ID: 1108490304

View in Genome Browser
Species Human (GRCh38)
Location 13:50975066-50975088
Sequence CCACATAGCCAGAGTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108490304_1108490309 28 Left 1108490304 13:50975066-50975088 CCATGCTTACTCTGGCTATGTGG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1108490309 13:50975117-50975139 AATGATCTGCCAGCTTCCTCTGG 0: 1
1: 0
2: 3
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108490304 Original CRISPR CCACATAGCCAGAGTAAGCA TGG (reversed) Intergenic
901652087 1:10748831-10748853 CCACGTGGCCAGAGCAAGCATGG + Intronic
902615283 1:17620343-17620365 CCTCACAGCCAGAGGAATCAGGG - Intronic
904329573 1:29749498-29749520 GCACAGAGGCAGAGAAAGCAGGG + Intergenic
905217258 1:36417591-36417613 CCTCAGAGGAAGAGTAAGCAAGG - Intronic
905795633 1:40814798-40814820 ACACGTACCCAGAGTCAGCAAGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906844990 1:49182041-49182063 CCAGATGGCTACAGTAAGCAGGG + Intronic
906854643 1:49291802-49291824 CCACAGAGCCAGAGGGAGCCAGG + Intronic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
907518234 1:55006908-55006930 CCACATACCCAAAGCAAACAGGG + Intronic
907732979 1:57085857-57085879 AGGCATAGCCAGGGTAAGCATGG + Intronic
909841323 1:80328962-80328984 CCACAGAGCTACAGTAATCAAGG + Intergenic
910109019 1:83661983-83662005 CCTCAAAGCTAGAGAAAGCATGG - Intergenic
911773321 1:101775354-101775376 CGACAAAGCCAGAGTGAGCCAGG - Intergenic
912963654 1:114218045-114218067 CCACCTAGCCAGAGTAGTCTCGG - Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
917158725 1:172033011-172033033 TCACATAGGCAGAGTAAGAAAGG - Intronic
1066561788 10:36677678-36677700 CCACATTGACATAGGAAGCAGGG - Intergenic
1069503445 10:68975407-68975429 CCACATACTCAGGGTAAGTAGGG + Intronic
1071429401 10:85594813-85594835 CCACAAAGCAAAAGGAAGCATGG + Intergenic
1072441968 10:95464952-95464974 CCACAAAGTCAGAGTGAGCTTGG + Intronic
1073934157 10:108610711-108610733 CCAGATAGCTACAGTAATCAAGG + Intergenic
1074763875 10:116686631-116686653 CCACAGGGCCAGAAAAAGCAAGG + Intronic
1076170162 10:128312419-128312441 CCACATACCCAGAATCAGCCTGG - Intergenic
1078720089 11:13876172-13876194 CCACACAGTCTGAGCAAGCAAGG + Intergenic
1078856921 11:15213664-15213686 ACATATAGGCAGAGAAAGCAGGG - Intronic
1081378996 11:42392121-42392143 ACACATGGGCAGTGTAAGCAAGG - Intergenic
1081633858 11:44707719-44707741 CCACATTGCCATGGGAAGCAAGG + Intergenic
1081852160 11:46281378-46281400 CCCCTTAGCCAGAGGAAGGAGGG - Intronic
1082080586 11:48009639-48009661 CCACATATCCATATAAAGCACGG - Intronic
1082687830 11:56260950-56260972 CCACAGAGCCAGAGTGGGCCAGG - Intergenic
1084381990 11:68818404-68818426 CCACATCGCCAGAGCAAGGGAGG + Intronic
1088826085 11:113495846-113495868 CCACAGAGCCAGGGTGAGCCAGG - Intergenic
1089695318 11:120212692-120212714 CCAGATTGCCATAGTTAGCAGGG + Intronic
