ID: 1108497022

View in Genome Browser
Species Human (GRCh38)
Location 13:51035334-51035356
Sequence AATAAGAGGGTGTTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108497022_1108497029 10 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497029 13:51035367-51035389 CTGTGACACATGTAAGTCCTGGG No data
1108497022_1108497028 9 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497028 13:51035366-51035388 GCTGTGACACATGTAAGTCCTGG No data
1108497022_1108497033 17 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497033 13:51035374-51035396 ACATGTAAGTCCTGGGGGCTGGG No data
1108497022_1108497031 12 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497031 13:51035369-51035391 GTGACACATGTAAGTCCTGGGGG No data
1108497022_1108497032 16 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497032 13:51035373-51035395 CACATGTAAGTCCTGGGGGCTGG No data
1108497022_1108497030 11 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497030 13:51035368-51035390 TGTGACACATGTAAGTCCTGGGG No data
1108497022_1108497034 18 Left 1108497022 13:51035334-51035356 CCTGTGAGAAACACCCTCTTATT No data
Right 1108497034 13:51035375-51035397 CATGTAAGTCCTGGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108497022 Original CRISPR AATAAGAGGGTGTTTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr