ID: 1108485346

View in Genome Browser
Species Human (GRCh38)
Location 13:50917946-50917968
Sequence AAACATACTGAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108485346_1108485350 2 Left 1108485346 13:50917946-50917968 CCATGCTCCATCTCAGTATGTTT 0: 1
1: 0
2: 2
3: 24
4: 269
Right 1108485350 13:50917971-50917993 TGGTCTTTGTGGCTCTGAGTTGG 0: 1
1: 0
2: 1
3: 28
4: 244
1108485346_1108485349 -9 Left 1108485346 13:50917946-50917968 CCATGCTCCATCTCAGTATGTTT 0: 1
1: 0
2: 2
3: 24
4: 269
Right 1108485349 13:50917960-50917982 AGTATGTTTGCTGGTCTTTGTGG 0: 1
1: 0
2: 1
3: 24
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108485346 Original CRISPR AAACATACTGAGATGGAGCA TGG (reversed) Intronic
900006084 1:52898-52920 AAACAAACTGAGATACAGCATGG - Intergenic
900149722 1:1173042-1173064 AGACACACAGAGATGGAGAAAGG + Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902915916 1:19639334-19639356 GATTATAATGAGATGGAGCAAGG - Intronic
903375874 1:22865603-22865625 AATCATACAGACAAGGAGCAGGG - Intronic
905389347 1:37626253-37626275 GAACCTACTGGGATCGAGCAAGG - Intronic
907641894 1:56199014-56199036 CAGCCTACTGAGATGGAACAAGG - Intergenic
908865543 1:68545120-68545142 AAGCATACTGATATGGAGATGGG - Intergenic
908995046 1:70141246-70141268 AAAAATAAGGAAATGGAGCATGG + Intronic
909209217 1:72801215-72801237 AAATTAAATGAGATGGAGCATGG + Intergenic
909490051 1:76216097-76216119 AAAGACCCTGAGATGGTGCATGG - Intronic
909530251 1:76673990-76674012 AAACCTCCTGAGAGGGTGCAGGG + Intergenic
912014415 1:105015050-105015072 AAAAAAACCTAGATGGAGCAGGG - Intergenic
917743138 1:177981232-177981254 AAATAAACTGAGAGGGGGCAGGG - Intronic
918870851 1:189972407-189972429 AATCATTCTGTGATGGAGCAGGG - Intergenic
919091573 1:192983932-192983954 ACACATAATGAGAAGTAGCAAGG - Intergenic
919716020 1:200777386-200777408 AAACACAATGAGAAGAAGCATGG + Intronic
919945366 1:202315300-202315322 AATCTTCCTGGGATGGAGCAGGG - Intronic
921480940 1:215663964-215663986 AGACAAGCTGAGATGGGGCAAGG + Intronic
921827760 1:219692957-219692979 AAACATACTGACAGAGACCAGGG - Intronic
922369423 1:224894501-224894523 AAAAATAGTGAGATGGACCTTGG + Intergenic
922673194 1:227530633-227530655 AAAGATACAGAGCTGCAGCATGG - Intergenic
922972257 1:229752640-229752662 AAACATACTGGGATAAAACAGGG + Intergenic
924317903 1:242817511-242817533 AAATATTATGAGGTGGAGCAAGG - Intergenic
1063409817 10:5828662-5828684 ATAGAAACTGAGATGGAGGACGG + Intronic
1063786377 10:9389548-9389570 CAAAAAACTGAGTTGGAGCAGGG + Intergenic
1065414424 10:25469075-25469097 AAGCAGGCTGAGATGGAGCAGGG - Intronic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1070868783 10:79729349-79729371 AAACATCATGAGATGTAGTATGG + Intergenic
1071635697 10:87251568-87251590 AAACATCATGAGATGTAGTATGG + Intergenic
1071659545 10:87486408-87486430 AAACATCATGAGATGTAGTATGG - Intergenic
1071914698 10:90280286-90280308 AAAGATAATGAGATAGAGAAAGG - Intergenic
1072015342 10:91341339-91341361 CCAGGTACTGAGATGGAGCAGGG + Intergenic
1072422879 10:95304198-95304220 AAGGACACTGAGAAGGAGCAGGG + Intergenic
1074078447 10:110150139-110150161 AAACACTCTGAGGTGGAGGAAGG + Intergenic
1075805973 10:125189133-125189155 AAACATACGGGGTTGGAGGAGGG - Intergenic
1076844893 10:133065288-133065310 AAACATACAGAGCTGCAGCTGGG - Intergenic
1078423304 11:11229728-11229750 CAGCCTAATGAGATGGAGCAGGG - Intergenic
1078579777 11:12529383-12529405 AAACATACAGAGATAGAGGTGGG + Exonic
1081096928 11:38947922-38947944 ACACATACAAACATGGAGCAGGG + Intergenic
1081196754 11:40170555-40170577 AAAGAGAGTGAGATGGAGAATGG + Intronic
1081546922 11:44078180-44078202 AATCATAATCAGATGGATCAGGG - Intronic
1081582950 11:44365055-44365077 AAATTGAGTGAGATGGAGCAGGG - Intergenic
1083715089 11:64570706-64570728 AAGGAAACTGAGATGCAGCAGGG + Intronic
1083945880 11:65922302-65922324 AAACATAGAGAGATGGTGGAGGG + Intergenic
1084222101 11:67688651-67688673 AAACAAATGGAGGTGGAGCACGG + Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1085597883 11:77826807-77826829 AAAAATACTGAATTGGAGCTGGG + Intronic
1086937323 11:92759168-92759190 AAACCTTCTGAGATGGTTCAAGG - Intronic
1087401338 11:97669999-97670021 AAACATAAGTAGATGGGGCATGG - Intergenic
1087562987 11:99815183-99815205 AAACACACTTAAATGTAGCAAGG + Intronic
1087994153 11:104782668-104782690 AAACATGCTGAGATAGGGAAGGG + Intergenic
1088414958 11:109578475-109578497 CAACATACTGAGATCTTGCATGG + Intergenic
1089927439 11:122273264-122273286 AAACAGACAGAAATGGAGAATGG - Intergenic
1091009101 11:131982164-131982186 AAACATACTGGGGTGGAGGGAGG + Intronic
1091496709 12:979278-979300 AAACATACAAAGATTTAGCATGG + Intronic
1091897327 12:4116053-4116075 AAACATGCTGAGATGGTGGGCGG - Intergenic
1092461679 12:8692703-8692725 TAATGTGCTGAGATGGAGCAGGG + Intronic
1093590104 12:20892756-20892778 AAACATACTGACAGGGAAAATGG + Intronic
1095206012 12:39442185-39442207 AAACATACTGACATTAGGCAGGG - Intronic
1096048229 12:48583085-48583107 AAACATTCTGCGATGGAGACTGG - Intergenic
1098139364 12:67436001-67436023 AAACATACTGAGAGAGAACTGGG + Intergenic
1099223988 12:79947122-79947144 AAACATACTGAGAGGAATAAGGG + Intergenic
1099684930 12:85872770-85872792 GAACATACTCACATGGAGGAAGG - Intergenic
1100569732 12:95836779-95836801 AAACTTACTCAGATGCAGAAGGG + Intergenic
1102114859 12:110395036-110395058 AAACATGGAGAGAGGGAGCAGGG + Intronic
1102713159 12:114946198-114946220 AAAAATACAGAGATCAAGCAGGG + Intergenic
1102807065 12:115791470-115791492 AAACCTACTGCTATGGGGCATGG + Intergenic
1103329758 12:120145695-120145717 AAACATTTTGAGATGAAGAAAGG - Intronic
1103383776 12:120515562-120515584 AAACATGCTGAGATGGACCAAGG + Intronic
1103553423 12:121751671-121751693 CAACATACTGACTTGGAGGAAGG - Intronic
1104148146 12:126055321-126055343 AAACATACAGAAATGCAGAATGG - Intergenic
1104573097 12:129942527-129942549 AAACAGGCTGAGATGAAACATGG + Intergenic