1093669811 12:21860306-21860328 CCACAGAGCCAGACTAATCCTGG + Intronic
1093756782 12:22861730-22861752 ACCCATAGCCAGAGTATCCATGG - Intergenic
1096427797 12:51518737-51518759 CCTAATAGCCACAGTAGGCAAGG + Intergenic
1096794996 12:54071186-54071208 ACACAGAGCCAGAGTCAGCATGG + Intergenic
1097992985 12:65856153-65856175 CCACATTGCTGCAGTAAGCATGG + Exonic
1099713730 12:86264496-86264518 CCACAGAGCCAAGGGAAGCAAGG + Intronic
1099838020 12:87932569-87932591 CCACATTGTCAAACTAAGCATGG - Intergenic
1099839975 12:87953184-87953206 GCATAAAGCCAGAGGAAGCAGGG - Intergenic
1102739112 12:115190481-115190503 CCACAGAGAGAGAGAAAGCAAGG + Intergenic
1104861668 12:131927476-131927498 CCACATGGCCAGTGTGTGCAGGG - Intergenic
1105069669 12:133226954-133226976 CCACAAACCCAGAGTCAACACGG + Exonic
1105929019 13:25034413-25034435 CCACCTAGCCACAGAAACCAGGG - Intergenic
1106875945 13:34072932-34072954 CCACATAAACAGAATTAGCATGG - Intergenic
1108490304 13:50975066-50975088 CCACATAGCCAGAGTAAGCATGG - Intergenic
1109565730 13:64114039-64114061 CCTCACAGCAAGAGCAAGCATGG - Intergenic
1110173481 13:72530359-72530381 CCACATGGCCAGAGTCTGGATGG + Intergenic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1130138119 15:81198396-81198418 CCACAAAGCCAGTGAGAGCATGG - Intronic
1130387477 15:83424246-83424268 CCGCAAAGTCAGAGGAAGCATGG - Intergenic
1133932710 16:10245168-10245190 CCTCAGAGGCAGAGCAAGCAGGG - Intergenic
1136672716 16:31873056-31873078 CCACAGAGCCTGAGCCAGCACGG + Intergenic
1137528354 16:49258522-49258544 CCAAATAGCCAAAGTAATCTTGG + Intergenic
1138579594 16:57932104-57932126 CCACAAAGCCACAGAAACCACGG + Intronic
1138664978 16:58558601-58558623 CCTCACACCCAGAGTATGCAGGG - Exonic
1139229853 16:65273233-65273255 CCACTGAGCCAGAGTAAGCTGGG - Intergenic
1139300417 16:65940990-65941012 CCACAAAGCCAAAGCAAGGATGG + Intergenic
1139344982 16:66296966-66296988 CCAAAAAGCCAGAGAAATCAGGG + Intergenic
1143169284 17:4917865-4917887 TCACAAAGCAACAGTAAGCAAGG + Intergenic
1145291360 17:21549181-21549203 CCACATAGCAAGAACAAGCAAGG + Intronic
1145388715 17:22437872-22437894 CCACATAGCAAGAACAAGCAAGG - Intergenic
1146706079 17:35001723-35001745 CCCTATAGCCTGAGTAATCAGGG - Intronic
1149662777 17:58344141-58344163 CCTCATAGCCATGGAAAGCAGGG + Intergenic
1151775797 17:76200912-76200934 ACAGAAAACCAGAGTAAGCATGG - Intronic
1153803056 18:8688371-8688393 CGTCATAGCCAGGGTACGCAGGG - Intergenic
1157126512 18:44961172-44961194 ACACAGAGGCAGAGGAAGCAGGG + Intronic
1162193391 19:8964758-8964780 CCACATGGCCAGAGTCTACAAGG - Exonic
925310871 2:2880642-2880664 GCACATCACCAGAGTTAGCAGGG - Intergenic
929136781 2:38632262-38632284 CCAAATAGCAAAATTAAGCATGG + Intergenic
929349832 2:40937169-40937191 GCACATAGCCAGAGGATGGAGGG - Intergenic
931168738 2:59779551-59779573 CCACAAAGCCACAGTGAGCCAGG - Intergenic
934720347 2:96570652-96570674 TCACATAGGTAGAGTAAGAATGG - Intergenic
