ID: 1108488162

View in Genome Browser
Species Human (GRCh38)
Location 13:50949515-50949537
Sequence TGTGACTAAGATATCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108488156_1108488162 4 Left 1108488156 13:50949488-50949510 CCAAATCCTCCATCAAAGGTAAG 0: 1
1: 0
2: 1
3: 18
4: 336
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1108488157_1108488162 -2 Left 1108488157 13:50949494-50949516 CCTCCATCAAAGGTAAGAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1108488158_1108488162 -5 Left 1108488158 13:50949497-50949519 CCATCAAAGGTAAGAAGCTGTGA 0: 1
1: 0
2: 1
3: 17
4: 163
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1108488152_1108488162 25 Left 1108488152 13:50949467-50949489 CCAGAACCTTCAGCCTCATTGCC 0: 1
1: 0
2: 3
3: 22
4: 214
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1108488153_1108488162 19 Left 1108488153 13:50949473-50949495 CCTTCAGCCTCATTGCCAAATCC 0: 1
1: 0
2: 2
3: 18
4: 241
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172
1108488154_1108488162 12 Left 1108488154 13:50949480-50949502 CCTCATTGCCAAATCCTCCATCA 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108488162 Original CRISPR TGTGACTAAGATATCTTTGG GGG Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
914803473 1:150976142-150976164 GGTGACTAAGATGTATTTGAGGG + Intergenic
917243924 1:172979656-172979678 TCTGACTCAGGCATCTTTGGAGG - Intergenic
918284860 1:183042378-183042400 AGTGACTAAGCTCTCTCTGGTGG - Intronic
921387501 1:214585897-214585919 AGAGACTAAGATAGATTTGGTGG + Intergenic
1066008106 10:31166547-31166569 TGGGACCTAGATATCTTTGGGGG + Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1069101871 10:64332142-64332164 CTTGACTAAGATTTCTTTGAAGG - Intergenic
1069195456 10:65545691-65545713 GGTGAATTACATATCTTTGGGGG - Intergenic
1075369852 10:121927151-121927173 CGTGATTCAGATTTCTTTGGGGG - Intronic
1076656963 10:132030968-132030990 TGTGTCTCAGTTATCTTTTGAGG + Intergenic
1079775415 11:24519559-24519581 TTTCACTAAGATAGTTTTGGAGG - Intronic
1080099149 11:28439211-28439233 AGGGACTAGGATATCTGTGGAGG + Intergenic
1080805158 11:35646388-35646410 TGTGACATAGATATTTTTGTGGG + Intergenic
1080905180 11:36537781-36537803 TTTGATTCAGTTATCTTTGGGGG + Intronic
1081667055 11:44922806-44922828 TGCGTCTAAGAAACCTTTGGAGG + Intronic
1084131453 11:67139012-67139034 TGTGCCTAAGATACCATTAGTGG - Intronic
1084605866 11:70171238-70171260 TGTGACCAAGGCATCTTGGGAGG - Intronic
1085439509 11:76545829-76545851 TGTTACAAAGATAACTTTTGAGG + Exonic
1086997959 11:93380322-93380344 TGTGACTCACATATTTTTAGTGG + Intronic
1087646861 11:100818161-100818183 GGTGAACAAGATAACTTTGGAGG - Intronic
1089513001 11:119012414-119012436 TGTGAATAGGATCGCTTTGGAGG - Intronic
1098917359 12:76271464-76271486 TGTGGCTAAGACATCTTTGTTGG - Intergenic
1099837519 12:87925715-87925737 TATGACTAAGATGTTTTTGTTGG + Intergenic
