ID: 1108482952

View in Genome Browser
Species Human (GRCh38)
Location 13:50893773-50893795
Sequence TTGCATGTAAACAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108482952_1108482955 -7 Left 1108482952 13:50893773-50893795 CCATGCTCCCTGTTTACATGCAA No data
Right 1108482955 13:50893789-50893811 CATGCAAAGTAGATGCATTAAGG No data
1108482952_1108482956 2 Left 1108482952 13:50893773-50893795 CCATGCTCCCTGTTTACATGCAA No data
Right 1108482956 13:50893798-50893820 TAGATGCATTAAGGTTTTCAAGG No data
1108482952_1108482957 24 Left 1108482952 13:50893773-50893795 CCATGCTCCCTGTTTACATGCAA No data
Right 1108482957 13:50893820-50893842 GTTTTAAAGTAGATGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108482952 Original CRISPR TTGCATGTAAACAGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr