ID: 1108494777

View in Genome Browser
Species Human (GRCh38)
Location 13:51014241-51014263
Sequence ATGGGTACAGACTCTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108494770_1108494777 10 Left 1108494770 13:51014208-51014230 CCCTGCACTTGGCCTATGAGGAA No data
Right 1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG No data
1108494769_1108494777 11 Left 1108494769 13:51014207-51014229 CCCCTGCACTTGGCCTATGAGGA No data
Right 1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG No data
1108494771_1108494777 9 Left 1108494771 13:51014209-51014231 CCTGCACTTGGCCTATGAGGAAG No data
Right 1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG No data
1108494773_1108494777 -2 Left 1108494773 13:51014220-51014242 CCTATGAGGAAGAGTTGGTAGAT No data
Right 1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108494777 Original CRISPR ATGGGTACAGACTCTGTGGC TGG Intergenic
No off target data available for this crispr