935519047 2:104081503-104081525 CCACAAAGGCAGAAAAAGCATGG - Intergenic
937125929 2:119475011-119475033 CCACACTGCAAGAGTGAGCAGGG + Intronic
937821195 2:126313080-126313102 ACACAAAGGCAGAGAAAGCAAGG + Intergenic
945657021 2:212636770-212636792 CGATTTAGCCAGATTAAGCAGGG + Intergenic
947590053 2:231380292-231380314 CCACATGGCAAGAGTAGGGAGGG - Intergenic
948090174 2:235286835-235286857 GCCAATAGCTAGAGTAAGCAAGG - Intergenic
1171337217 20:24395321-24395343 CCTCACAGACAGAGAAAGCAAGG + Intergenic
1173546807 20:43903984-43904006 CCACAGAGCCAGAGACAGCCAGG + Intergenic
1175311201 20:58012667-58012689 CCACACAGCTAGAGGCAGCAAGG + Intergenic
1177044687 21:16154866-16154888 CCACTTACCCAGAGTGACCAGGG + Intergenic
1181088121 22:20453540-20453562 CTACATAGCTACAGTAATCAAGG - Intronic
958099176 3:88987297-88987319 TCACATAGCCAGATAAAGAAAGG + Intergenic
959805124 3:110541907-110541929 CCAGACATCCAGAGAAAGCAAGG + Intergenic
968809830 4:2794787-2794809 CCACATGGACAGAGGAAGCAGGG + Intronic
971514170 4:27466073-27466095 CCCCAAAACCAGAGTAAGCCTGG - Intergenic
972942055 4:44207925-44207947 AAACACAGGCAGAGTAAGCAGGG + Intronic
973635423 4:52857731-52857753 CCACAGAGAGAGAGAAAGCAGGG - Intergenic
975040998 4:69744062-69744084 CCACGAAGCCAGCGGAAGCAGGG - Intronic
975343286 4:73265253-73265275 CAATTTAGCCAGAATAAGCATGG + Intergenic
977187829 4:93962452-93962474 CAACATAGCCAGACTAGGCTGGG - Intergenic
978549204 4:109906676-109906698 CCACATAGCCAAAGCAAGACTGG + Intergenic
981926027 4:150140305-150140327 CCACTTAGCTAGAGAAAACAAGG - Intronic
983428595 4:167619581-167619603 CCAGATGGCCAGAGTGACCATGG + Intergenic
984186235 4:176546939-176546961 CCAAATAGAGAGAGTAATCAGGG + Intergenic
991945600 5:71895782-71895804 CCACATGGCCAGAATAAGGCAGG - Intergenic
992344638 5:75864572-75864594 CCACAGAGCCAGATTCTGCAGGG - Intergenic
994670070 5:102754341-102754363 CCCCAAAGCAAGAGAAAGCAGGG - Intronic
995558813 5:113358683-113358705 CCACATTGCCACAAGAAGCATGG + Intronic
995846063 5:116494915-116494937 GCATAAAGCCAAAGTAAGCAAGG + Intronic
995926775 5:117384406-117384428 CCACATATGCAGAGTGAGCCAGG - Intergenic
995968965 5:117943695-117943717 CCAGATGGCCAGAGGAAGCGTGG - Intergenic
998098707 5:139413865-139413887 TCACATAGGCAGGGTAGGCATGG + Exonic
998635775 5:143953263-143953285 CCACATAGCAGGAGGCAGCATGG + Intergenic
998973710 5:147621246-147621268 CCACAAAGCCAGTGTGAGCTGGG + Intronic
999428797 5:151508738-151508760 CAGCATACCCAGAGTAATCATGG + Intronic
1003672661 6:8173787-8173809 CCACATAAACTGAGTAAACATGG + Intergenic
1004016477 6:11736600-11736622 CCACACAGGGAGAGGAAGCAGGG - Intronic
1006648224 6:35530032-35530054 CCACATACCCATAGAAATCAGGG - Intergenic
1006700188 6:35966143-35966165 TCAGAAAGCCAGAGTAAGCGTGG - Intronic
1007708394 6:43805617-43805639 ACAGAGAGCCAGAGCAAGCACGG - Intergenic