1101000484 12:100352831-100352853 TGTAACTAAGGCATCTTTAGGGG - Intergenic
1102449053 12:113026924-113026946 TGAGGATAAGACATCTTTGGGGG - Intergenic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG + Intronic
1110771480 13:79353200-79353222 TGTAACTAAGTTATCTGTGAAGG - Intronic
1110817108 13:79874140-79874162 TGTGGCTAAGTTATTTTGGGGGG + Intergenic
1111065017 13:83079408-83079430 TGAGACAAAAATGTCTTTGGAGG - Intergenic
1111936241 13:94559740-94559762 TGTAAATAAGATAATTTTGGGGG + Intergenic
1112426563 13:99307105-99307127 TTTGACAAAGATATTTCTGGTGG + Intronic
1112842090 13:103593011-103593033 TATGAATTGGATATCTTTGGGGG - Intergenic
1114776883 14:25494106-25494128 TGAGACTCAGATATCTGAGGAGG + Intergenic
1115614236 14:35077941-35077963 TGTGACTAAGTCATATTTGAAGG + Intronic
1116183729 14:41569402-41569424 ATTGACTAACATATCTTTGTTGG - Intergenic
1120267987 14:82275567-82275589 TGTCATTAAGATATATTTTGGGG + Intergenic
1124375115 15:29124835-29124857 TGTGACTAAGACATTTTAGATGG + Intronic
1124550352 15:30675335-30675357 TGTTACAAAGATATGTTTTGTGG - Intronic
1125636599 15:41193859-41193881 TATGAAGAAGTTATCTTTGGGGG - Intronic
1127603721 15:60564705-60564727 TATCACTCAGATATATTTGGGGG + Intronic
1130102839 15:80906806-80906828 TTTGACTTCGATACCTTTGGGGG + Exonic
1134637875 16:15806454-15806476 TGTGCACAAGATTTCTTTGGGGG + Intronic
1137786718 16:51143900-51143922 TGCAACTAAGATTTGTTTGGTGG - Intronic
1138652675 16:58470466-58470488 AGTGATTAGGATATCTTTGGGGG - Intronic
1141428706 16:83959893-83959915 TGGGACTGAAATATCTGTGGTGG - Intronic
1141567055 16:84909817-84909839 TGTGAGGAAGATATCTCTGTGGG - Intronic
1143075136 17:4335754-4335776 TATGTCTAAGATACCGTTGGTGG - Intronic
1143812494 17:9483500-9483522 CGGGACTAGGATATCTTTGGGGG + Intronic
1144446665 17:15336832-15336854 TATGCCTAAGACCTCTTTGGAGG + Intronic
1148976516 17:51534906-51534928 TGTAACAAAGAGTTCTTTGGTGG - Intergenic
1151239166 17:72744357-72744379 TGTGACAAAGATGTCTTCAGAGG + Intronic
1151529339 17:74694702-74694724 TAGGACACAGATATCTTTGGGGG + Exonic
1152854295 17:82655359-82655381 TGTGACTCAGAGCTCTTTGGAGG - Exonic
1153322434 18:3786221-3786243 TGGGATTTAGACATCTTTGGGGG + Intronic
1154975091 18:21449691-21449713 TGTGACCCAGAACTCTTTGGCGG + Exonic
1155254133 18:23979801-23979823 TGTGACTATGTTATCTTTTATGG + Intergenic
1155900881 18:31388820-31388842 TGTTACTAAAATTCCTTTGGTGG + Intronic
1157010857 18:43646730-43646752 TGTGTATAAGATTTCTTTGTGGG + Intergenic
1158069347 18:53452339-53452361 TGTAACTAAGCTATCTGTAGTGG + Intronic
1158793451 18:60811372-60811394 AATGACTAAAATATTTTTGGTGG + Intergenic
1160059278 18:75514840-75514862 TGTGAACAAGATATTTCTGGTGG - Intergenic
1164698884 19:30268080-30268102 TGTGGCTAATATATCTGGGGGGG - Intronic
927298006 2:21477185-21477207 TGATAATAAGATATCTTTTGGGG - Intergenic
930073317 2:47386681-47386703 TGGGACGAAGACATCTTTGAAGG + Exonic