1107709091 13:43134814-43134836 TCCCATCCTGAGATGGAGCAGGG - Intergenic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1108900142 13:55392497-55392519 AAACAAACAGAGATGGGGGAGGG - Intergenic
1109264502 13:60181642-60181664 TAAAATACTGAGATGGATTAAGG - Intergenic
1109707422 13:66114604-66114626 ATATAAACTGAGATAGAGCAAGG - Intergenic
1109941056 13:69365974-69365996 AAACAGAGTGAGAGGGAGAAAGG + Intergenic
1110974332 13:81809669-81809691 AAAATTAGTGAGATTGAGCATGG + Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1112416231 13:99205609-99205631 AAACAGATTGAGATGGAGGCAGG + Intronic
1112963263 13:105155078-105155100 CAACCTATTGAAATGGAGCAAGG + Intergenic
1113201560 13:107871996-107872018 AAAATCACTGAGCTGGAGCATGG - Intergenic
1114947277 14:27699431-27699453 AGACATTCTGAGATGGAGATGGG + Intergenic
1115486770 14:33917856-33917878 AAAGCTACAGGGATGGAGCATGG - Intergenic
1115508885 14:34120350-34120372 AATCATACTGAGTTAGGGCAAGG - Intronic
1115833266 14:37365920-37365942 CAACCTACTGAGATTGAGCCAGG - Intronic
1118802661 14:69205339-69205361 AAACATACTGAGGCGAAGCATGG - Intronic
1118878485 14:69805513-69805535 TAACAGAATGAGATGAAGCATGG + Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1121180856 14:91927553-91927575 AAATGTGTTGAGATGGAGCAAGG - Intronic
1122195671 14:100083166-100083188 AGAGATCCTGAGATGCAGCATGG - Intronic
1123832414 15:24154406-24154428 TAAGATCCTGTGATGGAGCAGGG + Intergenic
1123837946 15:24214870-24214892 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123866527 15:24524547-24524569 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123873459 15:24599220-24599242 GAAGATACTGTGATGGATCAGGG - Intergenic
1126194441 15:45916731-45916753 AAACAGCCTGAGATGAGGCAAGG - Intergenic
1126259305 15:46669226-46669248 AAACAAAAGGAGCTGGAGCAAGG + Intergenic
1126573812 15:50178859-50178881 AAATATACTGTGATGGGGGAGGG + Intronic
1126812568 15:52422673-52422695 GAACATACTGTGCTGGAGCAAGG - Intronic
1126875887 15:53040709-53040731 AACCATAATGAGATGAAACAAGG - Intergenic
1128350505 15:66885349-66885371 GAGCATACTGAGAAGGACCAAGG + Intergenic
1129498267 15:76008343-76008365 AAAGATACTGGGATGTAGTATGG - Intronic
1129772249 15:78209714-78209736 ACACAGGCTGAGATGGGGCAGGG - Intronic
1132078896 15:98847793-98847815 AGACATACTGAGATGAAGTTAGG + Intronic
1132447435 15:101938025-101938047 AAACAAACTGAGATACAGCATGG + Intergenic
1134326848 16:13215288-13215310 AAACATCCTGAGTTGTTGCAGGG + Intronic
1135657612 16:24264919-24264941 AAAATTTCTGAGATGAAGCATGG - Intronic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1139309850 16:66019148-66019170 AAACATAAAGAGAGTGAGCAAGG + Intergenic
1140246326 16:73253209-73253231 AAACCTACAGATACGGAGCAGGG + Intergenic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1143113851 17:4569736-4569758 AAACAGACTGAGAAGGTGCAAGG - Intergenic
1143219021 17:5246105-5246127 AAACAAATTGAGATAGAGCAGGG + Intergenic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1145287496 17:21517231-21517253 CAACAGACTGAGACGGAGCATGG + Intergenic
