ID: 1108502903

View in Genome Browser
Species Human (GRCh38)
Location 13:51084470-51084492
Sequence AGGTCCACCCATGGCCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502903_1108502922 30 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502903_1108502919 24 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502919 13:51084517-51084539 AAGGGGAAGGACGGGTGGTGAGG No data
1108502903_1108502909 5 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502909 13:51084498-51084520 GGACCTTGGCCTGGCCTTGAAGG No data
1108502903_1108502916 16 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502916 13:51084509-51084531 TGGCCTTGAAGGGGAAGGACGGG No data
1108502903_1108502906 -9 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502906 13:51084484-51084506 GGTGGACCTCAGCTGGACCTTGG No data
1108502903_1108502911 7 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502911 13:51084500-51084522 ACCTTGGCCTGGCCTTGAAGGGG No data
1108502903_1108502915 15 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502915 13:51084508-51084530 CTGGCCTTGAAGGGGAAGGACGG No data
1108502903_1108502918 19 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502918 13:51084512-51084534 CCTTGAAGGGGAAGGACGGGTGG No data
1108502903_1108502920 25 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data
1108502903_1108502907 -4 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502907 13:51084489-51084511 ACCTCAGCTGGACCTTGGCCTGG No data
1108502903_1108502913 11 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502903_1108502910 6 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502910 13:51084499-51084521 GACCTTGGCCTGGCCTTGAAGGG No data
1108502903_1108502921 29 Left 1108502903 13:51084470-51084492 CCATGGGGGCCATGGGTGGACCT No data
Right 1108502921 13:51084522-51084544 GAAGGACGGGTGGTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502903 Original CRISPR AGGTCCACCCATGGCCCCCA TGG (reversed) Intergenic
No off target data available for this crispr