930975446 2:57453790-57453812 TATGACTATGAGATCTTTGAGGG - Intergenic
931592868 2:63904805-63904827 TATGTCTAAGATTTCTTTTGTGG - Intronic
932202686 2:69845737-69845759 TGGGACTAAGATATTTGTGATGG + Intronic
932237469 2:70132270-70132292 TGTGCCTTAGACATCTTTGGAGG + Intergenic
932292292 2:70592746-70592768 TATGACTCAGATTTCTGTGGAGG + Intergenic
934466377 2:94266742-94266764 AGTGCTTAAGATATGTTTGGAGG - Intergenic
935390883 2:102551562-102551584 TGTGACTAAGTTATGTTTTATGG + Intergenic
941209109 2:162613449-162613471 AGTAACTAAGATATTTTTTGTGG - Intronic
941703581 2:168633344-168633366 TCTGACTGAAATAGCTTTGGAGG + Intronic
941826613 2:169905223-169905245 TGTGGCCAAGAGATTTTTGGAGG + Exonic
943811906 2:192196764-192196786 TGAGATTCAGAAATCTTTGGAGG - Intergenic
944032905 2:195259182-195259204 TGTGACTAAGTTATTTTCAGTGG - Intergenic
944264393 2:197707395-197707417 TGTGTCTAAGATGTCTTCAGGGG + Exonic
945144131 2:206718443-206718465 GGTGACTGAAATATCTTGGGAGG + Intergenic
945578261 2:211559188-211559210 TGGAATTAAGATATATTTGGGGG - Intronic
946543435 2:220711114-220711136 TGTGAATATGTTATCTTTCGTGG + Intergenic
947829120 2:233126294-233126316 TGTCATTAGGATTTCTTTGGGGG - Intronic
1172997369 20:39081130-39081152 TGTGACTAAGAAATGTTTTGAGG + Intergenic
1173051181 20:39563434-39563456 TTTGACACAGATTTCTTTGGGGG - Intergenic
1173451676 20:43169916-43169938 TGTGTTTAATATCTCTTTGGTGG + Intronic
1174964058 20:55190917-55190939 TATGATTAAGAAATATTTGGTGG + Intergenic
1177333552 21:19694080-19694102 TGTGACTATCATCCCTTTGGGGG + Intergenic
1177583680 21:23061370-23061392 TGTGACTAAAACATCTTTGGTGG + Intergenic
1178539180 21:33434963-33434985 TGTAACTCAGAGACCTTTGGCGG - Intronic
1179480833 21:41677614-41677636 TGTCTCTAAGAAATCTTTGCTGG + Intergenic
1180587499 22:16905913-16905935 AGTGCTTAAGATATGTTTGGAGG - Intergenic
953204758 3:40815634-40815656 TGTGACTCAGAAATATTGGGTGG + Intergenic
957343199 3:78927700-78927722 TATGACAAATATATCTTTGAAGG - Intronic
958414503 3:93857962-93857984 TGTAACTAAGATATCAGTCGAGG - Intergenic
958806914 3:98822803-98822825 TGTGTCTGTGATATTTTTGGGGG - Intronic
961017175 3:123477311-123477333 CGTGACCAAGATATTTTTGTAGG + Intergenic
961580487 3:127876977-127876999 TGTGCCTAAGTTTTCTTTGTGGG + Intergenic
962145479 3:132835617-132835639 GGGGTCTAAGATATCTGTGGTGG + Intergenic
962445893 3:135464699-135464721 TGTGACTATGATTTCTGTAGGGG + Intergenic
962486511 3:135848063-135848085 TCTTGCTAAGAGATCTTTGGTGG - Intergenic
962681350 3:137803249-137803271 TGTGATCTGGATATCTTTGGGGG - Intergenic
964384091 3:156128733-156128755 TGTGCCAAAGATAATTTTGGGGG + Intronic
964710622 3:159667846-159667868 TGAGACTAAGAACTGTTTGGTGG - Intronic
965348045 3:167576471-167576493 TGTGAATATGTTATCTTAGGTGG + Intronic
968245604 3:197143847-197143869 TGTGACCAAGATATCTTGAATGG - Intronic
971108295 4:23552194-23552216 TGTGAGTATCATGTCTTTGGTGG - Intergenic
971109449 4:23567024-23567046 TGTGTCTCAGATTTTTTTGGGGG + Intergenic
973088155 4:46095266-46095288 TGTGACTAACATACCTATAGTGG + Intronic
974549652 4:63354767-63354789 TATGACATAGATGTCTTTGGTGG + Intergenic
979523084 4:121690452-121690474 GGTAACTAGGAGATCTTTGGTGG + Intronic
979760971 4:124404546-124404568 TGTATCTAAGATATATTTTGAGG - Intergenic
980624557 4:135357553-135357575 TGGGACTCAGATATCTCTGGAGG + Intergenic
982359138 4:154500033-154500055 TATGACGAAGACATCTTTGTGGG - Intergenic
982995984 4:162346415-162346437 TCAGACTTAGACATCTTTGGGGG - Intergenic
983116674 4:163826288-163826310 AGTTATTAAGATACCTTTGGAGG + Intronic
984582192 4:181523073-181523095 TGGGACAAAGACATCTTTGAAGG + Intergenic
984748148 4:183243696-183243718 TGTGACTAGGGGATCTTTAGGGG + Intronic
987665243 5:20929584-20929606 TGTAACTGAGATTTCTTTTGTGG + Intergenic
989115219 5:37945848-37945870 CCTGGCTAAGATATCTTAGGGGG - Intergenic
992421687 5:76612777-76612799 TGTGTCTAAAATATTTCTGGAGG + Intronic
992538416 5:77736585-77736607 AATGACTAGGATATATTTGGGGG - Intronic
992593624 5:78323378-78323400 TGTAACTAAGATGACTTTGCTGG + Intergenic
993445551 5:88007772-88007794 TGTCACTAAGATGTCTTTCTTGG - Intergenic
993518515 5:88867953-88867975 TGTGAATAATATATATTTTGGGG + Intronic
997077028 5:130691013-130691035 TGTAACTAAGTTATCACTGGTGG - Intergenic
997743751 5:136280230-136280252 GGTGTCCAAGATGTCTTTGGGGG - Intronic
1000734672 5:164884403-164884425 TGGGATTAGGCTATCTTTGGGGG - Intergenic
1005521922 6:26609140-26609162 TAAGACTTAGATATCTTTGAGGG - Intergenic
1008891140 6:56492349-56492371 TCTGACTAAAATATTTTAGGTGG + Exonic
1010403268 6:75472828-75472850 TGTGACTAATATATGTGTTGTGG - Intronic
1011182226 6:84633822-84633844 TGTCACTATGGTATCATTGGAGG + Intergenic
1011485791 6:87840274-87840296 TGTGACCTAGATATCTTTTGGGG - Intergenic
1012769356 6:103409536-103409558 TGTGACTAAGATTTTATTTGGGG + Intergenic
1013054248 6:106568093-106568115 AGAGACTAACATATATTTGGTGG - Intronic
1013089793 6:106889968-106889990 TGTGACTAGGAAATGTCTGGGGG - Intergenic
1015446391 6:133310652-133310674 AGTGACTAAAAGATATTTGGAGG + Intronic
1017032300 6:150235050-150235072 TGGGAATAAGACATCTTTGGTGG + Intronic
1021313989 7:19123603-19123625 TTTTACTAAGGTATCTGTGGTGG - Intergenic
1021787963 7:24171709-24171731 TGTCAGTAAGATATATTTTGGGG - Intergenic
1022202006 7:28126155-28126177 TGTTACTAGGGTAGCTTTGGGGG - Intronic
1023614623 7:42007137-42007159 TGGAGCTAAGATATCTTTGGTGG - Intronic
1027566701 7:79803322-79803344 TGTGACTACTATACTTTTGGGGG + Intergenic
1029134662 7:98360726-98360748 TGTGACTAAGCAATCTTCGAGGG + Intronic
1031327158 7:120416001-120416023 AGTTACTCAGATATCTCTGGAGG - Intronic
1032999610 7:137489373-137489395 TGTAACTGTCATATCTTTGGGGG + Intronic
1033326399 7:140382227-140382249 GGTGTCTAAGATAGTTTTGGTGG - Intronic
1035870497 8:3132172-3132194 TGTGACTGAGATATCTGCTGAGG - Intronic
1037462418 8:19125425-19125447 TGGGTTTAAGATATATTTGGTGG - Intergenic