1145390132 17:22449158-22449180 CAACAGACTGAGACGGAGCATGG - Intergenic
1147059395 17:37862658-37862680 AAAAATACTGAGATAGGGCCAGG + Intergenic
1148408672 17:47445160-47445182 AAAAATACTGAGATAGGGCCAGG + Intergenic
1148795973 17:50196914-50196936 AAAGATACTGAGTTGCATCATGG - Intronic
1149918860 17:60637399-60637421 AAAAATACTGAGTAGGAGCGGGG - Intronic
1150976555 17:70093671-70093693 AAACATAGTGAAATGAAGGAGGG + Intronic
1151027183 17:70691534-70691556 AGAAATATTGAGATGGAGGAAGG + Intergenic
1153416747 18:4854164-4854186 AAAGATAATGGCATGGAGCAAGG + Intergenic
1155266904 18:24103138-24103160 TAACATTCTGATGTGGAGCAAGG - Intronic
1155917793 18:31573079-31573101 AAAGATACAGAAATGAAGCAGGG - Intergenic
1160637839 19:94508-94530 AAACAAACTGAGATACAGCATGG - Intergenic
1161204083 19:3031476-3031498 AAACATAAAGAGATGGTGAAGGG - Intronic
1161793402 19:6373707-6373729 ACACATGCTGGGATGGGGCAGGG + Intronic
1162270633 19:9612216-9612238 AAATAAACTGAGGTGGGGCATGG - Intronic
1163331623 19:16642265-16642287 AATCATATTGTGATTGAGCACGG + Intronic
1163687001 19:18717414-18717436 ATAGATGCTGAGCTGGAGCAGGG + Intronic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166348026 19:42178961-42178983 AGACACAGTGAGATGGAGAAAGG + Intronic
1167710927 19:51110071-51110093 GAACAAACTGAGATGATGCATGG - Intergenic
1168525710 19:57087456-57087478 AAACATACTGAAAAGGGGCCGGG + Intergenic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
929133869 2:38603706-38603728 AAACATATTTAACTGGAGCAGGG - Intergenic
931593853 2:63918167-63918189 ACAAAGACTGAGATGAAGCAAGG + Intronic
932270495 2:70404769-70404791 AAACATACAGAGTTGCAGAATGG + Intergenic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
935326838 2:101945425-101945447 AAAAAAAGTGAGATGGGGCAGGG - Intergenic
937373452 2:121318937-121318959 AAACATATTGAGGCTGAGCATGG + Intergenic
937892534 2:126949645-126949667 AACATTATTGAGATGGAGCAAGG + Intergenic
940413080 2:153388899-153388921 AAAAAAACTGAGATGGAGCCTGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940826035 2:158413971-158413993 AAACAGACTGAGATAAATCAAGG + Intronic
941302289 2:163817652-163817674 AAACATACTGAGAAGGAAAATGG - Intergenic
941586876 2:167370583-167370605 AAAGACATTGAGATGGAGTAGGG + Intergenic
941771435 2:169349864-169349886 ACAGACACTGAGATGGAGCTTGG - Intronic
942778634 2:179614290-179614312 AAAAATACAGAAGTGGAGCAAGG - Intronic
943028433 2:182656816-182656838 ACACATACTGAAATAGAGCTTGG + Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946896054 2:224325454-224325476 AAAGATACTGTGATACAGCAAGG + Intergenic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
947398657 2:229712002-229712024 AAACTTACTGAGATGATTCAGGG - Intronic
949080211 2:242090134-242090156 AAACATAGTGGGTAGGAGCATGG + Intergenic
1172394544 20:34591418-34591440 AATCATACTTATATAGAGCAGGG + Intronic
1173411023 20:42809405-42809427 AAGGGCACTGAGATGGAGCAGGG + Intronic
