ID: 1108482631

View in Genome Browser
Species Human (GRCh38)
Location 13:50890188-50890210
Sequence ACATGGGCCTCCAGAGAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108482631_1108482634 -2 Left 1108482631 13:50890188-50890210 CCGGATTCTCTGGAGGCCCATGT No data
Right 1108482634 13:50890209-50890231 GTAATGATATAGTTCTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108482631 Original CRISPR ACATGGGCCTCCAGAGAATC CGG (reversed) Intergenic
No off target data available for this crispr