1010114670 6:72288765-72288787 CCACTTTGCCAGAGGAAGAAAGG - Intronic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1012147559 6:95704435-95704457 CCACATAGGAAGAGCAAACAGGG - Intergenic
1012764431 6:103348157-103348179 CCACATTCCCAGAGTGACCACGG - Intergenic
1015346032 6:132160994-132161016 GCACATGAACAGAGTAAGCATGG + Intergenic
1016607057 6:145941738-145941760 CCACATAGCAATAGTGAGGATGG - Exonic
1016883038 6:148929943-148929965 CCACATAGCCAAATCAAACATGG + Intronic
1018637321 6:165874382-165874404 AAATTTAGCCAGAGTAAGCAGGG + Intronic
1018961474 6:168452348-168452370 TAAAATAACCAGAGTAAGCAGGG + Intronic
1029530375 7:101121521-101121543 TCACAGAGCCAGGGTAAGGAAGG + Intergenic
1029968916 7:104770089-104770111 CCAGAAAGCCAGAGTCAGCCTGG + Intronic
1030357844 7:108561930-108561952 CCAGAAAGTCAGAGTAAGGATGG + Intronic
1031351001 7:120730994-120731016 CCAAAGCCCCAGAGTAAGCATGG + Intronic
1031470389 7:122161505-122161527 CCAGATAGACAGAGTAGGAAAGG + Intergenic
1032700158 7:134372286-134372308 CCAGAAAGCCAGAGTACCCAGGG - Intergenic
1035312869 7:157981048-157981070 CAACACAGCCAGAGTGCGCAGGG - Intronic
1035937385 8:3856675-3856697 CCACATGGCCAGTGAAAGCTGGG + Intronic
1036078062 8:5523031-5523053 CCACATAGCCAGGGTAGAGAAGG + Intergenic
1037727658 8:21496342-21496364 CCACAGAGCCAGATTTAACAAGG + Intergenic
1038411530 8:27362984-27363006 CCTCATGGCCAGAGTCAGCTGGG + Intronic
1038508537 8:28107955-28107977 CCTCATAGCCAGTGTAAGACTGG - Exonic
1046018447 8:108634600-108634622 CCACATTGCCAGAGTAAAGGAGG - Intronic
1046315386 8:112494612-112494634 CTACATTTCCAGAGTTAGCAGGG - Intronic
1048221331 8:132544919-132544941 GCAAATAGGCAGAGGAAGCAGGG - Intergenic
1049657248 8:143804339-143804361 CCACATGGCCACAGTCAGCGAGG - Intronic
1050103571 9:2143247-2143269 ACACACAGTCACAGTAAGCAGGG - Intronic
1051609923 9:18951187-18951209 CCACATTGCTTGTGTAAGCAGGG + Intronic
1053481335 9:38418593-38418615 CCACACTGCCAGAGGAACCAGGG + Intronic
1055912281 9:81366413-81366435 CAACCTAGCCAGTGTAAGAAAGG - Intergenic
1057438067 9:95060594-95060616 CCACATACCCAGGGTAACCTGGG - Intronic
1058469041 9:105258087-105258109 CCACATATCCAGATTAAGTCAGG - Intronic
1185744531 X:2561647-2561669 CCTCATTTCCAGAGTAAGCAGGG + Intergenic
1187731390 X:22258824-22258846 CAACACAGCCAGAGTCATCATGG - Intergenic
1190855418 X:54289617-54289639 CCACAAAGCCAGACTGTGCAAGG - Intronic
1192261861 X:69510436-69510458 CCTCATACCCAGTGTTAGCAAGG - Intronic
1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG + Intronic
1199748821 X:150795139-150795161 CCACAGAGCCAGAGCCAGCTTGG - Intronic
1199750689 X:150814777-150814799 CCACAGAGCCAGAGTCAGTCTGG - Intronic
1200342524 X:155413212-155413234 CCACAAAGCAACAGTAATCAAGG + Intergenic
1201648201 Y:16258850-16258872 CCACAGAGCAAAAATAAGCATGG + Intergenic
1201654609 Y:16326451-16326473 CCACAGAGCAAAAATAAGCATGG - Intergenic