1174356533 20:50001965-50001987 ATAGATACTGAGGTGGAGGATGG - Intergenic
1177416001 21:20794265-20794287 AGACATTGTGAGATAGAGCAAGG + Intergenic
1178621559 21:34181549-34181571 AATCGTTCTGAGATGAAGCAGGG - Intergenic
1180228008 21:46409012-46409034 AAACTTTCTGAGGTGGGGCACGG - Intronic
1181769320 22:25113888-25113910 AAACAAACAGAGACAGAGCAAGG - Intronic
1181772352 22:25135086-25135108 AAACTAAATGAGATGGGGCAGGG - Intronic
1183207322 22:36428448-36428470 AAAGAGACGGAGACGGAGCATGG - Intergenic
1183276565 22:36901711-36901733 AAAGTCACTGAGATGGTGCAGGG + Intergenic
1184241152 22:43211929-43211951 ACAGACACTGAGAGGGAGCACGG + Intronic
1185231727 22:49687637-49687659 AGACATCCTGAGATGGAGGGAGG - Intergenic
949219460 3:1613168-1613190 AAACATAAATAAATGGAGCATGG - Intergenic
952291770 3:32023596-32023618 CAACAAATTGAGATGGAGCAGGG - Intronic
953092866 3:39746992-39747014 ACAGAGAATGAGATGGAGCAGGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955385226 3:58474116-58474138 CAACATACAGAGATAGAACAGGG + Intergenic
957269324 3:78008961-78008983 ATACATGATGAGAAGGAGCAAGG + Intergenic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
958910933 3:99994187-99994209 AAACCTACTGAGACTGAGCCAGG - Intronic
959955031 3:112227104-112227126 AAACCTACTGAGATTGAGCCAGG + Intronic
961435485 3:126913620-126913642 AAACAACCTGAGGTGGGGCAGGG - Intronic
965883487 3:173414872-173414894 AAGCATCCTGAGACAGAGCAGGG + Intronic
966235133 3:177692321-177692343 GAAATTACTGAGATGGAACAGGG + Intergenic
966962455 3:184953868-184953890 AATGAAACTGAGATGGAGCAGGG - Intronic
967511561 3:190319457-190319479 ATACAAAATGAGATAGAGCAAGG - Intronic
967527904 3:190514927-190514949 CTAAATACTGAGAGGGAGCAAGG + Intronic
970215910 4:13760398-13760420 AAACATACAGAAATAGAACAAGG - Intergenic
970795892 4:19912994-19913016 AACCAGACAGAGATGGGGCAGGG + Intergenic
972348978 4:38218315-38218337 AAACATCCTGAGCTGCAACATGG - Intergenic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
973623208 4:52747740-52747762 AAAGAAACTGAGATGCAGCCGGG + Intronic
975552900 4:75631075-75631097 GAAAACACTGAGATGGAGGAAGG + Intergenic
976853054 4:89571061-89571083 AAACATACAGAAGTAGAGCATGG + Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
978382762 4:108147203-108147225 AAAAATACTGACATGGAGTTAGG - Intronic
979206697 4:118046590-118046612 GAACATAATCAGGTGGAGCAAGG - Intronic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
980506606 4:133732049-133732071 ACACATACTGTGATGAACCAAGG - Intergenic
982306930 4:153942355-153942377 CAACATAGTGAGATGGAAGAGGG - Intergenic
982724468 4:158890914-158890936 AAACACACTGTGATAGAGGAAGG + Intronic
982988295 4:162238415-162238437 GACCATTCTGGGATGGAGCAAGG + Intergenic
983985270 4:174052252-174052274 TAACACACTGAGCTGGAGGAAGG - Intergenic
984677622 4:182568380-182568402 AAACAGAATGAGAAGGGGCAAGG + Intronic
989463282 5:41725779-41725801 ACAAATATTGAGATGGAGCAGGG + Intergenic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
