ID: 1108502833

View in Genome Browser
Species Human (GRCh38)
Location 13:51084117-51084139
Sequence TTCCTTGACGTGTCTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502833_1108502836 -6 Left 1108502833 13:51084117-51084139 CCAGTCTGAGACACGTCAAGGAA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1108502836 13:51084134-51084156 AAGGAATCCAGATGGAGTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 257
1108502833_1108502835 -7 Left 1108502833 13:51084117-51084139 CCAGTCTGAGACACGTCAAGGAA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1108502835 13:51084133-51084155 CAAGGAATCCAGATGGAGTCAGG 0: 1
1: 0
2: 2
3: 32
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502833 Original CRISPR TTCCTTGACGTGTCTCAGAC TGG (reversed) Intergenic
901798656 1:11694558-11694580 TTCCTTCACGTGTGTCGGCCAGG + Intronic
903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG + Intergenic
904033371 1:27546853-27546875 TCCCTTCACCTGTCTCACACAGG + Intronic
905519709 1:38588646-38588668 TTCCTTCACGGGTCATAGACAGG - Intergenic
906686925 1:47768932-47768954 CTCCTTGGCCTGTCTCAGGCTGG - Intronic
910847775 1:91619831-91619853 TTCTTGGAAGTGTATCAGACTGG + Intergenic
911876140 1:103165521-103165543 TTTCTTGCTGTGTCTCTGACAGG + Intergenic
911982961 1:104588648-104588670 TTCTTTGTCGTGTCTCTGCCAGG - Intergenic
912839988 1:113030799-113030821 TTCCCTGACATGTGTCAGATTGG - Intergenic
915399158 1:155610063-155610085 TTCCTAGACGTGGCCCAGTCCGG - Intergenic
915416275 1:155745644-155745666 TTCCTAGACGTGGCCCAGTCCGG - Intergenic
916926811 1:169530232-169530254 TTCCTTGACCTCTCTTAGCCTGG - Intronic
917165229 1:172104807-172104829 TGCCATGACGAATCTCAGACAGG - Intronic
921180491 1:212627985-212628007 CTCCTTCCCATGTCTCAGACAGG - Intergenic
922882895 1:228995777-228995799 TTCCGTGGTGTTTCTCAGACTGG + Intergenic
1063651901 10:7946343-7946365 TTCCCTGGCTTGTCTCTGACTGG + Intronic
1063905347 10:10775282-10775304 CTCCTTGCTGTGCCTCAGACAGG - Intergenic
1068700705 10:60016727-60016749 TTCCTTGACTTTTTTCAGAGTGG + Intergenic
1075555257 10:123426317-123426339 TTCCTCCACGTGCCCCAGACAGG - Intergenic
1076141019 10:128078541-128078563 TTCCATGGCTTGTCTCACACTGG + Intronic
1077091760 11:781861-781883 GTCCTCGACGTGGCCCAGACAGG + Intronic
1088730142 11:112672963-112672985 TTTCTTGCTGTGTCTCTGACAGG - Intergenic
1091101721 11:132880865-132880887 TTTCTTCCCGTGTCTCTGACTGG + Intronic
1097482774 12:60151272-60151294 TTTCTTGTTGTGTCTCTGACAGG + Intergenic
1105707113 13:22974848-22974870 GTCCTTGCCGTGTCCCAGAAAGG + Intergenic
1108502833 13:51084117-51084139 TTCCTTGACGTGTCTCAGACTGG - Intergenic
1109140918 13:58713466-58713488 TTCTTTGACATGTTTCAGAATGG + Intergenic
1114767392 14:25389423-25389445 TTCCTTGACGTATTTCATGCAGG - Intergenic
1115380731 14:32735821-32735843 TTCCTTTTCTTGTCTCAGACAGG - Exonic
1116508310 14:45713417-45713439 TTCATTCACGTGTGGCAGACTGG + Intergenic
1121650899 14:95557518-95557540 TTCCTTGACTTTTTTGAGACAGG + Intergenic
1125643894 15:41254412-41254434 TTTCTTGACCTCTGTCAGACAGG + Intronic
1126015939 15:44350650-44350672 TTCCTTGATGTGTCTTTAACTGG - Intronic
1126194578 15:45917895-45917917 TTCCTAGACTTGTCTCTGCCTGG + Intergenic
1132190996 15:99859434-99859456 TTCCTTGTCATGTCTCTGACTGG + Intergenic
1136032066 16:27510611-27510633 TCCCTTGACGTCCCTCAGAATGG - Intronic
1138119003 16:54383141-54383163 ATCCTTGACATGTCTCAAAAGGG + Intergenic
1139912800 16:70408480-70408502 GTCCTTGACCTGTCTGAGAATGG + Intronic
1141637306 16:85321100-85321122 TGCCTGGAGGTGTCACAGACTGG - Intergenic
1141889180 16:86915209-86915231 TTCCTTGACTTGGCACAGCCGGG - Intergenic
1144806214 17:17969665-17969687 TTCCTTCACAGGTCACAGACGGG + Intronic
1150524107 17:65903641-65903663 TTTCTTGTCGTGTCTCTGCCAGG - Intronic
1156598071 18:38570808-38570830 TTCCCTGACCTGTCACAGAATGG - Intergenic
1157734420 18:50034002-50034024 TTTCTTGATGTGGCTCACACAGG - Intronic
1159415332 18:68139658-68139680 TTTCTTGTTGTGTCTCTGACAGG + Intergenic
1161234402 19:3190695-3190717 TTCCTGCACGGGTCTCACACGGG + Intronic
1162723141 19:12674297-12674319 GTCCTTGACATGTCCCAGCCTGG + Intronic
1165601857 19:37060650-37060672 CTCCCATACGTGTCTCAGACAGG + Intronic
1166826232 19:45611015-45611037 TTCCCTGATGTGCCCCAGACTGG - Intronic
929495526 2:42439011-42439033 TTACTTGACATTTCTCAGCCTGG + Intergenic
929604046 2:43223825-43223847 TTCCTAATTGTGTCTCAGACCGG - Exonic
930839545 2:55830226-55830248 TTCATTGTCGTGTCTCTGCCAGG - Intergenic
932070070 2:68611275-68611297 TTCTTTGACGTATTTCAAACTGG - Intronic
932404437 2:71504020-71504042 GGCCCTGACTTGTCTCAGACAGG + Intronic
937985884 2:127637920-127637942 TTCCTTCCTGTTTCTCAGACTGG + Intergenic
940797838 2:158099412-158099434 TTCTTTGGCGGGTCTCAGAGTGG - Intronic
943715971 2:191152144-191152166 TTCCCTGACGGGTTTCACACAGG + Intergenic
946625969 2:221612702-221612724 GTGCTTGACGTGTATCAGTCAGG + Intergenic
948811247 2:240479530-240479552 TTCCCTGAGGTGGCTCAGGCAGG + Intronic
1177947679 21:27492353-27492375 TCTCTGGACCTGTCTCAGACTGG + Intergenic
1178565794 21:33683135-33683157 TGCCTTGGCGATTCTCAGACTGG + Intronic
1182418297 22:30235626-30235648 TTCCCTGCCCTGTCTCAAACAGG - Intergenic
950981042 3:17304599-17304621 TTTCACCACGTGTCTCAGACTGG + Intronic
958668821 3:97176360-97176382 TTTCTTGATGTGTCTTAGTCTGG + Intronic
959404172 3:105940352-105940374 TTCCTTGACTAGTTTTAGACAGG + Intergenic
962662092 3:137612521-137612543 TTCCTTTATGGGTCTGAGACTGG + Intergenic
962953859 3:140246422-140246444 TTCCTTCACCTGGCTCAAACAGG - Intronic
964566998 3:158067779-158067801 TTTCTTGTTGTGTCTCTGACAGG - Intergenic
983357424 4:166681490-166681512 TTCCTTGAAGTGTCTCCTTCAGG - Intergenic
984373539 4:178897879-178897901 TTGCCTGATGTGTCTCAGAAGGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG + Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
991004825 5:61817691-61817713 TTTCTTTACATGACTCAGACAGG + Intergenic
992587556 5:78256695-78256717 TTCCTTGATGTGTCTTTGTCTGG - Intronic
994056978 5:95428041-95428063 TTCCTTGAATGGTCTCAGTCAGG - Intronic
996318162 5:122184696-122184718 TACCTTGATGTGTCTCAAGCTGG - Intergenic
1002761837 6:208541-208563 TTCCCAGCTGTGTCTCAGACAGG + Intergenic
1004779714 6:18894975-18894997 TTCCCTGACGTCTCTCATTCAGG - Intergenic
1011019586 6:82797328-82797350 TTCCTTGCTGAGTCTCAGCCAGG + Intergenic
1011665685 6:89630577-89630599 GACCTTGACGTTTCTCAGTCGGG - Exonic
1012109816 6:95215195-95215217 TTCCTTGCTGTGTCTCAAACTGG - Intergenic
1016800033 6:148159069-148159091 TACGTGGACGTGTCTCAGACAGG - Intergenic
1018868947 6:167767004-167767026 TTCCTTGAACTGGCTCAGAAAGG + Intergenic
1024516702 7:50265579-50265601 TTCCTTGGCTTGTCTAAGTCAGG + Intergenic
1029626946 7:101725832-101725854 TTCCTTGACGTGTGCTGGACAGG - Intergenic
1031101510 7:117486452-117486474 TTCCTTGACCAGCCTTAGACTGG - Intronic
1032646036 7:133825021-133825043 TTCCTTGACGACTCTCTGGCAGG + Intronic
1033739714 7:144261968-144261990 TTCCTTGGCATTTCTCAGATGGG - Intergenic
1036693255 8:10958093-10958115 TTCCCTCACTTGTGTCAGACTGG + Intronic
1040769302 8:50953660-50953682 TTTTTTGTCGTGTCTCTGACAGG + Intergenic
1040847550 8:51859655-51859677 TTCCTTGAAGTGTCTGAGTTTGG - Intronic
1041550681 8:59097255-59097277 TTCCTTGGGGTTTCTCAGACAGG - Intronic
1042310428 8:67373862-67373884 TTCATGGGCGTGTCACAGACTGG - Intergenic
1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG + Intergenic
1056637609 9:88344632-88344654 TTCCTTGAAGTCTCTCATAGGGG + Intergenic
1057628188 9:96697323-96697345 TTTCTTGAGGTGTCTCTGTCTGG - Intergenic
1060429919 9:123542227-123542249 TTCCTTGACATGTGTCTGGCTGG - Intronic
1190560190 X:51679327-51679349 TTCCTTGACGCTTGTCAGAAAGG + Intergenic
1190564101 X:51713994-51714016 TTCCTTGACGCTTGTCAGAAAGG - Intergenic
1193316341 X:80069874-80069896 TTCTTTGTTGTGTCTCTGACAGG + Intergenic
1193754266 X:85387707-85387729 TTCCTTGTTGTGTCTCTGCCAGG - Intergenic
1196383926 X:115127214-115127236 TTCATTTACATGTCTCAGATTGG - Intronic
1200371524 X:155730214-155730236 TTTCTTGATGTGTCTCTGTCTGG - Intergenic