ID: 1108501390

View in Genome Browser
Species Human (GRCh38)
Location 13:51072675-51072697
Sequence GAAGAGTGCTTGGCAAATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108501385_1108501390 -1 Left 1108501385 13:51072653-51072675 CCTATTCTGCCTTCAGGGCCTAG No data
Right 1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG No data
1108501386_1108501390 -10 Left 1108501386 13:51072662-51072684 CCTTCAGGGCCTAGAAGAGTGCT No data
Right 1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108501390 Original CRISPR GAAGAGTGCTTGGCAAATAC GGG Intergenic
No off target data available for this crispr