990663163 5:58041755-58041777 AAAGAGACTGAGAAGGAGCAGGG + Intergenic
993573029 5:89566650-89566672 AAACTTGCTTAGATGAAGCATGG + Intergenic
994101115 5:95893893-95893915 AAACATACAGAAATGCACCAAGG + Intronic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
994349433 5:98727462-98727484 AAACATTCTGAGAAGGCACATGG - Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995763965 5:115595785-115595807 GTACATTCTAAGATGGAGCATGG - Intronic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
997026598 5:130070465-130070487 AAACTTACTGTGATGTACCAGGG - Intronic
997537683 5:134635275-134635297 ACAGATTTTGAGATGGAGCAGGG + Intronic
998179270 5:139925098-139925120 AAACATATTCAGATGAAGTAGGG + Intronic
999739126 5:154536114-154536136 AGAAATACTGAGATTTAGCAAGG + Intergenic
999799074 5:155016514-155016536 AAACAGCCTGAGACAGAGCAAGG + Exonic
999881608 5:155870825-155870847 AAACCCACAGAGACGGAGCAAGG - Intronic
1000500152 5:162038072-162038094 AGACATAGTGAGGTGGAGCTTGG - Intergenic
1001632972 5:173190303-173190325 AAAACTACTGAGATGAAGAACGG + Intergenic
1003533874 6:6959170-6959192 AAAGACACTGAGATGGAGTTTGG + Intergenic
1006548966 6:34804543-34804565 AATGATACTGAGAAGCAGCAGGG + Intronic
1008202444 6:48607688-48607710 GAGAAAACTGAGATGGAGCAAGG + Intergenic
1008569339 6:52800597-52800619 AAACAGCCTGGGATAGAGCAAGG - Intronic
1008574015 6:52842124-52842146 AAACAGCCTGGGATAGAGCAAGG - Intronic
1008577119 6:52871651-52871673 AAACAGCCTGGGATAGAGCAAGG - Intronic
1008983195 6:57510445-57510467 TACCATACTCAGATGGAGGAAGG - Intronic
1009351158 6:62680622-62680644 AAAAATATTGAGATGGGGCCGGG + Intergenic
1012712001 6:102618346-102618368 AAACATTGTGAGATGGAGTTGGG - Intergenic
1012951302 6:105521022-105521044 GAACATACTGAGATGGAATATGG + Intergenic
1014810000 6:125874352-125874374 CAACATACTAAGTTGGACCACGG - Intronic
1015507703 6:134006691-134006713 AAACACACTTAGAAGGAGAACGG - Intronic
1015653625 6:135492844-135492866 ATACATACTGAGTTGAACCATGG - Intronic
1016632215 6:146246601-146246623 AAACAGACTGTGATAGAACATGG - Intronic
1017176548 6:151510163-151510185 AAACATTCTGAGTAAGAGCATGG + Intronic
1017626964 6:156358684-156358706 ATAAATACTGAGGTGGAGCGGGG + Intergenic
1018471990 6:164105739-164105761 GAAGATACCGAGAAGGAGCAGGG + Intergenic
1018562351 6:165114971-165114993 AAACATAATGAGAGGGAACGCGG + Intergenic
1019600083 7:1877157-1877179 AAACAGACTGACATAGAGCTGGG + Intronic
1023611897 7:41980257-41980279 AGAAACACTGACATGGAGCATGG - Intronic
1024086942 7:45901480-45901502 AAATATACTGAGATAGTGCTGGG + Intergenic
1024582270 7:50809775-50809797 AAAAATGCTGGGATGGAACAAGG - Intergenic
1026435472 7:70393220-70393242 AGACAAACTGAGAAGGAACAAGG - Intronic
1027485960 7:78761964-78761986 AAAAATACTGACATGAGGCATGG + Intronic
1029015855 7:97314910-97314932 AGGCACAATGAGATGGAGCAGGG - Intergenic
1034345061 7:150380951-150380973 AAGCAAAGTGAGATGGAGCAGGG - Intronic
1034529625 7:151687747-151687769 AAACCTCCTGGAATGGAGCAAGG - Intronic
