ID: 1108502905

View in Genome Browser
Species Human (GRCh38)
Location 13:51084479-51084501
Sequence GTCCAGCTGAGGTCCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108502905_1108502922 21 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502922 13:51084523-51084545 AAGGACGGGTGGTGAGGGCTGGG No data
1108502905_1108502921 20 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502921 13:51084522-51084544 GAAGGACGGGTGGTGAGGGCTGG No data
1108502905_1108502913 2 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502913 13:51084504-51084526 TGGCCTGGCCTTGAAGGGGAAGG No data
1108502905_1108502909 -4 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502909 13:51084498-51084520 GGACCTTGGCCTGGCCTTGAAGG No data
1108502905_1108502918 10 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502918 13:51084512-51084534 CCTTGAAGGGGAAGGACGGGTGG No data
1108502905_1108502919 15 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502919 13:51084517-51084539 AAGGGGAAGGACGGGTGGTGAGG No data
1108502905_1108502911 -2 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502911 13:51084500-51084522 ACCTTGGCCTGGCCTTGAAGGGG No data
1108502905_1108502910 -3 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502910 13:51084499-51084521 GACCTTGGCCTGGCCTTGAAGGG No data
1108502905_1108502915 6 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502915 13:51084508-51084530 CTGGCCTTGAAGGGGAAGGACGG No data
1108502905_1108502916 7 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502916 13:51084509-51084531 TGGCCTTGAAGGGGAAGGACGGG No data
1108502905_1108502920 16 Left 1108502905 13:51084479-51084501 CCATGGGTGGACCTCAGCTGGAC No data
Right 1108502920 13:51084518-51084540 AGGGGAAGGACGGGTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108502905 Original CRISPR GTCCAGCTGAGGTCCACCCA TGG (reversed) Intergenic