ID: 1108497696

View in Genome Browser
Species Human (GRCh38)
Location 13:51041575-51041597
Sequence TCTCTCAGACTCATGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108497689_1108497696 7 Left 1108497689 13:51041545-51041567 CCTGTAGCCTTTCCTTTGGATGG No data
Right 1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG No data
1108497687_1108497696 11 Left 1108497687 13:51041541-51041563 CCTTCCTGTAGCCTTTCCTTTGG No data
Right 1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG No data
1108497692_1108497696 0 Left 1108497692 13:51041552-51041574 CCTTTCCTTTGGATGGGTCTTGC No data
Right 1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG No data
1108497693_1108497696 -5 Left 1108497693 13:51041557-51041579 CCTTTGGATGGGTCTTGCTCTCT No data
Right 1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108497696 Original CRISPR TCTCTCAGACTCATGGGAGT TGG Intergenic
No off target data available for this crispr