1034578136 7:152019287-152019309 AAACATACTGATGAGGACCAGGG + Intronic
1035373279 7:158392458-158392480 AACCATCCTGGCATGGAGCAGGG + Intronic
1036212736 8:6855300-6855322 CAGCATTGTGAGATGGAGCATGG - Intergenic
1036488545 8:9202131-9202153 ACACACATTGAGACGGAGCAGGG + Intergenic
1036947597 8:13109265-13109287 AAAAATACTGAGATGGGGTGTGG + Intronic
1037357769 8:18040683-18040705 AAACATACTGGGGTGCAGAATGG - Intergenic
1037736821 8:21573889-21573911 GATCAATCTGAGATGGAGCAGGG - Intergenic
1037884412 8:22588848-22588870 AAACATAAAGGGATGAAGCAAGG - Intronic
1038207024 8:25476468-25476490 ACACATACAGAGATGCAGGAGGG - Intronic
1039875474 8:41581338-41581360 AAACATACTAAGATTGTACAAGG - Intronic
1040486611 8:47878617-47878639 ACAGAAACTGAGATGGAGAAGGG - Intronic
1041268629 8:56089217-56089239 AGAGATAATGAGATGGATCAAGG - Intergenic
1041559139 8:59194966-59194988 AAAGGTACTTAGATGGAGAAAGG + Intergenic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1042634778 8:70861717-70861739 AAAAATACTTAGATTGAGCCTGG + Intergenic
1042823447 8:72956718-72956740 ACACACACTGAGAGGGAACAGGG + Intergenic
1043094362 8:75947751-75947773 AGTCATACTGAGGTGGTGCAGGG - Intergenic
1043487757 8:80715339-80715361 AAAGATACTGAGATTCAACAGGG + Intronic
1045074012 8:98542502-98542524 AAAAAAAGAGAGATGGAGCAAGG + Intronic
1045375011 8:101563340-101563362 AAAAAATCTGAGATGGACCAAGG - Intronic
1049511851 8:143031408-143031430 CAACATAGTGAGATGGAGCAGGG + Intergenic
1051418039 9:16863206-16863228 GAATATATTGAGATGGGGCAGGG - Intronic
1053587646 9:39477243-39477265 AAACATACTGAGGCCGGGCATGG - Intergenic
1054578653 9:66887996-66888018 AAACATACTGAGGCCGGGCATGG + Intronic
1056195552 9:84225101-84225123 CAAGAAATTGAGATGGAGCAGGG - Intergenic
1056660707 9:88540916-88540938 AAATCTACTGAGATTGAGCAAGG - Intronic
1059507650 9:114814260-114814282 AGACAGACTGAGATGGAGGCAGG + Intergenic
1060428857 9:123530239-123530261 AAATCTACTTAGATGCAGCAGGG + Intronic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1192139956 X:68638814-68638836 AAACAGACTGGCTTGGAGCAAGG - Intergenic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193763781 X:85499942-85499964 AAACAAAGTGAGAAGGAGAAAGG + Intergenic
1193846616 X:86479411-86479433 AATCAAACTGATATGGAACAGGG - Intronic
1194880358 X:99243112-99243134 AAACCTACTCAGATGGAGCTGGG - Intergenic
1196164427 X:112522904-112522926 AAACAGACTAAGAAGGAGAAAGG - Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1197021401 X:121693959-121693981 AAATATACGGAGATGAAGAAAGG - Intergenic
1198387774 X:136145851-136145873 AAACTTACAGAAATGGAGGACGG + Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1201221381 Y:11774022-11774044 AAATATTATGAGGTGGAGCAAGG - Intergenic
1201586838 Y:15570282-15570304 AACAATGATGAGATGGAGCAAGG - Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202197911 Y:22313915-22313937 AAACTTAATGAGATCGAACAAGG + Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic