 19:49799106-49799128 GGTGCTGGGGCCCTTCCTGGGGG + Intronic
925340235 2:3131055-3131077 GCCCCCGGGGTCCCTCCAGCTGG - Intergenic
927003951 2:18828136-18828158 GCTGCAGGGTCACCTGCAGCTGG - Intergenic
927138879 2:20116217-20116239 ACTGCTGGGGGCTCTTCAGCTGG + Intergenic
928366386 2:30706439-30706461 CCTGCTGGGGCCTCTTGAGCTGG - Intergenic
929561170 2:42957540-42957562 GCTGCCAGGGCCCCTCTCGCGGG + Intergenic
930051355 2:47218539-47218561 GCTGCTGGTTCCCCTCCATCAGG + Intergenic
930136101 2:47905591-47905613 GCTGCTGGGGCGGCTGCTGCTGG + Exonic
932773722 2:74515086-74515108 ACTGCAGGCGCCCCCCCAGCGGG - Exonic
937208263 2:120250926-120250948 CCTACTGGGACTCCTCCAGCAGG - Intronic
937305804 2:120869852-120869874 GCTGCAGGGGGCCCTGCAGGGGG + Intronic
937363720 2:121246067-121246089 TCTGCCGGGGCCGCTCTAGCAGG - Intronic
938252843 2:129828887-129828909 GATGCTGGGGGGCCTCCAGCTGG + Intergenic
938502138 2:131835809-131835831 GTTGCTGGGGCCTCTGCGGCCGG + Intergenic
938985865 2:136575757-136575779 TCTGCAGGGTCCCCACCAGCAGG - Intergenic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
943324984 2:186486638-186486660 GCTGCTGGCGCCCCCGCACCTGG + Intronic
943624088 2:190180296-190180318 GCTGCGGGGCCCCCTGCAGGCGG + Intronic
945946621 2:216001458-216001480 GCTCCTGGGCCCTCCCCAGCAGG + Intronic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948093401 2:235314586-235314608 GCTGCAGCGGCCCCTCCTTCTGG + Intergenic
948159430 2:235812085-235812107 GCTGCGGGGGACCCTCCATCAGG + Intronic
948424360 2:237877949-237877971 GGTGCTGGGCCCCCATCAGCAGG + Intronic
948727222 2:239942285-239942307 GCTGCTGGGGCCCACCCACCAGG + Intronic
948789074 2:240367973-240367995 CCAGCTGGGCCCCTTCCAGCTGG - Intergenic
948822469 2:240557168-240557190 GGTGCGGGGGACCCTCCAGCGGG - Exonic
948827125 2:240578207-240578229 GCTGCTGGGGCCCTTGCCCCGGG - Exonic
948853623 2:240720071-240720093 GCTCCCGGGGCCCGTCCACCAGG + Intronic
948953745 2:241272201-241272223 GCTGCGGGGGCCCCGCCGCCCGG + Intronic
1168827420 20:823140-823162 TCTGCTGGGGCCCCACAGGCAGG - Intergenic
1169074896 20:2754479-2754501 GGCTCTGGGGCCTCTCCAGCTGG + Intronic
1169116712 20:3071258-3071280 GACGCTGGGACCCCTCCAGGTGG - Intergenic
1170574409 20:17651843-17651865 GCAGATGGGGGCCCTGCAGCGGG - Intronic
1170941189 20:20849222-20849244 CCTGCTGGGGCCCATGCAGCAGG + Intergenic
1173495969 20:43517804-43517826 GCAGATTGGGCTCCTCCAGCTGG - Intronic
1173918215 20:46725411-46725433 GCTGGTGGGGCCACGGCAGCGGG + Exonic
1174174425 20:48636003-48636025 GCTCCTGGAGCCCCTGCTGCTGG - Intronic
1175159199 20:56995410-56995432 GGTGCTGCCGCACCTCCAGCAGG - Intergenic
1175234644 20:57501655-57501677 GCTCCTGGGGCTTCTCCATCCGG - Intronic
1175286693 20:57841346-57841368 CATGCTGGGGCCCCTCGGGCAGG - Intergenic
1175561943 20:59938735-59938757 GCTGCTTGGGCCTCCCCAGAGGG + Exonic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1175796239 20:61773059-61773081 GGTGCTGGGGCCACGGCAGCAGG - Exonic
1175872306 20:62214278-62214300 TCTCCTGGGGCCCCTGGAGCAGG + Intergenic
1175893290 20:62324722-62324744 GGTGCTGGCCCACCTCCAGCCGG - Intronic
1175976160 20:62711438-62711460 GCCCCTGGGGCCCCTCCACGCGG - Intronic
1175995889 20:62812178-62812200 ATGGCTGGGGCCCCTCCTGCTGG - Intronic
1176108878 20:63402119-63402141 TCTGCTGGGCACCCTCCACCAGG + Intergenic
1176117226 20:63438359-63438381 GGTGCTGGGGCCCGGCCATCAGG - Intronic
1176147587 20:63572343-63572365 GCAGCTGGGTGGCCTCCAGCGGG - Exonic
1179098251 21:38334887-38334909 GCTGCCGCTGCCCCTGCAGCTGG + Intergenic
1179279167 21:39919229-39919251 GCTGCTGGGGCCCTCTTAGCTGG - Intronic
1179558379 21:42195055-42195077 GCTCCTGTGGCTTCTCCAGCCGG - Intergenic
1180732831 22:17994675-17994697 CCAGCTGGGGCCACTCCAGCCGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181030601 22:20147422-20147444 GGTGCTGGACCCCCTGCAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181280237 22:21714494-21714516 GCAGCTGGGCCCCCTTCACCTGG + Intronic
1181512709 22:23395959-23395981 GGTGCTGGACCCCCTGCAGCAGG + Intergenic
1181628969 22:24140487-24140509 GCTTCTGGGGCTCCCCCCGCAGG + Intronic
1181635603 22:24172976-24172998 TCTCCTGGGGCCCCACCAGCTGG - Intronic
1181878487 22:25958719-25958741 GCTGCTGAGGCCCCTCCTATAGG + Intronic
1182352367 22:29706003-29706025 GCTGCTCTGCCTCCTCCAGCTGG + Intergenic
1182735619 22:32530624-32530646 GCTGCTAAGACCCTTCCAGCTGG + Intronic
1183782377 22:40007182-40007204 GCAGCAGGAGCCCCTCCTGCGGG + Intronic
1184246550 22:43238638-43238660 TCTGCTGGGGACCCTGCTGCTGG + Intronic
1184470374 22:44692436-44692458 CCTCCTGGGGCTCCTCCACCGGG + Intronic
1184528371 22:45038985-45039007 GCTCCTGGGCTCCCTTCAGCAGG - Intergenic
1184867567 22:47209970-47209992 GCTGCTTGTGCACCTCCCGCTGG - Intergenic
1185371055 22:50461176-50461198 GCAGCTGGAGCCCGTCCTGCAGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950604244 3:14064355-14064377 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604250 3:14064382-14064404 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604318 3:14064841-14064863 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950630102 3:14276625-14276647 GCAGCTGGAGTCCCTGCAGCTGG + Intergenic
952125030 3:30290595-30290617 AGTGCTGGGGCCGCTGCAGCTGG - Intergenic
952451747 3:33439994-33440016 GCTGCGGGGGCCCCACTGGCAGG + Exonic
952866891 3:37861084-37861106 ACTCCTGGGACCCCTCAAGCTGG + Intergenic
953263447 3:41362979-41363001 GCAGCTGAGGCCTCGCCAGCAGG + Intronic
953683889 3:45061058-45061080 GGTGCTGGGCTCCCTCCATCTGG - Intergenic
955941332 3:64149463-64149485 GCTGCTGGGGCCCCTTCCCGTGG + Intronic
959662953 3:108889666-108889688 GATGTTATGGCCCCTCCAGCCGG + Intergenic
961501337 3:127338096-127338118 GGCTCCGGGGCCCCTCCAGCGGG - Intergenic
961657613 3:128452107-128452129 GCTGCTGGGGCCCCGGCATGGGG - Intergenic
962097997 3:132312009-132312031 GCTACTTGGGCCCCTCCAAGAGG - Intergenic
962599353 3:136979295-136979317 GCTGCTGGGGACACCCCACCTGG - Intronic
963969722 3:151416308-151416330 GCTGCTGGGGCTGCTGCATCTGG - Exonic
966808239 3:183822761-183822783 GCTATTCAGGCCCCTCCAGCTGG - Intronic
968475574 4:805148-805170 GCTGCTGTGGGCGCTGCAGCCGG + Intronic
968504053 4:963905-963927 GAGGCTGGGGCCCCCACAGCGGG + Intronic
968515135 4:1012527-1012549 GCTGCTGGGGGCCTTCCCGCCGG + Exonic
968533766 4:1111470-1111492 CCTGCTGGGTTCCCTCCCGCTGG + Intronic
969302142 4:6303438-6303460 GCCCCAGGGGCCCCTCCAGCTGG - Intergenic
969351537 4:6600772-6600794 GCAGCTAAGGCCCCTCCAGCAGG - Intronic
969859967 4:10028061-10028083 TCTGCCTGGGCCCCTCCAGGAGG + Intronic
973624018 4:52752934-52752956 GGTGCTGGGGGTGCTCCAGCCGG - Intergenic
975072456 4:70158694-70158716 GCAACAGGGGCCCCTGCAGCAGG - Exonic
975683389 4:76897495-76897517 GCTGCTGGGGCGGCTCCCCCCGG + Exonic
978484057 4:109229924-109229946 GCTTCTGGGGCACCTCCCTCAGG + Intronic
978704794 4:111694145-111694167 ACTGTTGTGACCCCTCCAGCAGG + Intergenic
979349639 4:119628896-119628918 GCTGCTGCGCCCCCCCCACCCGG + Exonic
981016203 4:139977080-139977102 GCTGCTTCGGCCCTTCCACCAGG + Intronic
985693098 5:1324376-1324398 GCTGCTGGGGCCATTCCTCCAGG + Intronic
985786068 5:1895610-1895632 GCTGCTGGGTCCCTTGCAGCTGG + Intergenic
985805416 5:2039375-2039397 CCAGCTCGGGCCCCTCCTGCTGG - Intergenic
986273777 5:6256129-6256151 GCTGCACTGACCCCTCCAGCAGG - Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
988556324 5:32239171-32239193 GCTGCTGGGGCCTCTCCTAGAGG - Exonic
992052752 5:72956212-72956234 GCGGCGGCGGCCCCTCCGGCAGG + Intronic
996900280 5:128537001-128537023 GCTTCTCTGGCCCCTGCAGCAGG + Intronic
997505258 5:134411921-134411943 GCTGATGGGGCCCCTCTGGCCGG - Intergenic
997541515 5:134666882-134666904 CCTCATGGGCCCCCTCCAGCTGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002280032 5:178124501-178124523 GAAGCTGAGGCCCCGCCAGCTGG - Exonic
1002434525 5:179222502-179222524 GCAGCTGGGGCCCGGCAAGCAGG - Intronic
1004541186 6:16551767-16551789 CCTGCTGTGGCGCTTCCAGCTGG + Intronic
1005040436 6:21595544-21595566 GCTGCTGCGGCCGCTCAGGCTGG - Exonic
1005082073 6:21966173-21966195 CCTGCTGGTTCCGCTCCAGCAGG - Intergenic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006180419 6:32150627-32150649 GCTGCCGGGGCACCCCCACCCGG - Exonic
1006380315 6:33693464-33693486 GAAGCTGGGTCCCCTCCAGCAGG + Intronic
1006447995 6:34090661-34090683 GCTGCTTGGGGGCCTCCACCTGG - Intronic
1006507129 6:34496468-34496490 GCTGCTCGGCCTCCTCCTGCTGG + Intronic
1006802201 6:36766308-36766330 GCTTCTGTGGCCCCTCCAGGAGG + Intronic
1006946844 6:37790330-37790352 GCTTCTAGGGCCCGTCCAGGGGG - Intergenic
1007375506 6:41453445-41453467 GCTGCAGGAGCCAGTCCAGCAGG + Intergenic
1007826640 6:44605823-44605845 CCAGCTTGGGCCTCTCCAGCAGG + Intergenic
1013610413 6:111789258-111789280 GATGCTGGGACCCCTACACCTGG - Intronic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1014981222 6:127948508-127948530 GCTGCTTGGGCCCTTCGATCTGG + Intergenic
1016346991 6:143124540-143124562 GCTGCTGTGGCTCTTCCAGCAGG + Intronic
1016388261 6:143549553-143549575 GCTGCTGAGTACCCCCCAGCAGG - Intronic
1017545837 6:155450146-155450168 TCTCCTGGGGCTCCCCCAGCAGG - Intronic
1017679226 6:156846749-156846771 CCTGCTGTGGCCCCTCCAGATGG + Intronic
1017872877 6:158501994-158502016 GCTGCATGGGCCCCTGCGGCGGG - Exonic
1018174454 6:161166897-161166919 GGTGCTGGGGCTCCTGCGGCTGG - Intronic
1019127634 6:169851638-169851660 ACTGCTGTGGGGCCTCCAGCAGG - Intergenic
1019331723 7:463664-463686 CCTGCCGGGTGCCCTCCAGCAGG + Intergenic
1019366622 7:636482-636504 GATGCTGGGGCTCCTTCACCAGG + Intronic
1020073047 7:5240148-5240170 GCTGCTGAGGCCCTGCAAGCTGG + Intergenic
1020096984 7:5374743-5374765 GCTGATGGGGGACCTCCACCAGG + Intronic
1020283253 7:6662110-6662132 GCTGCTTGGGCCCCTAGATCTGG + Intergenic
1021845280 7:24757403-24757425 GCTGCCGGGGACCCAGCAGCGGG - Intronic
1022400593 7:30032872-30032894 GCTGCTTGTGCCTCTCCAGCAGG + Intronic
1024575825 7:50763446-50763468 GCTGCTGCCCCCACTCCAGCGGG - Intronic
1024638448 7:51309921-51309943 GCAGCTGGGGCTCCCCCAGGAGG - Intronic
1025023359 7:55497004-55497026 GATGCTCGGGGCACTCCAGCAGG + Intronic
1027252787 7:76409673-76409695 TTTTCTGGGGCCGCTCCAGCTGG - Exonic
1028152577 7:87391121-87391143 GCCGCTAGGGCCTCTCCATCGGG + Intronic
1028585589 7:92447983-92448005 GCTCCTCCGGCCCCTCCCGCCGG + Intronic
1029189354 7:98760830-98760852 GCTGCTGGTGCCCCTGCTGAGGG + Intergenic
1029371851 7:100155357-100155379 GCTGCTGGGGCTGCTCTTGCGGG + Exonic
1030830206 7:114210836-114210858 GCTGCTGCAGCCACTCCAGAAGG - Intronic
1031978589 7:128109364-128109386 GCTGCTGGGTCACCTCCAAGTGG - Intergenic
1032097741 7:128947820-128947842 GCTCCTGGGTGGCCTCCAGCTGG - Exonic
1034713901 7:153221527-153221549 GATGCTGGAGCCCCTCCAGATGG + Intergenic
1034781637 7:153887215-153887237 GCTCCGGGGGCTCCTCCAGCAGG - Intronic
1035448199 7:158957306-158957328 GCTGCTGGGGCTGCTCCTGTGGG + Intergenic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1038145563 8:24892080-24892102 GCTGCTGGTTCCCCTGGAGCTGG + Intergenic
1039311365 8:36321406-36321428 GCAGGGGGGGCCCCGCCAGCTGG + Intergenic
1039464927 8:37778077-37778099 GCTCCTGTGCCACCTCCAGCGGG - Exonic
1039476984 8:37844155-37844177 ACTGCTGCGGCTCCTCCTGCAGG - Exonic
1040122502 8:43698899-43698921 GCTGCAGGGACCCCATCAGCTGG + Intergenic
1040878439 8:52177076-52177098 GCTGCTGGGGACCCCACACCTGG + Intronic
1044613759 8:94119503-94119525 CCTGCAGCGGCCGCTCCAGCAGG - Intergenic
1047168518 8:122466820-122466842 GTTGCTGGGGGCCATCCTGCTGG - Intergenic
1047248649 8:123165622-123165644 TCTGCAGGGGCTGCTCCAGCTGG + Intergenic
1048959769 8:139566630-139566652 GAAGCTTGGGCCCCTACAGCTGG + Intergenic
1048985208 8:139731353-139731375 GCTCCAGTGCCCCCTCCAGCAGG + Intronic
1049574322 8:143383432-143383454 CCTGCTTGGGCCGCTCCTGCTGG + Exonic
1049612621 8:143562500-143562522 CCTGTTGGGGCCGCTCGAGCTGG + Exonic
1049622939 8:143606724-143606746 CCTGCTGGGGCCTGCCCAGCAGG - Intronic
1049711270 8:144064421-144064443 GTTGCTGGGCCCCATCCTGCAGG - Intergenic
1049789892 8:144467710-144467732 GCTGCTTCAGCTCCTCCAGCTGG - Exonic
1049838259 8:144754243-144754265 GCAGCTGGGCCCCCAGCAGCGGG - Exonic
1049875910 8:145020234-145020256 GCTGATTGGGGCCCTGCAGCTGG + Intergenic
1051585059 9:18718633-18718655 GCTGCCGCCGCCGCTCCAGCTGG + Intronic
1053221435 9:36316228-36316250 GCTGCTCTGGGCCCTGCAGCTGG - Intergenic
1053294583 9:36903549-36903571 GCTGCTGGGGCATGTCCAGGTGG + Intronic
1053482218 9:38424176-38424198 GCTGCGGGGGCCGCGCCGGCGGG - Exonic
1054810247 9:69428551-69428573 GCTGCTGTGGCTGCTCCACCAGG - Exonic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1059119770 9:111631470-111631492 GCTGCTGGCGCCCCTGCTGCCGG + Exonic
1059425779 9:114220133-114220155 GCAGCTGGGGCCTCTCCAGTGGG - Intronic
1059490895 9:114666597-114666619 GCTGCTGGGGCATCTCCATGAGG - Intergenic
1059669189 9:116477149-116477171 CCTGCTGGGGACTCTCAAGCAGG - Intronic
1060437135 9:123603615-123603637 GCAGCTGGGGGCCCCCCAACTGG + Intronic
1060477476 9:123997321-123997343 GCTTCTGGGGCTCCTCCTCCTGG - Intergenic
1060942871 9:127553383-127553405 GCTGCTGAGGCTCCTCCAGGAGG + Intronic
1061304046 9:129722489-129722511 GCTGTTGAGGCCCCTGCAGCCGG + Exonic
1061953853 9:133951417-133951439 CCTGCTGGAGCCTCTCCTGCAGG + Intronic
1062026487 9:134343006-134343028 TCTGCTGGGGCCTCTCTAGAAGG - Intronic
1062139451 9:134947802-134947824 CCTGCAGGGGCACCTCCTGCAGG - Intergenic
1062384292 9:136303007-136303029 TCTGCTGGGGCCCCAACACCTGG + Exonic
1062583050 9:137236758-137236780 GGAGCTGGGGCCCCTCCTGGGGG + Intergenic
1203761009 EBV:13017-13039 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203761116 EBV:13311-13333 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203761160 EBV:13424-13446 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203761938 EBV:16089-16111 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203762045 EBV:16383-16405 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203762089 EBV:16496-16518 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203762867 EBV:19161-19183 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203762974 EBV:19455-19477 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203763018 EBV:19568-19590 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203763796 EBV:22233-22255 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203763903 EBV:22527-22549 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203763947 EBV:22640-22662 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203764725 EBV:25305-25327 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203764832 EBV:25599-25621 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203764876 EBV:25712-25734 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203765654 EBV:28377-28399 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203765761 EBV:28671-28693 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203765805 EBV:28784-28806 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203766583 EBV:31449-31471 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203766690 EBV:31743-31765 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203766734 EBV:31856-31878 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1203767512 EBV:34521-34543 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203767619 EBV:34815-34837 GCTGCCGGGGTCCCTCCGGCTGG - Intergenic
1203767663 EBV:34928-34950 GCCGCCGGGGTCCCTCCGGCCGG - Intergenic
1186346251 X:8696184-8696206 GCTGCTGGGGCCCCTGCCATTGG + Intronic
1187685880 X:21815070-21815092 CCTGCTGGGGCTCCTCCCTCTGG + Intergenic
1188024890 X:25197936-25197958 GCTGCTGATGCTCCTCCAGTTGG - Intergenic
1189496637 X:41514708-41514730 GCTCCTGGTGCCCATCCTGCAGG - Intergenic
1190908560 X:54751171-54751193 CCAGCTGGGGCCTCTTCAGCAGG + Exonic
1190918112 X:54824973-54824995 ACTGCTCGGGTCTCTCCAGCTGG + Intergenic
1191220770 X:57985743-57985765 GCTGCAGGGCAGCCTCCAGCTGG - Intergenic
1192165719 X:68826619-68826641 GCTCCTGAGGCCCCTGTAGCTGG + Intergenic
1195966104 X:110431702-110431724 CCTGCTGGGGCGCATACAGCAGG + Intronic
1196473677 X:116058315-116058337 GCTGCTGCTGCCACTGCAGCTGG - Intergenic
1199076544 X:143532536-143532558 TCTGCTGGGGCCACTCTAGGAGG + Intergenic
1199679713 X:150216206-150216228 GCTCCTGGGGCCACCCCTGCTGG - Intergenic
1199695518 X:150340843-150340865 GCTCCTGGGGCCACCCCTGCTGG + Intergenic
1199846475 X:151695467-151695489 GCTGCTGCGCCTCTTCCAGCAGG - Intronic
1200082178 X:153583111-153583133 GCAGCTGGAGCCCCTCCCACTGG - Intergenic