ID: 1108484011

View in Genome Browser
Species Human (GRCh38)
Location 13:50906555-50906577
Sequence GCGTCTGCATTCGTTTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 1, 1: 0, 2: 6, 3: 126, 4: 1080}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108484008_1108484011 14 Left 1108484008 13:50906518-50906540 CCACTTATAAGTTAGAACATGCG 0: 3
1: 516
2: 6248
3: 18914
4: 27216
Right 1108484011 13:50906555-50906577 GCGTCTGCATTCGTTTGCTGAGG 0: 1
1: 0
2: 6
3: 126
4: 1080
1108484007_1108484011 15 Left 1108484007 13:50906517-50906539 CCCACTTATAAGTTAGAACATGC 0: 20
1: 2272
2: 9286
3: 21523
4: 24878
Right 1108484011 13:50906555-50906577 GCGTCTGCATTCGTTTGCTGAGG 0: 1
1: 0
2: 6
3: 126
4: 1080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108484011 Original CRISPR GCGTCTGCATTCGTTTGCTG AGG Intergenic
900499366 1:2993245-2993267 GCTTCTGTATTAGTTTGCTAAGG - Intergenic
900914991 1:5630807-5630829 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
900927496 1:5715143-5715165 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
901289631 1:8113865-8113887 GTTCCTGCGTTCGTTTGCTGAGG + Intergenic
901494808 1:9614886-9614908 CTGTCTGTATTCGTTTGCTTGGG + Intergenic
901829302 1:11882348-11882370 GCGTCTGTATGAGTTTCCTGCGG - Intergenic
901862979 1:12086591-12086613 CCATCTGTATTAGTTTGCTGGGG + Intronic
902129550 1:14247530-14247552 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
902138624 1:14333148-14333170 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
902153763 1:14466373-14466395 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
902831820 1:19019411-19019433 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
902999045 1:20251387-20251409 GTTCCTGCATTCGTTTGCTGAGG + Intergenic
903023125 1:20408370-20408392 GTCCCTGCATTAGTTTGCTGAGG - Intergenic
903898990 1:26629177-26629199 GTTCCTGCATTCGTTTGCTGAGG + Intergenic
903988512 1:27247590-27247612 GTTTCTGCTTTAGTTTGCTGAGG + Intronic
904821850 1:33250465-33250487 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
904971002 1:34419379-34419401 GGGCCTGCATTCGTTTCCTAAGG - Intergenic
905326381 1:37154988-37155010 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
905712138 1:40114489-40114511 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
905801427 1:40846016-40846038 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
905815837 1:40950134-40950156 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
905953176 1:41970416-41970438 GTTCCTGCATTAGTTTGCTGAGG - Intronic
905962310 1:42053561-42053583 GTTCCTGCATTCATTTGCTGAGG + Intergenic
906065514 1:42977790-42977812 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
906954853 1:50365288-50365310 GCTCCTGTATTAGTTTGCTGAGG - Intergenic
907311067 1:53539397-53539419 GGGTGTGCATTCATGTGCTGTGG - Intronic
907631443 1:56087096-56087118 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
908079144 1:60556510-60556532 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
908482834 1:64559371-64559393 GTTTCTGCATTAGTTTGCTAAGG - Intronic
908562246 1:65318581-65318603 GTTCCTGCATTAGTTTGCTGAGG - Intronic
908854989 1:68416928-68416950 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
908880602 1:68727404-68727426 GTTTCTGCGTTAGTTTGCTGAGG + Intergenic
909453405 1:75823738-75823760 GTTCCTGCATTAGTTTGCTGAGG + Intronic
909524360 1:76606444-76606466 GTTCCTGCATTAGTTTGCTGAGG - Intronic
909659525 1:78066761-78066783 GTTTCTGCATTAGTTTGCTAAGG - Intronic
909991922 1:82234058-82234080 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
910154514 1:84199414-84199436 TGTTCTGCATTAGTTTGCTGAGG + Intronic
910376586 1:86578568-86578590 GTTCCTGCATTAGTTTGCTGAGG + Intronic
910452531 1:87361635-87361657 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
910889909 1:92007500-92007522 GTTCCTGCATTTGTTTGCTGAGG + Intronic
911124868 1:94332077-94332099 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
911202775 1:95062561-95062583 GTTCCTGCATTAGTTTGCTGAGG + Intronic
911297359 1:96133918-96133940 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
912077793 1:105898389-105898411 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
912099483 1:106188538-106188560 GTTTCTGTATTAGTTTGCTGAGG + Intergenic
912155681 1:106916036-106916058 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
912223148 1:107700564-107700586 GTTCCTGCATTAGTTTGCTGAGG + Intronic
912271918 1:108220084-108220106 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
913713991 1:121515477-121515499 GTCCCTGCATTAGTTTGCTGAGG - Intergenic
914324886 1:146602900-146602922 GTTTCTGCATTAGTTTGCTAGGG + Intergenic
914344910 1:146790626-146790648 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
914994253 1:152527537-152527559 GTTCCTGCATTAGTTTGCTGAGG + Intronic
915641303 1:157229157-157229179 GCTTCTGCTTTCATTTCCTGTGG + Intergenic
915879316 1:159649608-159649630 ACCTCTGCATTAGTTTGCTGGGG + Intergenic
915995933 1:160563475-160563497 GTTCCTGCATTAGTTTGCTGAGG - Intronic
916829878 1:168480230-168480252 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
916864312 1:168838750-168838772 GTTCCTGCATTCGTTTGCTAAGG - Intergenic
917061990 1:171051467-171051489 GTTTCTGCATTTGTTTGCTGAGG - Intronic
917101563 1:171451405-171451427 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
917305847 1:173623838-173623860 GTTCCTGCATTAGTTTGCTGAGG - Intronic
917542813 1:175931523-175931545 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
918085303 1:181239913-181239935 GTTTGTGCATTCGTTTGCTAAGG + Intergenic
918522462 1:185429924-185429946 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
918603445 1:186392515-186392537 GCCCCTGCATTCGTTTTCTAAGG - Intronic
918709639 1:187710830-187710852 GTTTCTGCATTTGTTTGCTGAGG + Intergenic
918766535 1:188492586-188492608 GTTTCTGCATTCATTTGCTAAGG - Intergenic
918862815 1:189854774-189854796 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
919062151 1:192646763-192646785 GTTCCTGCATTAGTTTGCTGAGG + Intronic
919142237 1:193587151-193587173 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
919331553 1:196178507-196178529 CCTTCTGCATTAGTTTGCTTTGG - Intergenic
919598740 1:199596555-199596577 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
919721066 1:200836354-200836376 GTTTCTGCATTAGTTTGCTAAGG + Intronic
920140947 1:203812387-203812409 GTTTCTGCATTAGTTTGCTAAGG + Intronic
920406810 1:205720988-205721010 GTGCCTGCATTAGTTTGCTGAGG - Intronic
920568138 1:206992725-206992747 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
920954888 1:210609774-210609796 GTTCCTGCATTAGTTTGCTGAGG + Intronic
921111900 1:212046553-212046575 GTTTGTGCATTAGTTTGCTGAGG + Intronic
921366326 1:214378188-214378210 TTGTCTGCATTCCTTGGCTGGGG - Intronic
921415984 1:214887329-214887351 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
921434793 1:215105857-215105879 GTTTCTGCATTAGTTTACTGAGG + Intronic
921455844 1:215370458-215370480 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
921919238 1:220647772-220647794 GTTCCTGCATTAGTTTGCTGAGG - Intronic
922390123 1:225132481-225132503 GTTCCTGCATTAGTTTGCTGAGG + Intronic
922399072 1:225233069-225233091 GTTCCTGCATTAGTTTGCTGAGG + Intronic
923347665 1:233071422-233071444 GCTTCTGTGTTAGTTTGCTGAGG + Intronic
923492689 1:234498416-234498438 ACATCTGCATTCGTTTGCTAGGG - Intergenic
923945758 1:238885324-238885346 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
923994151 1:239472604-239472626 GTTCCTGCATTAGTTTGCTGAGG - Intronic
923995972 1:239494809-239494831 GTTCCTGCATTAGTTTGCTGAGG + Intronic
924652777 1:245945840-245945862 GTTCCTGCATTAGTTTGCTGAGG - Intronic
924667359 1:246086989-246087011 GTCTCTGCGTTAGTTTGCTGAGG + Intronic
924871632 1:248053216-248053238 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1063251019 10:4274926-4274948 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1063465204 10:6238831-6238853 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1063709697 10:8465320-8465342 GCTTCTGCATTAGTTTGCTAAGG - Intergenic
1063745281 10:8872288-8872310 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1063793584 10:9484112-9484134 GCTCCTGCATTAGTTTGCTGAGG - Intergenic
1064657544 10:17570843-17570865 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1064721934 10:18237630-18237652 CCATCTGCATTTGTTTCCTGGGG - Intronic
1064901446 10:20299892-20299914 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1064936359 10:20683123-20683145 GCTTTTGCATTAGTCTGCTGGGG - Intergenic
1065445682 10:25795901-25795923 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1065509161 10:26460679-26460701 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1066186072 10:33011993-33012015 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1066280342 10:33911121-33911143 GCTCCTGCATTAGTTTGCTGAGG + Intergenic
1066494579 10:35930117-35930139 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1066510949 10:36095322-36095344 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1066679611 10:37924587-37924609 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1067923830 10:50487212-50487234 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1068001367 10:51338091-51338113 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1068025459 10:51637647-51637669 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1068384768 10:56311441-56311463 GCTCCTGCATTAGTTTGCTTAGG - Intergenic
1069341081 10:67409464-67409486 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1069353098 10:67552778-67552800 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1069361143 10:67643200-67643222 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1070709822 10:78672680-78672702 GTTTCTACATTAGTTTGCTGAGG - Intergenic
1070872014 10:79763816-79763838 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
1071109046 10:82133523-82133545 GCTTCTGCATTAGTTTACTGAGG + Intronic
1071130310 10:82384541-82384563 GTTTCTGCATTCGTCTGCTAAGG + Intronic
1071135280 10:82446514-82446536 GTTTTTGCATTAGTTTGCTGAGG - Intronic
1071141378 10:82513218-82513240 GTTTCTGCATTAGTTTGCTGAGG + Intronic
1071199339 10:83200791-83200813 GCTACTGCATTAGTTTGCTAAGG + Intergenic
1071668466 10:87584242-87584264 GTTACTGCATTAGTTTGCTGAGG + Intergenic
1071807318 10:89138118-89138140 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1071835435 10:89413117-89413139 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1072178342 10:92952711-92952733 GTTTCTGCATTAGTTTGCTTAGG + Intronic
1072404984 10:95142688-95142710 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1072415048 10:95240370-95240392 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1073669875 10:105575772-105575794 GTTGCTGCATTAGTTTGCTGAGG + Intergenic
1074022723 10:109600863-109600885 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1074741905 10:116493472-116493494 GCTTCTGCATTAGTTCGCTGAGG + Intergenic
1075064223 10:119278674-119278696 GGTTCTGTATTCATTTGCTGGGG + Intronic
1075899557 10:126029467-126029489 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1076072651 10:127503812-127503834 CCCCCTGCATTAGTTTGCTGGGG + Intergenic
1076437637 10:130457042-130457064 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1076933495 10:133551253-133551275 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1077268268 11:1662920-1662942 GCACCTGCATTCGTGGGCTGTGG - Intergenic
1077272613 11:1688699-1688721 GCACCTGCATTCGTGGGCTGTGG + Intergenic
1077835775 11:5926545-5926567 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1078159031 11:8824463-8824485 GCTCCTGCATTAGTTTGCTAAGG + Intronic
1079176551 11:18147151-18147173 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1079437313 11:20470497-20470519 GTTCCTGCATTCGTTTGCTCGGG + Intronic
1079751033 11:24197530-24197552 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1079822976 11:25154815-25154837 GCTCCTGAATTAGTTTGCTGAGG + Intergenic
1079865888 11:25733356-25733378 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1080807569 11:35668477-35668499 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1080921310 11:36712086-36712108 GCAGTTGCATTCGTTTGCTTGGG - Intergenic
1081357980 11:42137207-42137229 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1081370390 11:42293569-42293591 TGTTCTGCATTAGTTTGCTGAGG - Intergenic
1081394340 11:42567727-42567749 GATCCTGCATTAGTTTGCTGAGG - Intergenic
1082913569 11:58405476-58405498 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1083007451 11:59360721-59360743 GACTCTGCATTCGTTTGCTGAGG + Intergenic
1083012415 11:59415855-59415877 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1083027788 11:59565084-59565106 GCGTCTGGATATCTTTGCTGGGG + Intergenic
1083499749 11:63093571-63093593 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1083527622 11:63384404-63384426 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1083620071 11:64044865-64044887 GATTCTGCCTTCGTTTCCTGAGG + Intronic
1084110927 11:67013764-67013786 CCGTCTGCGTTCCTTTCCTGGGG + Intronic
1084722660 11:70917733-70917755 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1085177232 11:74500364-74500386 GTTTCTGCGTTAGTTTGCTGAGG + Intronic
1085647703 11:78237906-78237928 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1086013779 11:82138937-82138959 GTTTCTGCATTAGTTTGCCGAGG + Intergenic
1086074367 11:82834628-82834650 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1086574346 11:88321544-88321566 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1086741466 11:90374682-90374704 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1086879110 11:92133202-92133224 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1086962767 11:92996571-92996593 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1087085155 11:94210774-94210796 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1087359428 11:97139124-97139146 GTTCCTGCATTCGTTTGCTAAGG + Intergenic
1087363676 11:97192880-97192902 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1087583476 11:100089774-100089796 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1087931584 11:103984288-103984310 GATCCTGCATTAGTTTGCTGAGG - Intronic
1087968270 11:104446904-104446926 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1088005516 11:104934596-104934618 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1088027171 11:105199513-105199535 GTTTCTGCATTGGTTTGCTAAGG + Intergenic
1088362643 11:109007199-109007221 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1088498011 11:110451811-110451833 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1088527948 11:110776795-110776817 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1088652618 11:111971845-111971867 GGTTCTGCATTAGTTTGCTTAGG - Intronic
1088772858 11:113053169-113053191 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1089548085 11:119245920-119245942 GCGTCTGTCTTAGTTTGCTTGGG - Intronic
1089577471 11:119456008-119456030 GCTCCTGCGTTAGTTTGCTGAGG + Intergenic
1089612309 11:119676401-119676423 GAGTCTGCCTTCTTTTTCTGGGG - Intronic
1090114605 11:123955371-123955393 GTTCCTGCATTCGTTTTCTGAGG - Intergenic
1090223816 11:125056365-125056387 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1091097093 11:132834378-132834400 GCTTCTGTATTCATTTCCTGGGG + Intronic
1091817366 12:3448999-3449021 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1091929811 12:4386576-4386598 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1091943867 12:4516589-4516611 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1092028897 12:5267478-5267500 GTTCCTGCATTAGTTTGCTGGGG - Intergenic
1092675841 12:10918099-10918121 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1092722403 12:11454814-11454836 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1093095446 12:14966603-14966625 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1093476695 12:19563571-19563593 GTTTCTGCATTAGTTTGCTAAGG + Intronic
1093630612 12:21404498-21404520 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1094207575 12:27856681-27856703 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1094454269 12:30614678-30614700 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1094782203 12:33803667-33803689 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1095129204 12:38518674-38518696 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1095194695 12:39299829-39299851 GTTTCTGCATTTGTTTGCTAAGG - Intronic
1095376436 12:41534557-41534579 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1095588008 12:43870033-43870055 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1095595821 12:43957032-43957054 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1096928934 12:55182744-55182766 GTTTCTGCGTTAGTTTGCTGAGG - Intergenic
1096929536 12:55191276-55191298 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1097337313 12:58397230-58397252 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1097562714 12:61228247-61228269 GTTTCTGCATTTGTTTGCTAAGG - Intergenic
1097632631 12:62082055-62082077 GTTTCAGCATTAGTTTGCTGAGG + Intronic
1097940275 12:65297098-65297120 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1097974515 12:65670303-65670325 GTTCCTGCATTCGTTTGCTAAGG - Intergenic
1098056313 12:66509676-66509698 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1098380092 12:69860212-69860234 ATTTCTGCATTAGTTTGCTGAGG + Intronic
1098813908 12:75131988-75132010 GCTTCTCCATTAGTTTTCTGTGG - Intronic
1098829158 12:75338863-75338885 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1099302525 12:80915756-80915778 GTTTCTGCATTAGTTTGCTTAGG - Intronic
1099659450 12:85536535-85536557 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1099860043 12:88214902-88214924 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1099922818 12:88980290-88980312 GTTTCTGCATTGGTTTGCTTAGG + Intergenic
1100377962 12:94034967-94034989 GTTCCTGCATTTGTTTGCTGAGG - Intergenic
1100923142 12:99512780-99512802 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1101046114 12:100807817-100807839 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1101327532 12:103729077-103729099 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1101447029 12:104743871-104743893 TGTTCTGCATTCGTTTGCTAAGG + Intronic
1101979252 12:109391343-109391365 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1102417244 12:112774655-112774677 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1102458037 12:113082913-113082935 AAGTCTGTATTAGTTTGCTGGGG + Intronic
1102785623 12:115602143-115602165 GTGTCTGCATATGTTTGCTTGGG + Intergenic
1102809172 12:115809135-115809157 CCCTCTGCATTCGTTTGCTAGGG + Intergenic
1103039344 12:117682147-117682169 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1103197484 12:119057457-119057479 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1104217750 12:126750836-126750858 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1104338220 12:127921137-127921159 GTTTCTGCGTTAGTTTGCTGAGG - Intergenic
1104457282 12:128925447-128925469 CTGCCTGCATTAGTTTGCTGAGG + Intronic
1104517924 12:129445189-129445211 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1104579607 12:130001089-130001111 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1104627379 12:130369159-130369181 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1104796464 12:131523243-131523265 GCTCCTGCATGAGTTTGCTGAGG - Intergenic
1105265842 13:18814349-18814371 GTTTCTGCATTGGTTTGCTTAGG + Intergenic
1105266799 13:18826376-18826398 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1105495778 13:20929792-20929814 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1106010146 13:25812958-25812980 GTTTCTGCGTTAGTTTGCTGAGG - Intronic
1106055993 13:26237746-26237768 CTGTCTGCATTCCTTTGTTGAGG + Intergenic
1106805963 13:33307538-33307560 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1106893466 13:34271720-34271742 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1106982267 13:35301450-35301472 GTTTCTGCGTTAGTTTGCTGAGG + Intronic
1107240597 13:38229993-38230015 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1107258529 13:38461497-38461519 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1107314274 13:39114260-39114282 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1107390857 13:39962565-39962587 GTCCCTGCATTAGTTTGCTGAGG + Intergenic
1107413024 13:40175001-40175023 GAGTCTGCCTTCGTTTGCTGTGG - Intergenic
1107703950 13:43080322-43080344 GTTTCTGCATTAGTTTGCTGAGG + Intronic
1108195084 13:47985499-47985521 GCTCCTGCATTAGTTTGCTGAGG + Intronic
1108443120 13:50476503-50476525 GCTTCTGCATTAGTTTACTGAGG + Intronic
1108480203 13:50861778-50861800 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1108484011 13:50906555-50906577 GCGTCTGCATTCGTTTGCTGAGG + Intergenic
1109306080 13:60643459-60643481 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
1109462078 13:62674061-62674083 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1109573296 13:64220843-64220865 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1110465467 13:75795658-75795680 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1110478271 13:75943679-75943701 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1110507576 13:76305967-76305989 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1110546380 13:76760559-76760581 GGGTCTGTATTGGTTTGCTTTGG - Intergenic
1110821322 13:79920468-79920490 GTGCCTGCCTTCGTTTGCTGAGG + Intergenic
1111171753 13:84535645-84535667 GCTTCTGAATTCCTTTACTGAGG + Intergenic
1111371673 13:87327394-87327416 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1111570455 13:90077819-90077841 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1111615882 13:90661180-90661202 GTTTCTGTATTAGTTTGCTGAGG - Intergenic
1111798626 13:92956005-92956027 CTGTCTGCATTTGTTTTCTGGGG + Intergenic
1111817936 13:93178069-93178091 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1111917927 13:94381228-94381250 ACGTCTGTATTCGTTTGCTAAGG + Intronic
1112086369 13:96036282-96036304 GTCTCTGCATTAGTTTGCTGAGG - Intronic
1112601428 13:100859218-100859240 GCTTCTGCATTCCTTTGCTATGG - Intergenic
1112730767 13:102359047-102359069 GTTTCTGCGTTAGTTTGCTGAGG - Intronic
1112876057 13:104040024-104040046 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1112891058 13:104231927-104231949 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1112957638 13:105080876-105080898 GTGTCTGCATTAGTTTTCTTAGG + Intergenic
1113022166 13:105899669-105899691 GTGTCTGCATTCGTTTGCTAAGG - Intergenic
1113023551 13:105916017-105916039 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1113072725 13:106437084-106437106 GAGTTTGCATTAGTTTGCTAAGG - Intergenic
1113358600 13:109607296-109607318 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1114333633 14:21663865-21663887 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1114800115 14:25764563-25764585 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1114831552 14:26148659-26148681 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1114843003 14:26288179-26288201 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1114885823 14:26849757-26849779 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1114958672 14:27854705-27854727 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1115859160 14:37665376-37665398 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1115870947 14:37802122-37802144 GTTTCTGCATTAGTTTGCTGAGG - Intronic
1116161830 14:41276990-41277012 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1116312101 14:43340659-43340681 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1116323522 14:43500047-43500069 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1116343516 14:43757134-43757156 GTTGCTGCATTAGTTTGCTGAGG - Intergenic
1116642015 14:47475703-47475725 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1116671808 14:47851842-47851864 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1116784572 14:49273159-49273181 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1116806443 14:49498685-49498707 GTCTCTGTATTCGTTTGCTAGGG + Intergenic
1117030410 14:51663493-51663515 GTTTCTGCATTAGTTTGCTGAGG - Intronic
1117454151 14:55881117-55881139 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1117467592 14:56008763-56008785 GTTACTGCATTAGTTTGCTGAGG + Intergenic
1118034450 14:61851172-61851194 GTACCTGCATTAGTTTGCTGAGG + Intergenic
1118426176 14:65665811-65665833 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1118540502 14:66818364-66818386 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1119108803 14:71951285-71951307 GCTCCTGCGTTTGTTTGCTGGGG - Intronic
1119607080 14:76028721-76028743 GTTTCTGCATTTGTTTGCTTAGG + Intronic
1119855628 14:77898518-77898540 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1120628114 14:86854713-86854735 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1120803741 14:88722493-88722515 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1121143464 14:91562759-91562781 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1121221081 14:92285894-92285916 CCATCTGTATTAGTTTGCTGGGG + Intergenic
1121923858 14:97909786-97909808 GCCCCTGCATTAGTTTGCTGAGG + Intergenic
1122336829 14:100995919-100995941 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1122479508 14:102037521-102037543 GCTCCTGCATGAGTTTGCTGAGG - Intronic
1122589368 14:102835632-102835654 GTTCCTGCATTCGTTTGCTGAGG - Intronic
1123499734 15:20868806-20868828 GTTTCTGCATTAGTTTCCTGAGG - Intergenic
1123556983 15:21442504-21442526 GTTTCTGCATTAGTTTCCTGAGG - Intergenic
1123593207 15:21879769-21879791 GTTTCTGCATTAGTTTCCTGAGG - Intergenic
1123859690 15:24451494-24451516 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1123878730 15:24653435-24653457 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1123998874 15:25738018-25738040 GTCTCTGTATTCGTTTACTGGGG - Intronic
1124447836 15:29754250-29754272 GTTCCTGCATTCGTTTGCTAAGG - Intronic
1124845585 15:33286884-33286906 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1125373842 15:39006890-39006912 GTTCCTGCATTCATTTGCTGAGG - Intergenic
1125400018 15:39292039-39292061 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1125409021 15:39385226-39385248 CCATCTGCATTAGTTTGCTAGGG - Intergenic
1125787796 15:42337436-42337458 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1126324643 15:47463679-47463701 GCGACTGTATTAGTTTCCTGTGG + Intronic
1126659285 15:51016332-51016354 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1126784946 15:52170431-52170453 GTTTCTGCCTTAGTTTGCTGAGG - Intronic
1126898001 15:53280594-53280616 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1126957030 15:53944522-53944544 GTGTCTGCATTTATTTGCTAAGG + Intergenic
1127154887 15:56113378-56113400 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1127682375 15:61310262-61310284 GTTTCTGCATTTGTTTGCTTGGG + Intergenic
1127795536 15:62435027-62435049 GTTTCTGCCTTAGTTTGCTGAGG + Intronic
1128195443 15:65750211-65750233 GTTTCTGCATTAGTTTGCTTAGG - Intronic
1129923956 15:79345411-79345433 GTTTCTGCATTAGTTTGCTAAGG + Intronic
1130084167 15:80763364-80763386 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1130249553 15:82289316-82289338 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1130450549 15:84047178-84047200 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1131036588 15:89226515-89226537 CCATCTGTATTCGTTTGCTATGG - Intergenic
1131535940 15:93238062-93238084 GTTTCTGCGTTCGTTTGCTAAGG + Intergenic
1131550888 15:93355908-93355930 GAGTCTGCATTAGTTTGCTAGGG + Intergenic
1131591361 15:93752520-93752542 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1131841570 15:96442766-96442788 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1132240604 15:100254723-100254745 GTTTCTGCATTAGTTTTCTGAGG - Intronic
1202965326 15_KI270727v1_random:169693-169715 GCTTCTGCATTAGTTTCCTGAGG - Intergenic
1133515862 16:6508092-6508114 GCTCCTGCATTAGTTTGCTAAGG - Intronic
1133684355 16:8151578-8151600 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1133873346 16:9710231-9710253 GTGCCTGCATTAGTTTGCTAAGG + Intergenic
1134294045 16:12929518-12929540 GTTTCTGCATTGGTTTGCTGAGG - Intronic
1134299581 16:12977696-12977718 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1134317348 16:13131342-13131364 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1134427643 16:14166772-14166794 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1134776785 16:16860029-16860051 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1135087356 16:19486128-19486150 CCCTCTGTGTTCGTTTGCTGGGG + Intronic
1135142989 16:19937474-19937496 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1135175857 16:20228327-20228349 GCCTCTGCATTAATTTGCTTAGG - Intergenic
1135351641 16:21734249-21734271 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1135450121 16:22550376-22550398 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1135801935 16:25505518-25505540 GGTCCTGCATTCGTTTGCTGAGG + Intergenic
1135895073 16:26393445-26393467 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1135944087 16:26849819-26849841 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1135954027 16:26940622-26940644 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1136063516 16:27743121-27743143 GTTTCTGCATTAGTTTACTGAGG + Intronic
1137226053 16:46510690-46510712 GTGTCTGTGTTAGTTTGCTGAGG - Intergenic
1137777834 16:51071324-51071346 CCGTCTGCATTCGTTTCTTGTGG - Intergenic
1137826937 16:51506052-51506074 GCTTCTGCATTAATTTGCTTAGG + Intergenic
1138119412 16:54387116-54387138 GTGAGTGCATTCCTTTGCTGTGG - Intergenic
1138319664 16:56101382-56101404 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1138968184 16:62111281-62111303 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1138969202 16:62124214-62124236 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1139617474 16:68107026-68107048 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1139989082 16:70924678-70924700 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1140008675 16:71108046-71108068 GTTTCTGCATTAGTTTGCTAGGG - Intronic
1140655784 16:77137905-77137927 GTACCTGCATTAGTTTGCTGAGG + Intergenic
1140693408 16:77507412-77507434 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1141056030 16:80815201-80815223 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1141269879 16:82529407-82529429 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1141765211 16:86053632-86053654 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1141836642 16:86544935-86544957 GTTCCTGCGTTCGTTTGCTGAGG - Intronic
1142932063 17:3293835-3293857 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1142943570 17:3404704-3404726 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1143345691 17:6247181-6247203 AGGTTTGCATTAGTTTGCTGGGG + Intergenic
1143870271 17:9953223-9953245 GTTCCTGCATTCGTTTGCTAAGG - Intronic
1144043769 17:11436367-11436389 GTGTCTGTATTAGTTTGCTTGGG - Intronic
1144224352 17:13130593-13130615 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1144432446 17:15206650-15206672 GCTTCTGCATTAGTTTGCAGAGG - Intergenic
1144468412 17:15515665-15515687 GGGTCTCCATTCCTTGGCTGTGG - Intronic
1145126991 17:20309661-20309683 GTTTGTGCATTAGTTTGCTGAGG + Intronic
1146751433 17:35384865-35384887 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1148967088 17:51445183-51445205 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1149230876 17:54532526-54532548 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1149381051 17:56094266-56094288 GTGTCTGCATTAGTTTCCTAGGG - Intergenic
1149386026 17:56144190-56144212 GCCTCTGCATTCATTTGGTTTGG - Intronic
1149405744 17:56349106-56349128 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1149417022 17:56470050-56470072 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1149455428 17:56784091-56784113 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1150154765 17:62843660-62843682 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1150163639 17:62920439-62920461 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
1150531934 17:65993203-65993225 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1150542624 17:66119072-66119094 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1151087291 17:71395056-71395078 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1152035861 17:77872373-77872395 GTATCTGCATTCGTTTCCTGGGG + Intergenic
1152811229 17:82383700-82383722 GCCTCTGCTTTCGTTTGCCCTGG + Intergenic
1153358159 18:4161355-4161377 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1153460526 18:5328066-5328088 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1153545159 18:6197375-6197397 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1153686564 18:7552036-7552058 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1154422558 18:14247167-14247189 GTTTCTGCATTGGTTTGCTTAGG - Intergenic
1154457820 18:14546020-14546042 GTTTCTGCATTAGTTTCCTGAGG - Intergenic
1155079131 18:22390259-22390281 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1155125340 18:22869899-22869921 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1155448330 18:25936268-25936290 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1155544155 18:26898190-26898212 GTTCCTGCATTCGTTTGCTGAGG + Intergenic
1155581158 18:27308258-27308280 GTTTCTGCATTAGTTTGATGGGG - Intergenic
1155683456 18:28518298-28518320 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1155919107 18:31585129-31585151 GTTTCTGCGTTCGTTTGCTGAGG + Intergenic
1156208873 18:34916781-34916803 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1156328870 18:36100793-36100815 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1156364971 18:36417331-36417353 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1156561884 18:38134601-38134623 GTTTCTGTATTCGTTTGCTAAGG + Intergenic
1156566093 18:38192757-38192779 GCTCCTGCTTTAGTTTGCTGAGG - Intergenic
1156958875 18:42998807-42998829 GCCTCTTCATTCTTTTGCAGGGG + Intronic
1156964539 18:43074775-43074797 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1157139704 18:45093570-45093592 GTCACTGCATTAGTTTGCTGAGG - Intergenic
1157778825 18:50419691-50419713 GTTTCTGCATTGGTTTGCTAAGG + Intergenic
1157980147 18:52370442-52370464 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1158307733 18:56125146-56125168 GTTCCTGCATTAGTTTGCTGCGG + Intergenic
1158329600 18:56346928-56346950 GTTTCTGCGTTAGTTTGCTGAGG + Intergenic
1158382136 18:56943427-56943449 ATGTCAGCATTCGGTTGCTGTGG + Intronic
1158575622 18:58635140-58635162 GTTTGTGCATTGGTTTGCTGAGG + Intergenic
1158839566 18:61369791-61369813 GTTCCTGCATTCGTTTGCTAAGG - Intronic
1158858412 18:61567594-61567616 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1159068919 18:63600748-63600770 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1159182389 18:64925372-64925394 GCTCCTGCATTAGTTTGCTGAGG - Intergenic
1159234121 18:65649002-65649024 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1159364188 18:67444996-67445018 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1159507061 18:69352076-69352098 CTGTCTGCATTCCTTTGCTAGGG + Intergenic
1159538785 18:69749034-69749056 GTTCCTGCATTAGTTTGCTGGGG - Intronic
1159554556 18:69931837-69931859 ACCTCTGCATTAGTTTGCTAGGG + Intronic