1039085685 8:33777325-33777347 TATGACTAAGATATCTTTGATGG - Intergenic
1042129948 8:65578739-65578761 GGTAACCAAGATTTCTTTGGTGG + Intergenic
1043597920 8:81905460-81905482 TGTGACTACTATATCTGTGGAGG + Intergenic
1046156646 8:110299318-110299340 TTTGACAGAGATAACTTTGGAGG + Intergenic
1046768116 8:118092111-118092133 TGTCATTAAAATATATTTGGAGG + Intronic
1048493105 8:134912892-134912914 TGTGGCTAAGACGCCTTTGGAGG - Intergenic
1050746502 9:8882582-8882604 TGTGATTAAGATATTTTAGAGGG + Intronic
1050847799 9:10245204-10245226 TATGACTAATCTATCCTTGGAGG - Intronic
1051322956 9:15929599-15929621 TGGGTCTAAGAGATCTGTGGTGG - Intronic
1051589196 9:18758781-18758803 TGAGATGAAGATATCTTCGGGGG + Intronic
1051808151 9:21020003-21020025 TGTGACTGTGAAATCTTTAGAGG + Intronic
1052423279 9:28271789-28271811 TTTGAGTAAGAAAGCTTTGGAGG - Intronic
1053696424 9:40643513-40643535 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1054307675 9:63442741-63442763 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1054406401 9:64766743-64766765 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1054440028 9:65252216-65252238 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1054490377 9:65769723-65769745 AGTGCTTAAGATATGTTTGGAGG + Intergenic
1055026942 9:71732361-71732383 TTTGATTATGATACCTTTGGGGG - Exonic
1058113573 9:101058335-101058357 TCTCACTCAGATATGTTTGGTGG - Intronic
1059236879 9:112768523-112768545 ATTGTCTAAGAGATCTTTGGAGG - Intronic
1059652193 9:116325314-116325336 TGTGACTATGAAACCCTTGGTGG + Intronic
1059741915 9:117160002-117160024 TGTGACTTTCATATCTTTGTGGG - Intronic
1202778872 9_KI270717v1_random:17173-17195 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1203585945 Un_KI270747v1:3582-3604 AGTGCTTAAGATATGTTTGGAGG - Intergenic
1186611509 X:11142533-11142555 TATGACACAGATATCTTTGGGGG - Intronic
1186778879 X:12893155-12893177 TGTTACTAAGTTCTGTTTGGTGG - Intergenic
1187550595 X:20301012-20301034 TGTGACTCAGCTATCTGTAGAGG + Intergenic
1187749422 X:22445613-22445635 TTTGACTAGGACATTTTTGGAGG + Intergenic
1189164702 X:38849446-38849468 TCTGACTCAGATAGCCTTGGTGG - Intergenic
1192098283 X:68236515-68236537 TGTGATTAAGATTTCTTTTTGGG - Intronic
1196557537 X:117106964-117106986 TGTCACTAAGGTATCTTTCAAGG + Intergenic
1197336273 X:125212921-125212943 TGTGATTGAAATGTCTTTGGTGG - Intergenic
1197978667 X:132193703-132193725 TATGAACAAGAAATCTTTGGGGG + Intergenic
1198651813 X:138871466-138871488 AGTGACTCAGATACCCTTGGAGG - Intronic
1198730657 X:139724216-139724238 TGTGATTATGATATATTTTGGGG - Intergenic
1200183616 X:154167277-154167299 TATGACACAGATATCTTTTGCGG - Intergenic
1200189270 X:154204405-154204427 TATGACACAGATATCTTTTGCGG - Intergenic
1200195025 X:154242214-154242236 TATGACACAGATATCTTTTGCGG - Intergenic
1200200675 X:154279335-154279357 TATGACACAGATATCTTTTGCGG - Intronic