1159616433 18:70585400-70585422 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1159772010 18:72557633-72557655 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1160112210 18:76044313-76044335 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1160180615 18:76632162-76632184 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1160578914 18:79872758-79872780 GAATCTGCATTTGTTTGGTGAGG - Intronic
1161176449 19:2845229-2845251 GTTTCTGCATGAGTTTGCTGAGG + Intronic
1161467290 19:4438288-4438310 GTGCCTGCGTTAGTTTGCTGAGG + Intronic
1162853255 19:13448235-13448257 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1162879975 19:13651246-13651268 CCATATGTATTCGTTTGCTGGGG + Intergenic
1163075542 19:14887598-14887620 GTTTCTGCGTTAGTTTGCTGAGG + Intergenic
1163995471 19:21042072-21042094 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1164730247 19:30498317-30498339 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1164883530 19:31758219-31758241 TCCTCTGCATTCTGTTGCTGTGG - Intergenic
1164929079 19:32160087-32160109 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1164999727 19:32751215-32751237 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1165107390 19:33479683-33479705 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1165985344 19:39763946-39763968 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1166949953 19:46420452-46420474 GGCTCTGTATTCGTTTCCTGTGG - Intergenic
1167188720 19:47967380-47967402 TCTTCTGTATTAGTTTGCTGGGG + Intergenic
1167201791 19:48070622-48070644 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1167339885 19:48908967-48908989 GAGGCTGCACTTGTTTGCTGAGG + Intronic
1167717292 19:51151966-51151988 GAGTCTGTATTAGTTTCCTGTGG + Intronic
1168165490 19:54544335-54544357 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1168178152 19:54640534-54640556 GTTCCTGCATTGGTTTGCTGAGG + Intronic
1168359887 19:55730636-55730658 GTCCCTGCATTCGTTTGCTAAGG - Intronic
925012110 2:493955-493977 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
925041397 2:733966-733988 CCATCTGCATTCGTTTTCTATGG - Intergenic
925268548 2:2584843-2584865 GCTCCTGTATTAGTTTGCTGAGG - Intergenic
925331961 2:3065338-3065360 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
925420877 2:3710469-3710491 GTTCCTGCATTAGTTTGCTGAGG + Intronic
925528338 2:4830157-4830179 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
925964461 2:9050976-9050998 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
926347456 2:11961193-11961215 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
927440446 2:23112422-23112444 GTTTCTGCATTGGTTTGCTGAGG + Intergenic
928165022 2:28964751-28964773 GTTCCTGCATTGGTTTGCTGAGG + Intronic
928475461 2:31622232-31622254 GCTTCTGTGTTAGTTTGCTGAGG + Intergenic
928808307 2:35189441-35189463 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
929256388 2:39815605-39815627 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
929422361 2:41806092-41806114 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
930350756 2:50251293-50251315 GTTCCTGCATTAGTTTGCTGAGG + Intronic
930840346 2:55838374-55838396 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
930855851 2:56017357-56017379 TCCTCTGCATTCCTTTGCTGAGG + Intergenic
931547298 2:63403151-63403173 GTTTCTGCATTAGTTTGCTAAGG - Intronic
932060659 2:68494765-68494787 GTTCCTGCATTAGTTTGCTGAGG + Intronic
932068877 2:68595887-68595909 GTTCCTGCATTAGTTTGCTGAGG + Intronic
932532975 2:72557526-72557548 GTTCCTGCATTAGTTTGCTGAGG - Intronic
933150104 2:78904093-78904115 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
933223364 2:79716570-79716592 GTTCCTGCATTAGTTTGCTGAGG + Intronic
933436070 2:82251460-82251482 GTTTCTGCATTAGTTTCCTGAGG + Intergenic
933453492 2:82490396-82490418 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
933587828 2:84199264-84199286 GATTCTGCATTAGTTTGCTTAGG + Intergenic
933601975 2:84341961-84341983 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
933869594 2:86552884-86552906 GATCCTGCATTAGTTTGCTGAGG - Intronic
934015201 2:87873103-87873125 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
934478615 2:94613342-94613364 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
935065893 2:99647372-99647394 GCTCCTGCATTAGTTTGCTGAGG - Intronic
935078715 2:99771137-99771159 GTTCCTGCATTAGTTTGCTGAGG - Intronic
935127405 2:100236453-100236475 GCTATTGCATTCGTTTGCTAAGG - Intergenic
935231482 2:101101774-101101796 GTTCCTGCATTAGTTTGCTGAGG - Intronic
935883753 2:107593276-107593298 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
935888785 2:107652842-107652864 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
935890194 2:107668651-107668673 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
936173415 2:110197008-110197030 GTTCCTGCATTAGTTTGCTGAGG - Intronic
936783920 2:116069306-116069328 GCTTCTGCACTAGTTTGCTAGGG - Intergenic
936807724 2:116357305-116357327 GTTTCTACATTAGTTTGCTGAGG + Intergenic
936832658 2:116667507-116667529 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
937397717 2:121553069-121553091 GTTTCTGCATTAGTTTGCTAAGG - Intronic
937446754 2:121964964-121964986 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
937546920 2:123033682-123033704 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
937700059 2:124853920-124853942 GTTCCTGCATTCGTTTGCTAGGG + Intronic
937728307 2:125194035-125194057 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
938675523 2:133629857-133629879 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
938913464 2:135909012-135909034 GTTCCTGCATTAGTTTGCTGAGG - Intronic
938982233 2:136537810-136537832 GGGTCTGCATTAGTTTGCTAAGG - Intergenic
939022388 2:136974461-136974483 GTTCCTGCATTGGTTTGCTGAGG + Intronic
939087381 2:137737815-137737837 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
939119468 2:138099540-138099562 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
939639494 2:144622049-144622071 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
939874744 2:147564867-147564889 GTTTCTGCATTAGTTTGCTAGGG - Intergenic
940068466 2:149655996-149656018 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
940073377 2:149714454-149714476 GTTCCTGCATTCGTTTGCTGAGG - Intergenic
940195956 2:151094419-151094441 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
940367453 2:152863803-152863825 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
940395279 2:153182724-153182746 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
940402556 2:153264666-153264688 GCTCCTGCATTAGTCTGCTGAGG - Intergenic
940457895 2:153924322-153924344 TGTTCTGCATTAGTTTGCTGAGG + Intronic
940696481 2:156985346-156985368 ATTTCTGCATTAGTTTGCTGAGG + Intergenic
940708474 2:157133212-157133234 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
941276475 2:163497279-163497301 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
941537017 2:166736588-166736610 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
941743502 2:169061747-169061769 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
941794237 2:169582674-169582696 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
941810910 2:169755265-169755287 GTTCCTGCATTAGTTTGCTGAGG + Intronic
942387354 2:175456429-175456451 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
942618675 2:177823787-177823809 GGGTCTGCTTTGTTTTGCTGTGG + Intronic
943322361 2:186461360-186461382 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
944116060 2:196187310-196187332 GTCCCTGCATTAGTTTGCTGAGG + Intergenic
944299286 2:198104303-198104325 GTTTCTGCATTAGTTTGCTTAGG + Intronic
944342370 2:198617253-198617275 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
944359028 2:198829800-198829822 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
944364239 2:198897925-198897947 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
945327955 2:208505026-208505048 GTTGCTGCATTAGTTTGCTGAGG + Intronic
945429154 2:209744565-209744587 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
945438958 2:209855174-209855196 GTTCCTGCATTAGTTTGCTGAGG - Intronic
945524532 2:210871796-210871818 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
945559095 2:211315968-211315990 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
945635109 2:212339275-212339297 GTTCCTGCATTAGTTTGCTGAGG + Intronic
945714346 2:213338741-213338763 GTTACTGCATTAGTTTGCTGAGG - Intronic
946594127 2:221287442-221287464 GTTCCTGCATTCGTTTGCTAAGG - Intergenic
946740603 2:222797347-222797369 TCATCTGCATTTATTTGCTGAGG - Intergenic
946838118 2:223793451-223793473 GTTTCTGCGTTCGTTTGCTGAGG - Intronic
946981424 2:225220215-225220237 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
947097833 2:226586342-226586364 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
947448345 2:230182185-230182207 GTTCCTGCATTAGTTTGCTGAGG - Intronic
947491444 2:230598637-230598659 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
947879958 2:233499271-233499293 GTTCCTGCATTAGTTTGCTGAGG + Intronic
948077858 2:235180309-235180331 GTGCCTGCGTTCGTTTGCTTAGG + Intergenic
948669264 2:239556701-239556723 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1168959418 20:1858543-1858565 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1169184818 20:3605634-3605656 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1169418477 20:5438865-5438887 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1169465867 20:5837577-5837599 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1169610175 20:7370474-7370496 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1170771933 20:19340501-19340523 CCATCTGTATTCGTTTGCTAGGG - Intronic
1171155965 20:22874430-22874452 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1171206348 20:23284130-23284152 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1171232065 20:23495076-23495098 GTTTCTGCATTAGTTTGCTTAGG + Intronic
1171247350 20:23622296-23622318 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1172875100 20:38159236-38159258 GCTCCTGCGTTCGTTCGCTGAGG - Intronic
1173012443 20:39194505-39194527 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1173567176 20:44049754-44049776 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1173612135 20:44377164-44377186 GTTTCTGCATTAGTTTGCTTCGG - Intronic
1173952243 20:47002468-47002490 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1174089144 20:48033051-48033073 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1174710222 20:52696725-52696747 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1174785084 20:53424827-53424849 GCTTCTGTATTAGTTTGCTGAGG + Intronic
1174878058 20:54248963-54248985 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1174933479 20:54841788-54841810 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1174980717 20:55391490-55391512 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1175014695 20:55776891-55776913 GTCCCTGCATTCGTTTTCTGAGG + Intergenic
1175601592 20:60278515-60278537 GTTTCTGCATTTGTTTGCTAAGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1176521068 21:7824897-7824919 GCTCCTGCGTTAGTTTGCTGAGG - Intronic
1176523124 21:7839909-7839931 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1176816336 21:13607287-13607309 GTTTCTGCATTAGTTTCCTGAGG + Intergenic
1176850906 21:13912791-13912813 GTTTCTGCATTGGTTTGCTTAGG + Intergenic
1176885907 21:14255677-14255699 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1177165250 21:17594723-17594745 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1177411259 21:20733413-20733435 GCATCTACATTAGTTTGCTAGGG + Intergenic
1177556216 21:22692177-22692199 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1177691746 21:24519073-24519095 GATCCTGCATTAGTTTGCTGAGG - Intergenic
1177963344 21:27696633-27696655 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1177967833 21:27750470-27750492 GTTTCTGCATTAGTTTGCTATGG + Intergenic
1178034031 21:28560842-28560864 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1178243411 21:30928625-30928647 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1178355851 21:31910126-31910148 GGTTCTGCTTTGGTTTGCTGGGG + Intronic
1178484635 21:33010878-33010900 GAGTCTGCATTTGTCTGCTAGGG + Intergenic
1178655088 21:34454909-34454931 GCTCCTGCGTTAGTTTGCTGAGG - Intergenic
1178657144 21:34469921-34469943 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1178812899 21:35899689-35899711 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1179021389 21:37644103-37644125 GTTTCTGCATGAGTTTGCTGAGG - Intronic
1179272839 21:39865037-39865059 GCATCTGTGTTCGTTTCCTGTGG + Intergenic
1179337756 21:40473969-40473991 TCGTCTGCATTCATCTGCTAGGG - Intronic
1179402257 21:41095179-41095201 GCTTCTGTATTCGTTTGCTAAGG + Intergenic
1179637796 21:42724550-42724572 AAATCTGCATTCTTTTGCTGGGG - Intronic
1180052513 21:45337875-45337897 AAATCTGCATTCGTTTTCTGGGG - Intergenic
1180193131 21:46178311-46178333 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1181385164 22:22539601-22539623 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1181905439 22:26191464-26191486 GTTTCTGCATTAGTTTGCTGAGG - Intronic
1182195564 22:28512654-28512676 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1182761674 22:32727250-32727272 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1182922795 22:34095709-34095731 GTTGCTGCATTAGTTTGCTGAGG - Intergenic
1183794941 22:40109045-40109067 GTTCCTGCATTAGTTTGCTGAGG + Intronic
949433096 3:3999573-3999595 GTTCCTGCATTCATTTGCTGAGG - Intronic
949509586 3:4756593-4756615 GTTCCTGCATTCGTTTGCTGAGG + Intronic
949524901 3:4893875-4893897 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
949653522 3:6189491-6189513 CTGTCTGCATTAGTTTGCTTGGG + Intergenic
949711974 3:6881403-6881425 GTTTCTGCATTAGTTTGCTGAGG + Intronic
950920188 3:16686139-16686161 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
951257254 3:20464340-20464362 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
951365287 3:21774148-21774170 GTTCCTGCATTAGTTTGCTGAGG - Intronic
951451289 3:22841902-22841924 GCTCCTGCATTACTTTGCTGAGG + Intergenic
951720564 3:25693337-25693359 GTTTCTGCATTAGCTTGCTGAGG + Intergenic
951897148 3:27620361-27620383 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
951921394 3:27858674-27858696 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
951994589 3:28713252-28713274 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
952103175 3:30038361-30038383 GTTTCTGCACTAGTTTGCTGAGG + Intergenic
952694689 3:36250831-36250853 GGGTCTGCTTCTGTTTGCTGGGG - Intergenic
953079651 3:39603860-39603882 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
953478742 3:43230314-43230336 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
953727377 3:45411952-45411974 TGGCCTGCATTAGTTTGCTGAGG + Intronic
953816829 3:46164626-46164648 GCGCCTGCATTAGTTTGCTGAGG + Intronic
954118253 3:48478987-48479009 GTGTCTTCATTAGTGTGCTGGGG - Intronic
954144429 3:48627389-48627411 GTGTCTGCATGCGTTTCATGTGG - Intronic
954474599 3:50732120-50732142 GTTTCTGCTTTAGTTTGCTGAGG - Intronic
954900836 3:54018246-54018268 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
954970348 3:54646509-54646531 GTTCCTGCATTAGTTTGCTGAGG + Intronic
954993137 3:54858241-54858263 GGGTCTGCATTCCTGAGCTGAGG - Intronic
955116982 3:56015473-56015495 GTTCCTGCATTAGTTTGCTGAGG + Intronic
955119186 3:56038812-56038834 GTTCCTGCATTAGTTTGCTGAGG - Intronic
955421087 3:58738451-58738473 GTTCCTGCATTAGTTTGCTGAGG + Intronic
955434560 3:58888668-58888690 GTTCCTGCATTAGTTTGCTGAGG + Intronic
955582203 3:60435921-60435943 GTTCCTGCATTCGTTTGCTAAGG + Intronic
955709172 3:61760858-61760880 GTTCCTGCATTAGTTTGCTGAGG + Intronic
955811688 3:62797543-62797565 GCTCCTGCATTCGTTTGCTAAGG - Intronic
956032133 3:65049963-65049985 GCCTCTGCTTTAGTTTCCTGTGG + Intergenic
956160635 3:66347854-66347876 GTTCCTGCATTAGTTTGCTGAGG - Intronic
956236116 3:67072770-67072792 GTTTCTGCATTAATTTGCTGAGG + Intergenic
956318054 3:67961710-67961732 GTGCCTGTATTAGTTTGCTGAGG - Intergenic
956434425 3:69219884-69219906 GTTCCTGCATTAGTTTGCTGAGG + Intronic
956689944 3:71866979-71867001 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
956981360 3:74642458-74642480 GCATTTGTATTCGTTTGCTAGGG + Intergenic
957241475 3:77666314-77666336 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
957914066 3:86663415-86663437 GTTCCTGCATTAGTTTGCTGGGG - Intergenic
957938950 3:86979829-86979851 GCGTGTGCATACATTTGGTGGGG + Intronic
958458664 3:94365963-94365985 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
958623830 3:96599719-96599741 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
958660756 3:97063430-97063452 GCTCCTGCATTTGTTTGCTGGGG - Intronic
958782527 3:98559987-98560009 GTTCCTGCATTAGTTTGCTGAGG - Intronic
958815649 3:98911756-98911778 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
959046095 3:101475432-101475454 GTTCCTGCATTAGTTTGCTGAGG - Intronic
959451402 3:106507510-106507532 GTGTCTGCATTAATTTGCTTAGG + Intergenic
960019811 3:112936062-112936084 GTTTCTGCATTAGTTTGCTGAGG + Intronic
960234737 3:115268945-115268967 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
960265286 3:115614384-115614406 GTTTCTGCATCAGTTTGCTGAGG - Intergenic
960306808 3:116071861-116071883 GTTACTGCATTAGTTTGCTGAGG + Intronic
960681724 3:120255180-120255202 GTTCCTGCATTAGTTTGCTGAGG - Intronic
960782668 3:121336979-121337001 GTTCCTGCATTCGTTTGCTAAGG - Intronic
960791903 3:121441500-121441522 GTGTCTGCCTTCTTTTGCTAAGG + Intronic
960863459 3:122176513-122176535 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
960868373 3:122225952-122225974 GTTTCTGCATTAGTTTGCTTAGG - Intronic
961699719 3:128733455-128733477 GTGTCTGTATTCATTTGCTAGGG + Intronic
961931735 3:130540769-130540791 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
962973519 3:140426389-140426411 GTTCCTGCATTAGTTTGCTGAGG + Intronic
963362376 3:144290866-144290888 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
963493338 3:146028912-146028934 GCTCCTGCATTTGTTTACTGAGG + Intergenic
963587117 3:147205941-147205963 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
963755109 3:149226763-149226785 ACTCCTGCATTAGTTTGCTGAGG + Intergenic
963965079 3:151359190-151359212 GTTTCTGCATTAGTTTGCTTAGG + Intronic
964052145 3:152407858-152407880 GTTTCTACATTAGTTTGCTGAGG - Intronic
964054358 3:152434316-152434338 GCTTCTGTATTAGTTTGCTTAGG + Intronic
964498719 3:157324597-157324619 GTTCCTGCATTAGTTTGCTGAGG + Intronic
964507932 3:157420051-157420073 GTTTCTGCATTAGTTTGCTGAGG - Intronic
964529877 3:157655958-157655980 GTTCCTGCATTAGTTTGCTGAGG + Intronic
964776910 3:160289186-160289208 GTTTCTGCATTAGTTTGCTAAGG - Intronic
964828488 3:160856535-160856557 GTTTCTGCATTAGTTTGCTTAGG - Intronic
965246532 3:166278714-166278736 GCATCTGCATGAGTTTGCTTAGG - Intergenic
965548280 3:169937520-169937542 GTTCCTGCATTAGTTTGCTGAGG + Intronic
966080511 3:175994349-175994371 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
966131567 3:176646588-176646610 GTGTCTGGATTCATTTTCTGTGG - Intergenic
966267383 3:178062887-178062909 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
966331374 3:178818536-178818558 GTTTCTGCGTTAGTTTGCTGAGG + Intronic
966370893 3:179249761-179249783 GTTTCTGCATTAGTTTGCTGAGG - Intronic
966377113 3:179307642-179307664 GTTTCTGCGTTAGTTTGCTGAGG - Intergenic
966404105 3:179577743-179577765 GTTCCTGCATTAGTTTGCTGAGG + Intronic
966488398 3:180498013-180498035 GTTTCTGCATTATTTTGCTGAGG + Intergenic
966543949 3:181123315-181123337 GGCTCTGCATTCGTTTGCTTAGG + Intergenic
966651891 3:182310559-182310581 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
966978140 3:185104704-185104726 GTTTCTGCATTAGTTTGCTAAGG - Intronic
967384950 3:188902041-188902063 GCTTCTGCATTTGATGGCTGTGG - Intergenic
967442531 3:189525804-189525826 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
967508165 3:190277655-190277677 GTTGCTGCATTGGTTTGCTGAGG + Intergenic
967575284 3:191082786-191082808 GCTCCTGCATTGGTTTGCTAAGG - Intergenic
968035669 3:195545389-195545411 TCATCTGCATTCATTTGTTGTGG - Intergenic
968975264 4:3818957-3818979 TCCTCTGCATTCGTCTGCTCGGG + Intergenic
969036483 4:4257944-4257966 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
969184796 4:5467186-5467208 GCCTCTGTATTCGTTTCCTGGGG + Intronic
969557213 4:7919907-7919929 GTTTCTGCCTTAGTTTGCTGAGG + Intronic
969691537 4:8706691-8706713 CCGACTGCATTCGTTTCCTGGGG - Intergenic
969692785 4:8713710-8713732 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
970124323 4:12792367-12792389 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
970290776 4:14569756-14569778 GCTTTTGCATTAGTTTGCTAAGG + Intergenic
970357118 4:15266571-15266593 GCTTCTGCATTATTTTGCTTAGG + Intergenic
970443332 4:16103830-16103852 ATGTCTGTATTCGTTTCCTGGGG + Intergenic
970571793 4:17390527-17390549 GTTTCTGCACTAGTTTGCTGAGG + Intergenic
970895540 4:21099341-21099363 GTTCCTGCATTAGTTTGCTGAGG - Intronic
971078498 4:23178874-23178896 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
971141386 4:23928856-23928878 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
971429031 4:26544080-26544102 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
971489610 4:27197838-27197860 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
971995317 4:33956660-33956682 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
971995849 4:33962996-33963018 GGTTTTGCATTAGTTTGCTGAGG + Intergenic
972106767 4:35497446-35497468 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
972574261 4:40337600-40337622 GAGGCTGCATTAGTTTGCTAGGG + Intronic
972763566 4:42130945-42130967 GTTCCTGCATTAGTTTGCTGAGG - Intronic
973165140 4:47067991-47068013 GTTCCTGCATTAGTTTGCTGAGG + Intronic
973568423 4:52212274-52212296 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
973678682 4:53293182-53293204 GCTCCTGCATTAGATTGCTGAGG - Intronic
973728013 4:53795352-53795374 GTTTCTGCGTTAGTTTGCTGAGG - Intronic
974104916 4:57458947-57458969 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
974233278 4:59145853-59145875 GTTTCTGCATTCATTTGCTGAGG + Intergenic
974541008 4:63235785-63235807 GCATCTGTATTAGTTTGCTAGGG + Intergenic
974836070 4:67252591-67252613 GTTTCTGCAATAGTTTGCTGAGG + Intergenic
975105631 4:70565735-70565757 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
975192654 4:71483436-71483458 GTTCCTGCATTCGTTTGCTAAGG + Intronic
975889095 4:79003486-79003508 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
976116249 4:81730760-81730782 GTTCCTGCATTCGTTTGCTGAGG - Intronic
976164259 4:82237401-82237423 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
976204029 4:82607550-82607572 GCATATGCATTGGTTTGCTAGGG - Intergenic
976396223 4:84558474-84558496 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
976687091 4:87825949-87825971 GTTCCTGCATTGGTTTGCTGGGG + Intronic
976804815 4:89035102-89035124 GTTTCTGCATTAGTTTGCTTAGG - Intronic
976936688 4:90644730-90644752 GTGCCTGCATAAGTTTGCTGAGG + Intronic
977484401 4:97623900-97623922 GTTTCTGCATTAGTTTGCTGAGG + Intronic
977519435 4:98062175-98062197 GTTCCTGCATTAGTTTGCTGAGG - Intronic
977619739 4:99122834-99122856 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
977647663 4:99432193-99432215 GTTTCTGCATTCGTTTGCTCAGG - Intronic
977655378 4:99515424-99515446 GTTCCTGCATTAGTTTGCTGAGG - Intronic
977737662 4:100436740-100436762 GTTTCTGCATTCGTTTGCTGAGG - Intronic
978022663 4:103832739-103832761 CTTTCTGCATTAGTTTGCTGAGG + Intergenic
978147316 4:105391064-105391086 GCTCCTGCATTAGTTTGCTGAGG - Intronic
978205925 4:106081398-106081420 GTGCCTGCATTAGTTTGCTGAGG - Intronic
978211816 4:106146324-106146346 GTTTCTGCATTAGTTTGCTGAGG - Intronic
978288405 4:107107246-107107268 GTTTCTGCACTAGTTTGCTGAGG + Intronic
978538594 4:109790702-109790724 GTTTCTGCATTTGTTTACTGAGG + Intronic
978900253 4:113940368-113940390 GCCCCTGCATTAGTTTGCTGAGG - Intronic
979105646 4:116683202-116683224 GCTCCTGCAGTCTTTTGCTGTGG - Intergenic
979180010 4:117713647-117713669 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
979219158 4:118201049-118201071 GTTTCTGCATTAATTTGCTGAGG + Intronic
979662653 4:123275757-123275779 GCTGCTGCATTAGTTTGCTTAGG + Intronic
979853707 4:125605792-125605814 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
980021617 4:127717250-127717272 GTTCCTGCATTAGTTTGCTGAGG + Exonic
980273959 4:130623684-130623706 GTTACTGCATTAGTTTGCTGAGG - Intergenic
980555439 4:134397375-134397397 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
980644420 4:135624220-135624242 GTTTCTGCATTACTTTGCTGAGG + Intergenic
980703763 4:136464990-136465012 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
980817868 4:137972095-137972117 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
981079048 4:140620057-140620079 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
981458074 4:144979368-144979390 GTTCCTGCATTAGTTTGCTGAGG + Intronic
981866045 4:149420356-149420378 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
982421233 4:155200732-155200754 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
982525609 4:156474113-156474135 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
982617564 4:157659564-157659586 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
982813272 4:159853879-159853901 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
982843039 4:160216964-160216986 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
983478475 4:168243983-168244005 GTTTCTGCATTTGTTTTCTGAGG - Intronic
983659094 4:170114224-170114246 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
983693027 4:170495754-170495776 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
983699606 4:170576041-170576063 GCTCCGGCATTAGTTTGCTGAGG - Intergenic
983715664 4:170778266-170778288 GTTTCTGCATTCATTTGCTTAGG - Intergenic
983717894 4:170808141-170808163 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
983791099 4:171798090-171798112 GTTTCTGCATTCGTTTGCTTTGG + Intergenic
983852385 4:172597514-172597536 GAGTCTACATTATTTTGCTGTGG + Intronic
984075870 4:175178964-175178986 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
984202289 4:176739471-176739493 GCTCCTGCATTAGTTTGCTCAGG - Intronic
984332138 4:178337457-178337479 GCTTCTGCATTAATTTGCTTAGG - Intergenic
984447930 4:179860755-179860777 ACATGTGCATTCGTTTTCTGTGG - Intergenic
984516642 4:180749604-180749626 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
984628011 4:182030345-182030367 GTCCCTGCATTAGTTTGCTGAGG + Intergenic
985071954 4:186174344-186174366 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
985206524 4:187543692-187543714 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
985836281 5:2274426-2274448 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
985984156 5:3499976-3499998 GTTTCTGCATGAGTTTGCTGAGG - Intergenic
986056416 5:4141773-4141795 GTTCCTGCATTTGTTTGCTGAGG - Intergenic
986100819 5:4609496-4609518 GTTTCTGCATTGGTTTGCTAAGG - Intergenic
986268031 5:6207177-6207199 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
986598643 5:9449296-9449318 GTTTCTGCATTAGTTCGCTGAGG - Intronic
986648722 5:9943727-9943749 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
986716636 5:10529132-10529154 GTTTCTGCCTTAGTTTGCTGAGG + Intergenic
986888337 5:12267949-12267971 GTTCCTGCATTCGTTTGCTAAGG + Intergenic
986991740 5:13561804-13561826 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
987275114 5:16354391-16354413 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
987490527 5:18575376-18575398 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
987991407 5:25217346-25217368 ATTTCTGCATTAGTTTGCTGAGG - Intergenic
988004080 5:25385187-25385209 GTTTCTGCATTAGTTTGCTGGGG + Intergenic
988129320 5:27081771-27081793 GTTTCTGCATTAGTTTGCTAAGG - Intronic
988181556 5:27801214-27801236 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
988192538 5:27957856-27957878 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
988434892 5:31162888-31162910 GCTCCTGCATTAGTTTGCTGAGG - Intergenic
988665880 5:33326813-33326835 GCTCCTGCATTAGTTTGCTGAGG + Intergenic
988920891 5:35941389-35941411 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
989067072 5:37474842-37474864 GTTTCTGCATTAGTTTGCTGAGG + Intronic
989356582 5:40550210-40550232 GCTTCTGCGTTAGTTTGCTGAGG + Intergenic
989681720 5:44037320-44037342 GTTCCTGCATTGGTTTGCTGAGG + Intergenic
990352881 5:54936580-54936602 ACGACTGCATTCGTTTGCTAGGG + Intergenic
990480101 5:56202023-56202045 GTTCCTGCATTAGTTTGCTGAGG - Intronic
990858533 5:60299663-60299685 GTTCCTGCATTAGTTTGCTGAGG + Intronic
991027530 5:62046324-62046346 GTTTCTGCATTGGTTTGCTTAGG + Intergenic
991134294 5:63163207-63163229 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
991593473 5:68278588-68278610 GGTTCTGTATTCGTTTGCTCAGG + Intronic
991659340 5:68934412-68934434 GTTTCAGCATTAGTTTGCTGAGG + Intergenic
992284601 5:75221051-75221073 GTTTCTGCATTAGTTTGCTAAGG - Intronic
992361625 5:76044172-76044194 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
992365920 5:76089290-76089312 GTTCCTGCATTAGTTTGCTGAGG + Intronic
992601983 5:78410408-78410430 GTTCCTGCATTAGTTTGCTGAGG + Intronic
992736311 5:79725342-79725364 GTTTCTGCATTCATTTGCTTAGG - Intronic
992755367 5:79900212-79900234 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
992890342 5:81198378-81198400 GTTTCTGCATTAGTTTGCTTAGG + Intronic
992919883 5:81503863-81503885 GTTTCTGCATTAGTTTGCTAAGG - Intronic
993083009 5:83325572-83325594 GTTCCTGCATTAGTTTGCTGAGG + Intronic
993301248 5:86213688-86213710 GTTTCTGCATTGGTTTCCTGAGG + Intergenic
993308622 5:86299917-86299939 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
993335975 5:86659323-86659345 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
993453664 5:88102410-88102432 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
993794888 5:92254951-92254973 GCATCTGCATTAGTTTGCTAAGG - Intergenic
993881182 5:93363312-93363334 GCTCCTGCATTAGTTTGCTAAGG - Intergenic
993894837 5:93522086-93522108 GTTCCTGCATTCGTTTGCTAAGG - Intergenic
993995659 5:94719546-94719568 GTTCCTGCATTAGTTTGCTGAGG - Intronic
994162945 5:96577094-96577116 GTTTCTGCCTTAGTTTGCTGAGG + Intronic
994299286 5:98127257-98127279 GTTTCTGCATTAGTTTGCCGAGG - Intergenic
994403938 5:99319310-99319332 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
994960388 5:106594714-106594736 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995081324 5:108053990-108054012 GTTCCTGCATTAGTTTGCTGAGG - Intronic
995211533 5:109545022-109545044 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
995665849 5:114541262-114541284 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
996055669 5:118979727-118979749 GTTCCTGCATTAGTTTGCTGAGG - Intronic
996462661 5:123764723-123764745 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
996681562 5:126233048-126233070 GTTCCTGCATTCGTTTGCTAAGG - Intergenic
996689230 5:126320261-126320283 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
997046640 5:130326846-130326868 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
997754531 5:136383657-136383679 GTTCCTGCATTAGTTTGCTGAGG + Intronic
997909265 5:137853415-137853437 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
998046906 5:138994973-138994995 GTTTTTGCATTAGTTTGCTGAGG + Intronic
998668338 5:144324804-144324826 GTTCCTGCATTAGTTTGCTGAGG - Intronic
998905564 5:146900894-146900916 GTTCCTGCATTAGTTTGCTGAGG + Intronic
999052645 5:148540099-148540121 CCTTCTGCATTAGTTTCCTGAGG - Intronic
999665871 5:153912360-153912382 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
999836082 5:155374468-155374490 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
999973560 5:156888964-156888986 GTTTCTGCGTTAGTTTGCTGAGG - Intergenic
1000560953 5:162788731-162788753 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1000823074 5:166009434-166009456 GTGCCTGCATTAGTTTGCTAAGG + Intergenic
1000894370 5:166837558-166837580 GAGGCTGCATTAGTTTGCTAGGG + Intergenic
1001136338 5:169105719-169105741 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1002633222 5:180594497-180594519 GCCTCTGTATTCATTTCCTGAGG + Intergenic
1002652711 5:180713470-180713492 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1002938064 6:1691238-1691260 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1003525829 6:6896194-6896216 GATCCTGCATTAGTTTGCTGAGG - Intergenic
1003815546 6:9836240-9836262 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1003924719 6:10866937-10866959 GCTCCTGCGTTAGTTTGCTGAGG - Intronic
1004034091 6:11905043-11905065 GCGCCTGCATTAGTTTGCTAAGG + Intergenic
1004084640 6:12433446-12433468 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1004276717 6:14243168-14243190 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1004725590 6:18308567-18308589 CCATCTACATTCTTTTGCTGTGG + Intergenic
1004776405 6:18850798-18850820 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1004823259 6:19392934-19392956 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1005011934 6:21344098-21344120 GCTCCTGCATTAGTTTGCTAAGG - Intergenic
1005216157 6:23531113-23531135 GCTTCTGCCTTCTTTTGCTTGGG - Intergenic
1005845740 6:29776920-29776942 GTTTCTGCATTAGTTTGTTGAGG - Intergenic
1006049188 6:31327855-31327877 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1008037733 6:46763632-46763654 GCTTCTGAATTAGTTTGCTAGGG - Intergenic
1008309187 6:49944198-49944220 GTTTCTGTATTAGTTTGCTGAGG + Intergenic
1008331910 6:50255404-50255426 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1008676393 6:53823754-53823776 CCTCCTGCATTAGTTTGCTGAGG + Intronic
1008711230 6:54229632-54229654 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1008729865 6:54468417-54468439 GTTCCTGCATTCGTTTGCTGAGG - Intergenic
1008734530 6:54527039-54527061 GAGTCTGTATTAGTTTGCTAGGG + Intergenic
1008842758 6:55924119-55924141 GTTTCTGCATTGGTTTGCTAAGG - Intergenic
1008948222 6:57123388-57123410 GTTTCTGCATTAGTTTGCTTAGG - Intronic
1009640605 6:66330943-66330965 GTTCCTGCATTAGTTTGCTGGGG + Intergenic
1010467814 6:76189740-76189762 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1010481798 6:76364031-76364053 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1010548618 6:77191228-77191250 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1010867821 6:81001809-81001831 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1010995728 6:82530190-82530212 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1011992231 6:93536203-93536225 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1012049151 6:94317836-94317858 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1012166145 6:95955094-95955116 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1012503366 6:99915600-99915622 GTTCCTGCATTTGTTTGCTGAGG + Intergenic
1012518285 6:100089454-100089476 GTTCCTGCATTCGTTTGCTAAGG + Intergenic
1012563871 6:100621211-100621233 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1012563927 6:100621967-100621989 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1012601021 6:101096886-101096908 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1012831073 6:104204191-104204213 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1012834544 6:104248718-104248740 GTTTCTGCATTAGTTTGCTTGGG - Intergenic
1012848749 6:104422567-104422589 GTATCTGCGTTAGTTTGCTGAGG - Intergenic
1012857313 6:104517752-104517774 ATTTCTGCATTAGTTTGCTGAGG + Intergenic
1013046765 6:106493690-106493712 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1013332034 6:109112553-109112575 GCTTTTGAATTTGTTTGCTGTGG + Intronic
1013399888 6:109782992-109783014 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1013761531 6:113524032-113524054 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1013956653 6:115849954-115849976 GTTTCTGTATTAGTTTGCTGAGG - Intergenic
1014005489 6:116412968-116412990 GTGTCTGCATTACTTTGCTTAGG + Intronic
1014023040 6:116613159-116613181 GTTACTGCATTAGTTTGCTGAGG - Intergenic
1014340063 6:120193376-120193398 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1014359100 6:120453112-120453134 GTTTCTACATTGGTTTGCTGAGG - Intergenic
1014368901 6:120580424-120580446 GTTTCTGTATTAGTTTGCTGAGG + Intergenic
1014578773 6:123108367-123108389 GTCCCTGCATTAGTTTGCTGAGG + Intergenic
1014821600 6:125994857-125994879 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1015051321 6:128843715-128843737 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1015322280 6:131889495-131889517 GTTTCTGCATTAGTTTGCTAAGG + Intronic
1015343638 6:132130699-132130721 GCATCTGCCTTCTTTTCCTGTGG + Intergenic
1015662610 6:135592025-135592047 GTGTCTGTATTTGTTTGCTTAGG + Intergenic
1015672519 6:135706374-135706396 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
1015902360 6:138081269-138081291 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1015963482 6:138674581-138674603 ACTCCTGCATTAGTTTGCTGAGG + Intronic
1016178023 6:141104796-141104818 GGTCCTGCATTAGTTTGCTGAGG - Intergenic
1016226256 6:141742219-141742241 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1016287911 6:142493848-142493870 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1016398390 6:143651568-143651590 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1016451164 6:144183994-144184016 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1016568580 6:145487103-145487125 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1016674794 6:146751242-146751264 GCTCCTGCATTAGTTTGCTGAGG + Intronic
1016733885 6:147455122-147455144 GTATCTGCATTAGTTTGCTAAGG - Intergenic
1016845411 6:148564024-148564046 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1016847399 6:148581856-148581878 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1017217087 6:151921196-151921218 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1017269231 6:152487311-152487333 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1017390179 6:153929547-153929569 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1017390612 6:153934988-153935010 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1017426546 6:154327949-154327971 CTTTCTGCATTAGTTTGCTGAGG - Intronic
1017983686 6:159424351-159424373 GTGTCTGTGTTCGTTTCCTGGGG + Intergenic
1018053015 6:160028054-160028076 GTGTCTGTATTAGTTTGCTCAGG + Intronic
1018184053 6:161250070-161250092 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1018211211 6:161483905-161483927 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1018332454 6:162745263-162745285 GTGTCTGTGTTGGTTTGCTGAGG - Intronic
1020146013 7:5643654-5643676 GTGTATGCATTCTTTTGCTGTGG + Intronic
1020599443 7:10253720-10253742 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1021371868 7:19859270-19859292 GTGTATGCATTTGTTTGGTGCGG + Intergenic
1021374417 7:19889006-19889028 GGGGCTGCATTCCTTTGGTGGGG + Intergenic
1021526986 7:21598850-21598872 GCTCCTGCATTAGTTTGCTGAGG + Intronic
1022228308 7:28386839-28386861 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1022313590 7:29221723-29221745 GTTCCTGCATTCGTTTGCTGAGG + Intronic
1022365815 7:29715004-29715026 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1023195725 7:37636609-37636631 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1023238834 7:38120330-38120352 GTTTCTGCTTTAGTTTGCTGAGG - Intergenic
1023253831 7:38292987-38293009 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1023310453 7:38881249-38881271 GCGCCAGCATTCCTTGGCTGTGG + Intronic
1024123812 7:46271306-46271328 GCACCTGCATTAGTCTGCTGGGG - Intergenic
1024590576 7:50879298-50879320 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1024679971 7:51675618-51675640 GTTCCTGCATTCGTTTGCTGTGG + Intergenic
1025784265 7:64630180-64630202 GTGCCTGTATTAGTTTGCTGGGG - Intergenic
1026161878 7:67876611-67876633 GTTTCTGCGTTAGTTTGCTGAGG + Intergenic
1026231464 7:68487792-68487814 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1026256233 7:68714276-68714298 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1026491882 7:70870587-70870609 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1026598093 7:71751360-71751382 GTTTCTGCGTTAGTTTGCTGAGG - Intergenic
1026617265 7:71916548-71916570 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1027168308 7:75851920-75851942 GTTTCTGCATTAGTTTGCTTAGG + Intronic
1027418734 7:77999451-77999473 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1027713903 7:81644773-81644795 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1027771799 7:82416375-82416397 ATGTCTGGATTCGTTTGCTCAGG + Intronic
1028080100 7:86565189-86565211 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1028301926 7:89210608-89210630 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1028702415 7:93795427-93795449 GTTCCTGCATTCGTTTGCTGAGG + Intronic
1029038902 7:97552236-97552258 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1029297818 7:99555463-99555485 GAGTGTGCATTCGTGTGCTAGGG - Intronic
1029857464 7:103532170-103532192 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1029964658 7:104726594-104726616 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1030265909 7:107621705-107621727 CTGTCAGCATTCCTTTGCTGCGG - Exonic
1030402309 7:109067558-109067580 CCTTCTGCATTAGTTTCCTGAGG + Intergenic
1030495591 7:110295515-110295537 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1031097114 7:117433627-117433649 GTTTTTGCATTAGTTTGCTGAGG - Intergenic
1031118546 7:117694610-117694632 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1031240028 7:119225974-119225996 GCTCCTGCATTAGTTTGCTAAGG - Intergenic
1031249703 7:119363974-119363996 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1031594590 7:123634313-123634335 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1031668632 7:124516806-124516828 GTTCCTGCATTCGTTTGCTTAGG + Intergenic
1031718640 7:125140230-125140252 GTTCCTGCATTCATTTGCTGAGG + Intergenic
1031831528 7:126632761-126632783 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1032175813 7:129624949-129624971 TGGACTGCATTCGTTTCCTGGGG + Intronic
1032396503 7:131593757-131593779 GGTTGTGCATTAGTTTGCTGAGG + Intergenic
1032911716 7:136439754-136439776 ATTTCTGCATTAGTTTGCTGAGG + Intergenic
1033976630 7:147110637-147110659 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG + Intronic
1035843741 8:2841114-2841136 GTGCCTGCATTAGTTTGCTGAGG - Intergenic
1036920400 8:12848189-12848211 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1037295298 8:17393577-17393599 GTTCCTGCATTTGTTTGCTGAGG - Intronic
1037392165 8:18404695-18404717 GTTTCTGCATTGGTTTGCTAAGG - Intergenic
1037841736 8:22249890-22249912 GTGTATGTATTTGTTTGCTGTGG + Intronic
1038282262 8:26176481-26176503 GCTCCTGCATTAGTTTGCTAAGG - Intergenic
1038381343 8:27097276-27097298 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1038432471 8:27511185-27511207 GCCTTTGTATTAGTTTGCTGTGG - Intronic
1038487386 8:27946599-27946621 CAGTCTGTATTAGTTTGCTGAGG - Intronic
1038904204 8:31879821-31879843 GTTTCTGCATTAGTTTGCTAAGG + Intronic
1038915354 8:32015125-32015147 GAGGCTGTATTTGTTTGCTGGGG - Intronic
1038916667 8:32031723-32031745 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1039126536 8:34209068-34209090 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1039223231 8:35358375-35358397 GTGTTTCCATTAGTTTGCTGAGG - Intronic
1039460810 8:37742533-37742555 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1039632209 8:39124287-39124309 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1039674061 8:39640292-39640314 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1040350870 8:46566242-46566264 GTTCCTGTATTCGTTTGCTGAGG - Intergenic
1040774709 8:51027829-51027851 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1040856045 8:51948918-51948940 GTGACTGCATTAGTTTGCTAGGG - Intergenic
1041041276 8:53848653-53848675 GTTCCTGCATTTGTTTGCTGAGG + Intergenic
1041301087 8:56412083-56412105 GTTCCTGCATTAGTTTGCTGTGG + Intergenic
1041364670 8:57089254-57089276 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1041399485 8:57427229-57427251 GCCTCTGCATTAGTTTACTTTGG - Intergenic
1042064693 8:64861251-64861273 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1042503335 8:69533515-69533537 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1042504333 8:69543485-69543507 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1042751471 8:72162501-72162523 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1042851315 8:73218804-73218826 ATTTCTGCATTAGTTTGCTGAGG + Intergenic
1042936359 8:74062507-74062529 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1042976168 8:74472199-74472221 GTTTCTGCATTAGTTTGCTGAGG + Intronic
1043180074 8:77077424-77077446 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1043496298 8:80804553-80804575 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1043671091 8:82885297-82885319 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1043727042 8:83623784-83623806 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1043846237 8:85167293-85167315 GTACCTGCATTAGTTTGCTGAGG - Intergenic
1044116584 8:88343286-88343308 GTTTCAGCATTAGTTTGCTGAGG + Intergenic
1044493513 8:92848760-92848782 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1044653271 8:94521317-94521339 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1044890190 8:96826891-96826913 GTTTCTGCATTAGTTTGCTGAGG + Intronic
1045404208 8:101849085-101849107 GTTCCTGCATTCGTTTGCTAAGG - Intronic
1046148587 8:110193881-110193903 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1046189851 8:110779265-110779287 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1046229190 8:111331203-111331225 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1046447942 8:114347594-114347616 GCTCCTGCGTTCGTTTGCTAAGG - Intergenic
1046561819 8:115847250-115847272 GTTTCTGCATTAGTTTTCTGAGG + Intergenic
1046829856 8:118732800-118732822 GCTCCTGCATTAGTTTGCTGAGG - Intergenic
1046865079 8:119139805-119139827 GTTCCTGCATTTGTTTGCTGAGG + Intergenic
1047721138 8:127640846-127640868 GCGTCTGTTTTCTTTTGATGAGG + Intergenic
1048937902 8:139372147-139372169 GCTTCTGTATTGGTTTCCTGTGG + Intergenic
1049054341 8:140223282-140223304 GCTCCTGCGTTAGTTTGCTGAGG + Intronic
1049537859 8:143190247-143190269 CCCCCTGCATTCGTTTCCTGCGG + Intergenic
1050177496 9:2883473-2883495 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1050263092 9:3861664-3861686 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1050390706 9:5140973-5140995 GCTTCTACATTAGTTTGCTAAGG + Intronic
1050504827 9:6336932-6336954 GCGGCTGCATTCCTTTGGAGGGG - Intergenic
1050859900 9:10414816-10414838 GTTTCTGCATTAGTTTGCTGAGG - Intronic
1050883071 9:10728181-10728203 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1050928082 9:11291009-11291031 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
1050968760 9:11842271-11842293 GTTTCTGCATTAATTTGCTGAGG - Intergenic
1051045975 9:12874120-12874142 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1051296674 9:15603516-15603538 GTCCCTGCATTAGTTTGCTGAGG + Intronic
1051478915 9:17538764-17538786 GTGACTGTATTCGTTTGCTAGGG + Intergenic
1051703522 9:19851590-19851612 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1051861765 9:21633307-21633329 GTTTCTGCATTAGTTTGCTTAGG - Intergenic
1051998972 9:23253093-23253115 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1052089376 9:24308968-24308990 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1052147120 9:25062963-25062985 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1052455348 9:28689950-28689972 GTTTCTGCATTGGTTTGCTGAGG - Intergenic
1053040750 9:34869016-34869038 GTTCCTGCGTTCGTTTGCTGAGG + Intergenic
1053679443 9:40472745-40472767 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1053929437 9:43101090-43101112 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1054284274 9:63152198-63152220 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1054292524 9:63308283-63308305 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1054390544 9:64612757-64612779 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1054505175 9:65903550-65903572 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1055355258 9:75430922-75430944 GTTCCTGCCTTCGTTTGCTGAGG + Intergenic
1056096252 9:83257250-83257272 GTTTCTGCATTAGTTTGCTGAGG - Intronic
1056306687 9:85297785-85297807 CCCTCTGCATTAGTTTCCTGTGG + Intergenic
1056669612 9:88615144-88615166 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1056671385 9:88630673-88630695 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1056826490 9:89879653-89879675 GCCTCTGCATTCATTTCCTAGGG + Intergenic
1056891400 9:90496956-90496978 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1057158154 9:92863145-92863167 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1057508013 9:95652477-95652499 GTTTCTGCATTAGTTTGCTTAGG + Intergenic
1057884577 9:98820358-98820380 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1058208220 9:102134645-102134667 GTTACTGCATTAGTTTGCTGAGG - Intergenic
1058968911 9:110062355-110062377 GTTGCTGCATTAGTTTGCTGAGG + Intronic
1059022703 9:110593793-110593815 GTTGCTGCATTAGTTTGCTGAGG + Intergenic
1059064860 9:111072547-111072569 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1059077194 9:111206091-111206113 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1059131048 9:111749786-111749808 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1059225982 9:112673363-112673385 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1059264927 9:113018505-113018527 GTTTCTGCATTAGTTTGCTAAGG - Intergenic
1059712138 9:116878429-116878451 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1059920457 9:119154619-119154641 GCCACTGTATTCGTTTGCTAGGG + Intronic
1060316698 9:122517975-122517997 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1203531021 Un_GL000213v1:142180-142202 GTTTCTGCATTAGTTTCCTGAGG - Intergenic
1185749948 X:2602947-2602969 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1185824395 X:3235950-3235972 GTTCCTGCATTCGTTTGCTGAGG + Intergenic
1185985469 X:4827787-4827809 GATCCTGCATTAGTTTGCTGAGG - Intergenic
1185997531 X:4968639-4968661 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1186090964 X:6048723-6048745 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1186121970 X:6373195-6373217 GTTTCTGCATTGGTTTGCTTAGG - Intergenic
1186203041 X:7173201-7173223 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1186252140 X:7679752-7679774 GTTTCTGCCTTAGTTTGCTGAGG + Intergenic
1186300305 X:8193493-8193515 GTTCCTGCATTCGTTTGCTAAGG + Intergenic
1186301083 X:8200519-8200541 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1186334527 X:8572396-8572418 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1186740492 X:12512484-12512506 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1186909804 X:14150738-14150760 GTTTCTGTATTAGTTTGCTGAGG + Intergenic
1187605700 X:20880449-20880471 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1187646654 X:21354826-21354848 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1187820283 X:23280127-23280149 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1187943429 X:24403236-24403258 GTTCCTGCATTTGTTTGCTGAGG + Intergenic
1188141340 X:26556183-26556205 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1188215598 X:27472654-27472676 GTTTCTGCGTTAGTTTGCTGAGG + Intergenic
1188234965 X:27716995-27717017 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1188270118 X:28128656-28128678 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1188341940 X:29013590-29013612 GCTCCTGCATTAGTTTGCTGAGG - Intronic
1188536939 X:31207602-31207624 GTTTCTGCATTAGTTTGCTAAGG - Intronic
1188816687 X:34723649-34723671 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1188824783 X:34818313-34818335 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1188826340 X:34840157-34840179 GCTCCTGCATTAGTTTGCTAAGG - Intergenic
1188848847 X:35107349-35107371 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1188874427 X:35412690-35412712 GTTCCTGCATTTGTTTGCTGAGG - Intergenic
1188892634 X:35629608-35629630 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1188952841 X:36397560-36397582 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1188969148 X:36591798-36591820 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1189482415 X:41402673-41402695 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1189599639 X:42609450-42609472 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1189605061 X:42668360-42668382 GTTTCTGCATTCGTTTGCTTAGG - Intergenic
1189651798 X:43197751-43197773 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1189842622 X:45097087-45097109 GTTTCTGCATTCATTTGCTGAGG - Intronic
1189874058 X:45417161-45417183 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1189916611 X:45862117-45862139 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1189925826 X:45953463-45953485 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1190123677 X:47684738-47684760 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1190467159 X:50736520-50736542 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1190589734 X:51987655-51987677 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1190589918 X:51989313-51989335 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1190642346 X:52492844-52492866 GCTCCTGCATTAGTTTGCTAAGG + Intergenic
1190645327 X:52520023-52520045 GCTCCTGCATTAGTTTGCTAAGG - Intronic
1190809623 X:53870627-53870649 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1191032033 X:55984370-55984392 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1191034942 X:56014873-56014895 CCTCCTGCATTAGTTTGCTGAGG - Intergenic
1191074894 X:56442253-56442275 GTTCCTGTATTCGTTTGCTGAGG - Intergenic
1191590356 X:62876501-62876523 GTTGCTGCATTAGTTTGCTGAGG - Intergenic
1191672793 X:63764698-63764720 GCTTCTGCATTAGTTTGCTGAGG - Intronic
1191766076 X:64699521-64699543 GTTTCTGCATTAGTTTGCTGAGG + Intergenic
1192383110 X:70637640-70637662 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1192384212 X:70648979-70649001 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1192595639 X:72405242-72405264 GTTTCTGCATTAGTTTGCTAAGG + Intronic
1192685336 X:73298972-73298994 GACCCTGCATTCGTTTGCTAAGG - Intergenic
1192767501 X:74157059-74157081 GCTCCTGCATTAGTTTGCTTAGG - Intergenic
1193309749 X:79992015-79992037 TGTTCTGCATTAGTTTGCTGAGG - Intergenic
1193354109 X:80496993-80497015 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1193442497 X:81560296-81560318 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1193448300 X:81633846-81633868 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1193637168 X:83965858-83965880 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1193776001 X:85642201-85642223 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1193812674 X:86070036-86070058 GTTTCTTCATTAGTTTGCTGAGG - Intergenic
1193858631 X:86637603-86637625 GCTCCTGCATTAGTTTGCTAAGG - Intronic
1193975295 X:88110866-88110888 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1194152287 X:90340490-90340512 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1194271966 X:91826726-91826748 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1194306631 X:92256823-92256845 GCTTCTGCATTACTTTGCTGAGG + Intronic
1194554568 X:95341186-95341208 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1194563644 X:95454181-95454203 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1194868721 X:99101023-99101045 GTTCCTGCATTCGTTTGCTGAGG - Intergenic
1194902461 X:99530085-99530107 GTTCCTGCATTCGTTTGCTGAGG - Intergenic
1195090697 X:101455924-101455946 GTTTCTGCATTAGTTTGCTTAGG + Intronic
1195171161 X:102269811-102269833 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1195187699 X:102417288-102417310 GTTCCTGCATTAGTTTGCTGAGG - Intronic
1195205714 X:102598709-102598731 GTTGCTGCATTAGTTTGCTGAGG - Intergenic
1195212560 X:102663920-102663942 GTCTCTGCATTAGTTTGCTGAGG + Intergenic
1195275918 X:103280402-103280424 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1195507390 X:105673430-105673452 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1195588678 X:106598661-106598683 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1195715510 X:107814464-107814486 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1195794933 X:108635855-108635877 GCTTCTGCATTAATTTGCTTAGG - Intronic
1195818438 X:108915053-108915075 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1195825309 X:108993316-108993338 GCTTCTGAATTTGTTTGCTCTGG - Intergenic
1196014824 X:110927628-110927650 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1196132537 X:112172884-112172906 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1196346370 X:114664482-114664504 GTATCTGCATTAGTTTGCTGAGG + Intronic
1196559736 X:117131089-117131111 GTTGCTGCATTAGTTTGCTGAGG - Intergenic
1196896620 X:120343208-120343230 GTGACTGCATTAGTTTGCTAAGG + Intergenic
1196969832 X:121096803-121096825 CTGTCTGCATTAATTTGCTGTGG + Intergenic
1197015412 X:121620261-121620283 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1197122783 X:122912003-122912025 GTTTCTGCATTAGTTTGCTGAGG - Intergenic
1197242606 X:124136016-124136038 GTTACTGCATTCGTTTGCTAAGG + Intronic
1197357227 X:125450440-125450462 GTTCCTGCATTAGTTTGCTGTGG - Intergenic
1197394965 X:125915889-125915911 GTTTCTGCATTAGTTTGCTAAGG + Intergenic
1197490592 X:127112025-127112047 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1197573218 X:128176026-128176048 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1197598653 X:128499485-128499507 GTTTCTGCATTAGTTTGCTAGGG + Intergenic
1197614023 X:128672396-128672418 TCTTTTGCATTCATTTGCTGAGG + Intergenic
1197960290 X:131997112-131997134 GTGCCTGCATTAGTTTGCTAAGG + Intergenic
1198170752 X:134103005-134103027 GTCCCTGCATTAGTTTGCTGAGG - Intergenic
1198211416 X:134519732-134519754 GTTCCTGCATTTGTTTGCTGAGG + Intronic
1198211953 X:134524491-134524513 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1198501543 X:137254216-137254238 GTTCCTGCATTCGTTTGCTGAGG - Intergenic
1198560378 X:137843392-137843414 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1199080048 X:143567065-143567087 TGGTTTGCATTAGTTTGCTGAGG - Intergenic
1199129278 X:144165405-144165427 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1199178787 X:144827255-144827277 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1199397414 X:147355477-147355499 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1199515698 X:148673113-148673135 CCATCTGCGTTCTTTTGCTGAGG - Intronic
1199588823 X:149446399-149446421 GTTCCTGCATTAGTTTGCTGAGG + Intergenic
1199620807 X:149698872-149698894 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1200380961 X:155836813-155836835 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1200589215 Y:5048164-5048186 GTTCCTGCATTAGTTTGCTGAGG + Intronic
1201254915 Y:12097844-12097866 GTTCCTGCATTCATTTGCTGAGG - Intergenic
1201497360 Y:14602763-14602785 GTCCCTGCATTAGTTTGCTGGGG - Intronic
1201612536 Y:15859495-15859517 GTTCCTGCATTAGTTTGCTGAGG - Intergenic
1201962923 Y:19701950-19701972 GTTCCTGCATTAGTTTGCTGAGG - Intergenic